Preparation method and application of fusarium solani protoplast

Abstract

The invention discloses a lysate for preparing fusarium solani protoplast and application of the lysate, and belongs to the technical field of biology. The optimal formula of the lysate for preparing the fusarium solani protoplast obtained through orthogonal experimental design comprises driselase, lywallzyme of arthrobacter luteus and cellulase according to the mass ratio of 1: 3: 3, and a gene knockout strain of the fusarium solani is further obtained through a polyethylene glycol mediated protoplast transformation method. The lywallzyme of the arthrobacter luteus is used for replacing the lysozyme of the trichoderma harzianum, and the obtained cell wall lysis solution can effectively obtain the protoplast. The lysate provided by the invention is beneficial to protoplast preparation of fusarium solani, research on gene functions and the like, and provides a genetic transformation method reference for research on prevention and control of diseases caused by fusarium solani.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and particularly relates to a preparation method of Fusarium solani protoplasts and application thereof. Background Art

[0002] Protoplast preparation is an important technology in fungal biotechnology research. The most critical enzyme for the preparation of filamentous fungal protoplasts is Lysing Enzymes (Cat. No. L1412) extracted from Trichoderma harzianum. This enzyme inhibitor is exclusively produced by Sigma-Aldrich in the United States, but has now been discontinued. Therefore, it is urgent to find other enzymes and study new lysis solution formulas for protoplast preparation.

[0003] Fusarium solani is the main pathogen of soybean root rot, sweet potato root rot, potato dry rot and human fungal keratitis, and Fusarium solani in plants can also harm animals. Therefore, the study of pathogenicity and gene function of Fusarium solani is of great significance to food safety and human health.

[0004] Patent CN103865948A discloses a PEG-mediated genetic transformation method for sesame-specific protoplasts of Fusarium oxysporum, in which the protoplast lysate is formulated with 25 mg / mL of Driselase and 5 mg / mL of Lysing enzyme of Trichoderma harzianum, which can effectively prepare protoplasts of the filamentous fungus Fusarium oxysporum. However, the Lysing enzyme of Trichoderma harzianum, which is exclusively produced by Sigma-Aldrich, has been discontinued. Therefore, it is urgent to study the preparation of protoplasts that can replace the Lysing enzyme of Trichoderma harzianum. Summary of the invention

[0005] One of the purposes of the present invention is to provide a lysis solution for preparing protoplasts of Fusarium solani, so as to solve the problem that protoplasts are difficult to prepare due to the discontinuation of the lytic enzyme of Trichoderma harzianum.

[0006] The second object of the present invention is to provide a method for preparing protoplasts of Fusarium solani based on the above lysate, which has simple steps and low cost.

[0007] The third object of the present invention is to provide an application of the Fusarium solani protoplasts prepared by the above preparation method to solve the problem that experimental studies related to protoplasts such as protoplast-based gene knockout are difficult to conduct.

[0008] To achieve the above purpose, the technical solution adopted by the present invention is as follows:

[0009] In a first aspect, the present invention provides a lysis solution for preparing protoplasts of Fusarium solani, wherein the lysis solution comprises a composite enzyme, sodium chloride and a solvent, wherein the composite enzyme is composed of a disintegrating enzyme, a lytic enzyme and a cellulase in a mass ratio of 4-5:5-15:10-15, wherein the lytic enzyme is derived from Arthrobacter luteus, the concentration of the sodium chloride is 0.7 mol / L, and the solvent is water.

[0010] Preferably, the complex enzyme is composed of lyticase, cellulase and lysozyme in a mass ratio of 1:3:3.

