Kit for detecting miRNAs markers of hepatitis B related liver cancer

Abstract

The invention discloses a kit for detecting miRNAs markers of hepatitis B related liver cancer, and provides a kit for detecting miR-421 (a kit for diagnosing hepatitis B related liver cancer), the kit comprises a specific amplification primer and reagents (a nucleic acid extraction reagent, a polymerase chain reaction reagent and the like) required by PCR (Polymerase Chain Reaction) amplification, the reagent in the kit is a qPCR method detection reagent, and the qPCR method detection reagent in the kit comprises a reverse transcription primer and / or a qPCR amplification primer of the miRNA marker. And a reliable technical guarantee is provided for taking the circulating miRNA as a tumor noninvasive diagnosis marker.

Description

Technical Field

[0001] The invention belongs to the technical field of nucleic acid detection, and in particular relates to a kit for detecting miRNAs markers of hepatitis B-related liver cancer. Background Art

[0002] Currently, 75-85% of liver cancer is related to chronic hepatitis B virus (HBV) infection. High HBV DNA load is considered to be one of the important risk factors for recurrence and poor prognosis of HBV-related liver cancer. There have been studies on HBV. For example, Chinese patent application number CN200980104816, Application of serum-plasma miRNA in early diagnosis of HBV infection and liver cancer, mentions a microRNA combination for distinguishing normal people from HCV-infected people, HBV-infected people and HBV liver cancer patients, and its application in early diagnosis of HBV infection and HBV-related liver cancer. The microRNA combination consists of miR-23b, miR-423-5p, miR-375, miR-23a and miR-342-3p. The combination contains all microRNAs that are differentially expressed in the serum / plasma of normal people and HCV-infected people, HBV-infected people and HBV liver cancer patients. A kit containing the microRNA and capable of being used for early diagnosis of HBV infection and HBV-positive liver cancer and a preparation method thereof are also provided. The kit mainly has the characteristics of high specificity and high sensitivity. Another example is Chinese patent application No. CN201510455558, which is a miRNA combination and a kit for diagnosing early liver cancer. The kit includes: a detection reagent for specifically detecting human hsa-miR-193a-3p; a detection reagent for specifically detecting human hsa-miR-369-5p; a detection reagent for specifically detecting human hsa-miR-672; a detection reagent for specifically detecting human hsa-miR-429; and a detection reagent for specifically detecting human let-7i*; the detection reagents are RNA reverse transcription primers, DNA amplification primers and DNA probes.

[0003] Although there have been significant advances in the early diagnosis and treatment of liver cancer, 60-70% of patients still experience recurrence and metastasis within 5 years after radical resection. Studies have shown that hepatitis activity in residual liver tissue after liver resection is associated with tumor recurrence. Conventional treatments for hepatocellular carcinoma (HCC), such as surgical resection, hepatic artery chemoembolization, and systemic chemotherapy, can activate HBV replication, especially in HBV-related HCC patients who have not received any antiviral treatment. Currently, alpha-fetoprotein (AFP) is mainly used in clinical practice in combination with imaging and pathological examinations for early diagnosis of liver cancer, but the specificity and sensitivity of AFP for liver cancer screening are not ideal; and biopsy is invasive and can cause discomfort and fear in patients. Therefore, how to efficiently monitor the recurrence and metastasis of patients with chronic hepatitis B virus infection who develop liver cancer and hepatitis B-related liver cancer after treatment is a very important research topic in clinical practice.

