SgRNA for detecting vibrio parahaemolyticus and application of sgRNA in RPA-CRISPR / Cas12b detection

Abstract

The invention discloses sgRNA (small guide ribonucleic acid) for detecting vibrio parahaemolyticus and application of the sgRNA in RPA-CRISPR / Cas12b detection. The sgRNA comprises a vibrio parahaemolyticus target sequence as shown in SEQ ID NO. 1. The RPA-CRISPR / Cas12b detection method disclosed by the invention comprises the following steps: firstly, carrying out RPA amplification on a sample to be detected, wherein the nucleotide sequence of a used primer is as shown in SEQ ID NO.2-3; and performing CRISPR / Cas12b detection on the RPA amplification product by using the sgRNA, reading a fluorescence signal by naked eyes under 485nm exciting light after the CRISPR / Cas12b detection is finished, if the fluorescence signal exists, determining that the to-be-detected sample contains vibrio parahaemolyticus, and if the fluorescence signal does not exist, determining that the to-be-detected sample does not contain vibrio parahaemolyticus. The lowest detection limit of the detection method is 100 CFU / mL of bacterial concentration, and the detection method is high in specificity, wide in application range, not limited by site environment and professional skills of operators, easy to operate, capable of being used for rapid detection of vibrio parahaemolyticus in actual aquatic product samples and accurate in result.

Description

Technical Field

[0001] The present invention relates to an sgRNA for detecting Vibrio parahaemolyticus and application thereof in RPA-CRISPR / Cas12b detection, belonging to the field of biotechnology. Background Art

[0002] Vibrio parahaemolyticus is an important foodborne zoonosis pathogen, widely found in oceans, estuaries and a variety of aquatic products. It enters the human body through contaminated water or aquatic products, usually causing acute gastroenteritis with abdominal pain, vomiting, fever and other symptoms. In severe cases, dehydration, shock and even death may occur. It poses a serious threat to aquaculture and human health. Only through rapid detection of Vibrio parahaemolyticus can the spread and occurrence of related diseases be effectively prevented.

[0003] At present, the method used to detect Vibrio parahaemolyticus is mainly the traditional isolation and culture method, but the overall detection time is long and the operation is cumbersome, which is not suitable for the needs of actual sample detection. In addition, other detection methods such as immunology and molecular biology also have limitations to varying degrees due to high costs and dependence on professionals.

[0004] Recombinase Polymerase Amplification (RPA) is a new nucleic acid isothermal amplification technology developed by Piepenburg et al. in 2006. Compared with conventional PCR, RPA amplification is more sensitive, simpler in procedure and shorter in time. Under the constant temperature of 37-45°C, only a small amount of nucleic acid sample is needed to complete the amplification. Its simple operation and inclusiveness of samples show great potential in on-site rapid detection.

[0005] In recent years, the CRISPR-Cas (clustered regularly interspaced short palindromic repeats, Crispr-associated proteins) detection system developed based on Cas12b protein has rapidly emerged. The CRISPR-Cas system consists of a CRISPR gene sequence and a relatively conservative Cas gene, which is present in about 83% of archaea and 45% of bacteria. The CRISPR locus consists of a leader, a repeat, and a spacer. Most notably, the Cas12 family has the ability to cleave in trans. CRISPR records exogenous nucleic acids, and the Cas protein-crRNA forms a binary complex that recognizes the substrate and cuts it. At the same time, it indiscriminately cuts free single-stranded nucleic acids in the environment. Using this feature, coupled with isothermal amplification technology, on-site detection can be performed immediately.

[0006] At present, there are reports on the detection of Vibrio parahaemolyticus using CRISPR-Cas12a, but its specific target coverage is not comprehensive, and there are few reports on the detection of Vibrio parahaemolyticus using RPA combined with CRISPR / Cas12b. Therefore, the establishment of a PRA-CRISPR system for the detection of all Vibrio parahaemolyticus plays an important role in the prevention and control of this bacterium. Summary of the invention

[0007] Purpose of the invention: The first purpose of the present invention is to provide a sgRNA for detecting Vibrio parahaemolyticus, its preparation method and application. The second purpose of the present invention is to provide a kit and specific detection method for RPA-CRISPR / Cas12b detection of Vibrio parahaemolyticus.