[0011] In a second aspect, the present invention provides a method for preparing protoplasts of Fusarium solani based on the above lysate, comprising the following steps:

[0012] Step 1, weighing the lysing enzyme, the wall-dissolving enzyme, and the cellulase according to the formula ratio of the lysing solution of claim 1 or 2, respectively, dissolving them in a 0.7 mol / L sodium chloride aqueous solution, and then shaking to dissolve; centrifuging, absorbing the supernatant, filtering and sterilizing, and obtaining a lysing solution for protoplast preparation;

[0013] Step 2: Rinse the bacterial plate, filter the spores with sterilized three-layer lens paper, count the spores under a microscope, and add them to 20 mL of yeast extract liquid medium to make the spore concentration 10 5 cell / mL, and then culture at 28°C and 180rpm for 24h; filter the mycelium with sterilized three-layer clean paper, rinse and mix the mycelium with 10mL lysis solution, and lyse the mycelium in an incubator at 28°C and 95rpm;

[0014] Step 3: The mycelium is lysed for 3 to 4 hours, and the lysate is examined under a microscope using a hemocytometer. After the mycelium is fully lysed, it is filtered and rinsed to obtain protoplasts.

[0015] Preferably, in step 1, the centrifugal speed is 3500 rpm and the centrifugal time is 5 min.

[0016] Preferably, in step 2, the formula of the yeast extract liquid culture medium is: 3 g / L yeast extract, 10 g / L peptone, and 20 g / L glucose.

[0017] Preferably, in step 2 and step 3, the flushing uses a sterile 0.7 mol / L NaCl solution.

[0018] In a third aspect, the present invention provides application of the protoplasts prepared by the above method in knocking out genes of Fusarium solani.

[0019] Step 1: Select the sugar metabolism-related enzyme NECHADRAFT_58355 of Fusarium solani, and construct a DNA fragment using overlap extension PCR technology, in which the hygromycin resistance gene is used as a marker gene for transformant screening;

[0020] Step 2: 50% polyethylene glycol 4000 (PEG4000) is used to mediate the knockout fragment into protoplasts for gene knockout;

[0021] Step 3: Design verification primers for gene knockout within the open reading frame of the NECHADRAFT_58355 gene, and verify by PCR whether the target gene of the knockout transformant is knocked out.

[0022] Preferably, in step 2, the step of polyethylene glycol-mediated gene knockout is:

[0023] The protoplasts and the DNA fragments are fully mixed, and then allowed to stand on ice for 30 minutes; then, 1 mL of sterile 50% PEG4000 is slowly added dropwise, mixed evenly, and allowed to stand at room temperature for 30 minutes; after the transformation is completed, the protoplasts are slowly added to a cell wall regeneration liquid culture medium, and cultured at 28° C. and 95 rpm for 12 hours; then the cell wall regenerated protoplasts and the unsolidified transformant screening culture medium are mixed, poured into a plate, and cultured at 28° C. for 2 days; wherein the cell wall regeneration liquid culture medium: 1 g / L of acid hydrolyzed protein, 1 g / L of yeast extract, and 274 g / L of sucrose; the transformant screening culture medium: 50 μg / mL of ampicillin, 50 μg / mL of hygromycin, 1 g / L of acid hydrolyzed protein, 1 g / L of yeast extract, 274 g / L of sucrose, and 10 g / L of agar.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] 1. There are many domestic suppliers of the lytic enzyme of Arthrobacter luteus in the lysis solution for preparing protoplasts in the present invention, such as Shanghai Yuanye Biology (Article No. S10107). The optimized lysis solution formula can effectively obtain protoplasts, thereby replacing the lytic enzyme of Trichoderma harzianum produced exclusively by Sigma-Aldrich Company in the United States, thereby promoting the preparation of protoplasts of pathogens such as Fusarium solani and scientific and technological research at the protoplast level.

[0026] 2. The present invention optimizes the lysate formula. On the one hand, the lysate enzyme of Arthrobacter luteus, which is cheaper, is used to replace the lysate enzyme of Trichoderma harzianum. On the other hand, the cellulase, which has no lysing effect when used alone, is added to greatly improve the effect of the lysate. In addition, the price of cellulase is very low, which further reduces the cost of the lysate formula. Therefore, the lysate formula of the present invention has the advantages of wide reagents, high efficiency, and economical and affordable. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a diagram of the single factor experiment analyzing the effect of different enzymes on the preparation of Fusarium solani protoplasts;

[0028] Figure 2 This is an orthogonal experiment analyzing the effect of different lysis buffer combinations on the preparation of Fusarium solani protoplasts;

[0029] Figure 3 This is the result of PEG-mediated protoplast transformation experiment. DETAILED DESCRIPTION

[0030] The present invention is further described in detail below with reference to the accompanying drawings and specific embodiments.