[0004] At present, the detection of miRNA tumor markers in tissues, serum or plasma is used as a reference for the diagnosis of hepatitis B-related liver cancer. MiRNA is a single-stranded small molecule RNA widely present in eukaryotic cells. It is directly involved in the transcription and translation of protein encoding. By targeting the 3' untranslated region (UTR) of mRNA, it degrades mRNA or inhibits its normal transcription and translation. More and more studies have found that the expression profile of miRNA has obvious tissue specificity and has specific expression patterns in different tumors. These characteristics make miRNA a new biological marker and therapeutic target for tumor diagnosis. In addition, studies have found that abnormally expressed miRNA is closely related to the occurrence and development of HBV-HCC, viral replication, recurrence, invasion, metastasis and apoptosis. In the study, it was found that miR-421 and miR-106b-3p were abnormally highly expressed in HBV-HCC, and their expression levels were significantly higher than those in normal liver tissue and other HCC, while miR-15a-3p showed the opposite result of significantly low expression. On this basis, it is necessary to develop miRNA markers for hepatitis B-related liver cancer and prepare peripheral blood detection kits related to them. Summary of the invention

[0005] The purpose of the present invention is to provide a kit for detecting miRNAs markers of hepatitis B related liver cancer, using miR-421, miR-106b-3p and miR-15a-3p as miRNA markers of hepatitis B related liver cancer, and preparing a peripheral blood detection kit containing the miRNA markers of hepatitis B related liver cancer, which is used for efficiently monitoring the occurrence of liver cancer in chronic hepatitis B virus infection, recurrence and metastasis of hepatitis B related liver cancer patients after treatment, etc.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] A kit for detecting hepatitis B-related liver cancer, comprising the reagents required for specific detection of the above-mentioned miR-421, miR-106b-3p and miR-15a-3p as miRNA markers for hepatitis B-related liver cancer, as well as specific amplification primers and reagents required for PCR amplification;

[0008] The reagent for the miRNA marker of hepatitis B-related liver cancer is a qPCR detection reagent, including a reverse transcription primer and / or a qPCR amplification primer of the miRNA marker;

[0009] The reagents required for PCR amplification are nucleic acid extraction reagents and polymerase chain reaction reagents.

[0010] The present invention also provides a method for using the above-mentioned kit for detecting hepatitis B-related liver cancer to detect the specific amplification of serum hsa-mir-421, hsa-miR-15a-3p and hsa-miR-106b-3p mature bodies, first extracting serum microRNA, then adding a polyA tail to its 3' end with a poly(A) polymerase, reverse transcribed into cDNA under the action of a reverse transcriptase, and amplified by Real-time PCR, comprising the following steps:

[0011] 1) Total RNA extraction was performed according to the steps provided by Trizol (Invitrogen):

[0012] 2) The reverse transcription process of cDNA synthesis was carried out according to the steps provided by One Step miRNA cDNA Synthesis Kit (Haigene):

[0013] 3) Real-time PCR was performed according to the steps provided by 2×SYBR Green PCR Mastermix (Solarbio).

[0014] Compared with the prior art, the present invention has the following advantages:

[0015] 1. The miRNAs for detecting hepatitis B related liver cancer described in the present invention use miR-421, miR-106b-3p and miR-15a-3p as miRNA marker kits for hepatitis B related liver cancer and their applications. The markers have high sensitivity and high specificity and are used to efficiently monitor the occurrence of liver cancer in chronic hepatitis B virus infection, recurrence and metastasis of hepatitis B related liver cancer patients after treatment, etc.

[0016] 2. The miRNAs for detecting hepatitis B related liver cancer described in the present invention use miR-421, miR-106b-3p and miR-15a-3p as a kit for hepatitis B related liver cancer. The qPCR adopted is the most commonly used method for detecting the expression of known miRNAs. It is rapid, simple, and has good reproducibility. It can also very sensitively and accurately quantitatively analyze the expression of miRNAs. It is the most important method in clinical applications. This provides a reliable technical guarantee for the use of circulating miRNAs as non-invasive diagnostic markers for tumors. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 is a graph showing the expression levels of miR-421 and miR-106b-3p in HBV-related liver cancer cells (Hepg2.2.15) according to an embodiment of the present invention;

[0018] Figure 2 This is a diagram showing an embodiment of the present invention using miR-15a-3p mimic to enhance the effect of miR-15a-3p. DETAILED DESCRIPTION

[0019] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present invention, so the present invention is not limited by the specific implementation disclosed below.