[0031] Example 1: Single factor optimization of lysate formulation

[0032] Preparation of enzyme solution for protoplast lysis: 50 mg, 100 mg, 200 mg of disintegrating enzyme (Sigma, product number D9515), 100 mg, 200 mg, 400 mg, 800 mg of lytic enzyme (from Arthrobacter luteus, Yuanye Biotechnology, product number S10107), 100 mg, 200 mg, 400 mg, 600 mg of cellulase (Shanghai Ruiyong Biotechnology, product number RM1030) were respectively dissolved in 10 mL of 0.7 mol / L NaCl solution, then vortexed and dissolved, centrifuged at 3500 rpm for 5 min, the supernatant was aspirated, and filtered and sterilized with a 0.45 μm bacterial filter.

[0033] The concentration of Fusarium solani was 10 5 Spores of 1 cell / mL were cultured in 20mL yeast extract liquid medium (yeast extract 3g / L, peptone 10g / L, glucose 20g / L) at 28℃ and 180rpm shaking for 24h. Mycelia were filtered with sterilized three-layer clean paper and rinsed with sterile 0.7mol / L NaCl solution. Mycelia were then thoroughly mixed with 10mL lysis solution in a sterile 50mL volumetric flask, and then lysed in an incubator at 28℃ and 95rpm for 3h.

[0034] According to the microscopic examination results ( Figure 1 ) There were a small number of spherical protoplasts at 5 mg / mL of lysase, and the protoplast yield increased significantly with the increase of enzyme dosage, indicating that lysase had a good lysing effect. The mycelium of the lysase of Arthrobacter luteus was severely lysed at a concentration of 80 mg / mL, indicating that lysase had a certain lysing effect. However, cellulase had no obvious lysing effect.

[0035] Example 2: Orthogonal design optimization of lysate formulation

[0036] Based on the single-factor experimental results, an orthogonal experimental design was conducted for the enzymes of lysase, cellulase and lysase (see Table 1) to optimize the formula of the lysis solution.

[0037] Table 1 Optimization of lysate formulation L 9 3 3 Orthogonal array

[0038]

[0039] Similar to the experimental method of "Example 1", the enzyme was weighed and dissolved in 0.7 mol / L NaCl solution, and then the mycelium was lysed for 3 hours. The protoplasts obtained were as follows: Figure 2 .

[0040] The mycelial lysate was filtered with a sterile three-layer lens paper, and then the number of protoplasts was counted under a microscope. The number of protoplasts obtained in different enzyme treatment groups is shown in Table 2. According to the extreme results, the influence on the preparation of Fusarium solani protoplasts is cleavage enzyme> cellulase> lysozyme. The optimal formula of the protoplast lysate is cleavage enzyme 10 mg / mL, lysozyme 30 mg / mL, and cellulase 30 mg / mL.

[0041] Table 2 Experimental results of orthogonal design optimization of protoplast lysis enzyme solution formula

[0042]

[0043]

[0044] Example 3: Effect of PEG-mediated protoplast transformation

[0045] The sugar metabolism-related enzyme (NECHADRAFT_58355) of Fusarium solani was selected and the DNA fragment was constructed by overlap extension PCR technology. The hygromycin resistance gene was used as the marker gene for transformant screening, and the primers were designed using Primer Premier 5.

[0046] Overlap extension PCR technology is used to construct DNA fragments. Three rounds of PCR are required. The first round amplifies the upstream and downstream homologous fragments of the target gene: the first round upstream primers: GAATGTTAGTTAGCAGGAAGATGG (SEQ ID No. 1) and CGGATTTCACTCGCTTGTTA (SEQ ID No. 2); downstream primers: ACAGGCTTTCCCTTTGATAAT (SEQ ID No. 3) and TGTTATCGCCGTTGTTTCAGT (SEQ ID No. 4);

[0047] PCR reaction system of full-form gold HIFI enzyme (50μL): 5μL HIFI Buffer I, 1μL Template, 1μL Forward Primer (10μM), 1μL Reverse Primer (10μM), 4μL 2.5mM dNTPs, 0.5μL HIFI DNA Polymerase, Nuclease-free water to 50μL. Amplification conditions: 94℃ 3min; 94℃ 30s, 55℃ 30s (annealing temperature is the melting temperature of the primer with the lower melting temperature in the primer pair minus 5℃), 72℃ 1min, 30 cycles; 72℃ 10min; 4℃ 2h.