[0020] Example:

[0021] A kit for detecting hepatitis B-related liver cancer, using miR-421, miR-106b-3p and miR-15a-3p as miRNA markers for hepatitis B-related liver cancer, including specific amplification primers and reagents required for PCR amplification (nucleic acid extraction reagents, polymerase chain reaction reagents, etc., which are conventional reagents), and the detection system includes:

[0022] 1) Serum microRNA extraction system:

[0023] 2) Reverse transcription system: composed of reverse transcription system reagents, including reverse transcriptase buffer, reverse transcription primers, and reverse transcriptase;

[0024] 3) Amplification system: composed of a real-time fluorescence quantitative PCR reaction system, which includes amplification primers of the diagnostic marker, cDNA, RNase-free water and SYBR Green polymerase chain reaction system, wherein the amplification primers are composed of a forward primer and a reverse primer, and the forward primer is as described in part "I";

[0025] 4) Quantitative internal reference standardization system: composed of the internal reference RNU6 primer, the sequence of the internal reference RNU6 primer is: AGAGAAGATTAGCATGGCCCCT;

[0026] The composition of the kit is shown in Table 1:

[0027] Serial number composition quantity 1 Trizol 30ml 2 Chloroform 15ml 3 Isopropyl alcohol 15ml 4 75% ethanol (prepared with DEPC water) 30ml 5 DEPC water 30ml 6 OnestepmiRNARTSolution 5ml 7 miRNARTPrimer 2OD value 8 <![CDATA[RnaseFreeH2O]]> 15ml 9 SYBR Green qPCR Mix (2X) 5ml 10 ForwardPrimer 2OD value 11 ReversePrimer 2OD value

[0028] 5) The reverse transcription process of cDNA synthesis was carried out according to the steps provided by One Step miRNA cDNA Synthesis Kit (Haigene); poly A tailing and reverse transcription were completed in one step, and the reverse transcription primer sequence was: 5'-CAGGTCCAGTTTTTTTTTTTTTTTCT-3':

[0029] >hsa-miR-421MIMAT0003339 sequence: AUCAACAGACAUUAAUUGGGCGC

[0030] Upstream primer F:gcgcagatcaacagacat

[0031] Downstream primer R: gtttttttttttttttttgcgcccaa

[0032] >hsa-miR-15a-3p MIMAT0004488 sequence: CAGGCCAUAUUGUGCUGCCUCA

[0033] Upstream primer F:gcagcaggccatattgtg

[0034] Downstream primer R: ggtccagttttttttttttttttgag

[0035] >hsa-miR-106b-3p MIMAT0004672 sequence: CCGCACUGUGGGUACUUGCUGC

[0036] Upstream primer F:cgcactgtgggtacttg

[0037] Downstream primer R:gtccagttttttttttttttttgcag

[0038] 6) Extraction of serum miRNAs:

[0039] ① Collect whole blood as the sample source using a coagulation tube. After complete coagulation, immediately centrifuge at 3000×g for 10 minutes at 4°C, transfer the supernatant, and centrifuge the supernatant at 16000×g for 10 minutes at 4°C. The supernatant is the serum sample;

[0040] ②Take 0.5ml of serum sample and add 2ml of Trizol. Leave at room temperature for 5 minutes;

[0041] ③ Add 0.4 ml of chloroform per ml of Trizol, mix for 15 seconds, and leave at room temperature for 5 minutes;

[0042] ④ Centrifuge at 12000 rpm and 4℃ for 15 minutes, and pipette the upper colorless aqueous phase containing total RNA into a new centrifuge tube. About 0.5 ml can be pipetted for each ml of Trizol.

[0043] ⑤ Add 1 ml of isopropanol for every ml of initial Trizol, invert several times to mix, and precipitate in a -70°C refrigerator overnight;

[0044] ⑥ Centrifuge at 12,000 rpm and 4°C for 10 minutes. RNA precipitate can be seen at the bottom of the tube. Discard the supernatant.

[0045] ⑦ Add 1 ml of 75% ethanol (prepared with DEPC water) to each ml of the original Trizol and mix by inversion;

[0046] ⑧ Centrifuge at 7,500 rpm and 4°C for 5 minutes and discard the supernatant;

[0047] ⑨After the RNA is slightly dry, add 20 μl DEPC water to dissolve it and freeze it at -70℃ for later use;

[0048] 7) miRNAs plus Poly(A) tail structure and reverse transcription to synthesize cDNA:

[0049] ① Prepare the reverse transcription reaction solution according to the following components:

[0050]

[0051] Note: miRNA RT Primer primer is 5'-CAGGTCCAGTTTTTTTTTTTTTTTVN-3'

[0052] ② Perform the reaction on the PCR instrument according to the following conditions:

[0053] 37℃60min

[0054] 95℃5min

[0055] ③After obtaining the cDNA product, use a fluorescent quantitative PCR kit to perform quantitative detection of miRNA.

[0056] 8) Real-time PCR detection:

[0057] ① Melt and mix the various solutions required for PCR reaction. Set up the PCR reaction system on an ice bath (taking a 96-well plate as an example):

[0058]

[0059] ②Real-time PCR reaction procedure:

[0060] a. Pre-denaturation: 95℃ 2min

[0061] b. Denaturation: 95℃ 15sec

[0062] c. Annealing / extension: 60℃ 15-30sec

[0063] d. Repeat steps b and c for a total of 40 cycles

[0064] e. Analyze the results using the software provided by the fluorescence quantitative PCR instrument

[0065] Summarize:

[0066] Figure 1 In the results, the expression levels of miR-421 and miR-106b-3p in HBV-related hepatoma cells (Hepg2.2.15) were significantly higher than those in hepatoma cells (HepG 2) and normal cells (LO2); on the contrary, miR-15a-3p was lowly expressed.

[0067] Figure 2 In the above, A uses miR-15a-3p mimic to enhance the effect of miR-15a-3p, or uses miR-421inhibitor and miR-106b-3p inhibitor to inhibit the effects of miR-421 and miR-106b-3p respectively, which can significantly inhibit the proliferation of HBV-related liver cancer cells; B and promote the apoptosis of HBV-related liver cancer cells.

[0068] The above-mentioned embodiments merely express several implementation modes of the present invention, and the description thereof is relatively specific and detailed, but it should not be understood as limiting the scope of the present invention.

Claims

1. A kit for detecting hepatitis B-related liver cancer, characterized in that: The invention comprises the reagents required for specific detection of the above-mentioned miR-421, miR-106b-3p and miR-15a-3p as miRNA markers for hepatitis B-related liver cancer, as well as specific amplification primers and reagents required for PCR amplification; The reagent for the miRNA marker of hepatitis B-related liver cancer is a qPCR detection reagent, including a reverse transcription primer and / or a qPCR amplification primer of the miRNA marker; The reagents required for PCR amplification are nucleic acid extraction reagents and polymerase chain reaction reagents.

2. A method for detecting specific amplification of mature hsa-mir-421, hsa-miR-15a-3p and hsa-miR-106b-3p in serum by using a kit for detecting hepatitis B-related liver cancer according to claim 1, characterized in that: First, serum microRNA is extracted, and then poly(A) polymerase is used to add a polyA tail to its 3' end, reverse transcribed into cDNA under the action of reverse transcriptase, and amplified by real-time PCR, including the following steps: 1) Total RNA extraction was performed according to the steps provided by Trizol Invitrogen: 2) The reverse transcription process of cDNA synthesis was carried out according to the steps provided by One Step miRNA cDNA Synthesis Kit Haigene: 3) Real-time PCR process was carried out according to the steps provided by 2×SYBR Green PCR Mastermix Solarbio.

Images