[0048] In the second round, the upstream and downstream homologous fragments were connected to the marker gene hygromycin resistance gene.

[0049] PCR reaction system of HIFI enzyme in the second round of PCR (50μL): 5μL HIFI Buffer I, Firstround PCR products (A:HygR:B=1:2:1), 4μL 2.5mM dNTPs, 0.5μL HIFI DNA Polymerase, Nuclease-free water to 50μL. Amplification conditions: 94℃3min; 94℃30s, 55℃2min, 68℃6min, 15 cycles; 72℃10min; 4℃2h.

[0050] In the third round, the fusion DNA fragment for knocking out the target gene was amplified in large quantities using the second round PCR product as a template, and the nucleotide sequence is shown in SEQ ID No.7.

[0051] The third round of upstream primer: GCAGCATCTCCCGTTCACTA (SEQ ID No. 5); downstream primer: TCGCCGTTGTTTCAGTAGAT (SEQ ID No. 6)

[0052] PCR reaction system of HIFI enzyme in three rounds of PCR (50 μL): 5 μL HIFI Buffer I, 5μL Second round PCR products, 1μL Forward Primer (10μM), 1μL Reverse Primer (10μM), 4μL 2.5mM dNTPs, 0.5μL HIFI DNA Polymerase, Nuclease-free water to 50μL. Amplification conditions: 94℃ 3min; 94℃ 30s, 55℃ 30s (annealing temperature is the melting temperature of the primer with the lower melting temperature in the primer pair minus 5℃), 72℃ 5min, 32 cycles; 72℃ 10min; 4℃ 2h.

[0053] Then, gene knockout was performed through 50% PEG4000 mediation. Protoplasts were prepared by optimizing the lysate obtained in "Example 2". Take 200 μL of protoplasts and slowly add the DNA fragment solution, and the volume of the DNA fragment solution is less than 100 μL. The protoplasts and DNA fragments were fully mixed, and then allowed to stand on ice for 30 minutes. Then, 1 mL of sterile 50% PEG4000 was slowly added dropwise, and after mixing evenly, it was allowed to stand at room temperature for 30 minutes. When the transformation is completed, 5 mL of cell wall regeneration liquid culture medium (acid hydrolyzed protein 1 g / L, yeast extract 1 g / L, sucrose 274 g / L) was slowly added to the protoplasts, and cultured at 28 ° C and 95 rpm for 12 hours. Then, the cell wall revived protoplasts were mixed with unsolidified screening medium (1 g / L acid hydrolyzed protein, 1 g / L yeast extract, 274 g / L sucrose, 10 g / L agar) containing 50 μg / mL ampicillin and 50 μg / mL hygromycin, and poured into plates. After culturing at 28°C for 2 days, the transformants were picked and transferred to potato medium (200 g / L potato, 20 g / L glucose, 15 g / L agar), and then DNA was extracted and PCR was used to verify whether the target gene was knocked out.

[0054] The system and conditions of the PCR reaction for transformant verification were the same as those for the first round of overlap extension PCR. The verification primers (SEQ ID No.8: forward primer CACCACCAACAACCTGAGAC, SEQ ID No.9: reverse primer CGCAAGTACCGATGATAAGAC) were used to amplify a DNA fragment (SEQ ID No.10) of 1479 bp in the ORF of the wild-type NECHADRAFT_58355 gene, while the gene knockout strain did not have this fragment. Figure 3 As shown, two gene knockout strains were obtained by PEG-mediated protoplast transformation experiment using cells obtained from the best lysate optimized in "Example 2".

[0055] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principle of the present invention should be covered by the protection scope of the present invention.

Claims

1. A lysate for preparing protoplasts of Fusarium solani, characterized in that: The lysis solution comprises a composite enzyme, sodium chloride and a solvent. The composite enzyme is composed of a disintegrating enzyme, a wall-dissolving enzyme and a cellulase in a mass ratio of 4-5:5-15:10-15. The wall-dissolving enzyme is derived from Arthrobacter luteus. The concentration of the sodium chloride is 0.7 mol / L. The solvent is water.

2. A lysate for preparing protoplasts of Fusarium solani according to claim 1, characterized in that: The complex enzyme consists of lysase, cellulase and cellulose in a mass ratio of 1:3:

3.

3. A method for preparing protoplasts of Fusarium solani based on the lysate according to claim 1 or 2, characterized in that: The steps include: Step 1, weighing the lysing enzyme, the wall-dissolving enzyme, and the cellulase according to the formula ratio of the lysing solution of claim 1 or 2, respectively, dissolving them in a 0.7 mol / L sodium chloride aqueous solution, and then shaking to dissolve; centrifuging, absorbing the supernatant, filtering and sterilizing, and obtaining a lysing solution for protoplast preparation; Step 2: Rinse the bacterial plate, filter the spores with sterilized three-layer lens paper, count the spores under a microscope, and add them to 20 mL of yeast extract liquid medium to make the spore concentration 10 5 cell / mL, and then culture at 28°C and 180rpm for 24h; filter the mycelium with sterilized three-layer clean paper, rinse and mix the mycelium with 10mL lysis solution, and lyse the mycelium in an incubator at 28°C and 95rpm; Step 3: The mycelium is lysed for 3 to 4 hours, and the lysate is examined under a microscope using a hemocytometer. After the mycelium is fully lysed, it is filtered and rinsed to obtain protoplasts.

4. The method for preparing protoplasts of Fusarium solani according to claim 3, characterized in that: In step 1, the centrifugal speed is 3500 rpm and the centrifugal time is 5 min.

5. The method for preparing protoplasts of Fusarium solani according to claim 3, characterized in that: In step 2, the formula of the yeast extract liquid culture medium is: 3 g / L yeast extract, 10 g / L peptone, and 20 g / L glucose.

6. The method for preparing protoplasts of Fusarium solani according to claim 3, characterized in that: In step 2 and step 3, the flushing uses a sterile 0.7 mol / L NaCl solution.

7. Use of the protoplasts prepared by the method according to any one of claims 3 to 6 for knocking out genes of Fusarium solani, characterized in that: The following steps are involved: Step 1: Select the sugar metabolism-related enzyme NECHADRAFT_58355 of Fusarium solani, and construct a DNA fragment using overlap extension PCR technology, in which the hygromycin resistance gene is used as a marker gene for transformant screening; Step 2: knockout the gene by introducing the knockout fragment into protoplasts through 50% polyethylene glycol 4000; Step 3: Design verification primers for gene knockout within the open reading frame of the NECHADRAFT_58355 gene, and verify by PCR whether the target gene of the knockout transformant is knocked out.

8. The use according to claim 7, characterized in that: In step 2, the steps of polyethylene glycol-mediated gene knockout are: The protoplasts and DNA fragments are fully mixed, and then allowed to stand on ice for 30 minutes; then, 1 mL of sterile 50% polyethylene glycol 4000 is slowly added dropwise, mixed evenly, and allowed to stand at room temperature for 30 minutes; after the transformation is completed, the protoplasts are slowly added to a cell wall regeneration liquid culture medium, and cultured at 28° C. and 95 rpm for 12 hours; then the cell wall regenerated protoplasts and the unsolidified transformant screening culture medium are mixed, poured onto a plate, and cultured at 28° C. for 2 days; wherein the formula of the cell wall regeneration liquid culture medium is: 1 g / L of acid hydrolyzed protein, 1 g / L of yeast extract, and 274 g / L of sucrose; the formula of the transformant screening culture medium is: 50 μg / mL of ampicillin, 50 μg / mL of hygromycin, 1 g / L of acid hydrolyzed protein, 1 g / L of yeast extract, 274 g / L of sucrose, and 10 g / L of agar.

Images