[0008] Technical solution: The present invention provides a sgRNA for detecting Vibrio parahaemolyticus, wherein the sgRNA comprises a Vibrio parahaemolyticus target sequence as shown in SEQ ID NO.1.

[0009] The present invention also provides a method for preparing the above-mentioned sgRNA for detecting Vibrio parahaemolyticus, the method comprising the following steps: combining the Vibrio parahaemolyticus target sequence shown in SEQ ID NO.1 with the sgRNA fixed sequence, and then connecting with the pUC18 plasmid to construct a sgRNA-spacer-pUC18 recombinant plasmid; amplifying, in vitro transcribing and purifying using the recombinant plasmid as a template to obtain sgRNA.

[0010] Specifically, the fragment sequence after combining the Vibrio parahaemolyticus target sequence shown in SEQ ID NO.1 with the sgRNA fixed sequence is shown in SEQ ID NO.12.

[0011] The present invention also provides the use of the above-mentioned sgRNA for detecting Vibrio parahaemolyticus in preparing a kit for detecting Vibrio parahaemolyticus.

[0012] The present invention also provides a Vibrio parahaemolyticus RPA-CRISPR / Cas12b detection kit, which comprises an sgRNA comprising a Vibrio parahaemolyticus target sequence as shown in SEQ ID NO.1, and a primer pair for amplifying the Vibrio parahaemolyticus target sequence as shown in SEQ ID NO.1.

[0013] Furthermore, the nucleotide sequence of the primer pair is shown in SEQ ID NOs.8-9.

[0014] Furthermore, the kit also includes RPA amplification reagents and CRISPR / Cas12b detection reagents, positive and negative controls.

[0015] Furthermore, the RPA amplification reagent includes polymerase dry powder, Buffer A, Buffer B, and ddH2O.

[0016] Furthermore, the CRISPR / Cas12b detection reagent includes a detection buffer 10×HOLMES Buffer, a fluorescent signal reporter molecule, ddH2O, and a Cas12b protein.

[0017] The present invention also provides a Vibrio parahaemolyticus RPA-CRISPR / Cas12b detection method, wherein the sample to be tested is first subjected to RPA amplification, and the nucleotide sequences of the primers used are shown in SEQ ID NOs. 2 to 3; then the RPA amplification product is subjected to CRISPR / Cas12b detection using the above-mentioned sgRNA, and after the CRISPR / Cas12b detection is completed, the fluorescent signal is read with the naked eye under 485nm excitation light. If there is a fluorescent signal, the sample to be tested contains Vibrio parahaemolyticus, and if there is no fluorescent signal, the sample to be tested does not contain Vibrio parahaemolyticus.

[0018] Furthermore, the reaction conditions for the RPA amplification are 43°C for 30 min; and the CRISPR / Cas12b detection reaction conditions are 48°C for 30 min.

[0019] Beneficial effects: Compared with the prior art, the present invention has the following outstanding advantages: the minimum detection limit of the detection method of the present invention is 10 0 CFU / mL, with strong specificity and wide application range, it is not limited by the site environment and the professional skills of the operator. It is easy to operate and can be used for the rapid detection of Vibrio parahaemolyticus in actual aquatic product samples with accurate results. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 It is the sgRNA-space connecting the specific target and the sgRNA fixed sequence. The red part is the sgRNA fixed sequence, the pink marked part is the PAM sequence, here is TTA, and the orange marked part is the target specific sequence.

[0021] Figure 2 This is the electrophoresis of the amplified products of the RPA primer screening experiment of Vibrio parahaemolyticus in Example 1. Lane M is: DL2000 Marker (Novozyme); Lane 1 is the amplified product of RPA-F1 / R1 primers; Lane 2 is the amplified product of RPA-F2 / R2 primers, Lane 3 is the amplified product of RPA-F3 / R3 primers, and Lane 4 is the amplified product of RPA-F4 / R4 primers.

[0022] Figure 3 This is the electrophoresis diagram of the amplification products with increased amplification temperature in the RPA primer screening experiment of Example 1. Lane M is: DL2000 Marker (Novozymes); Lane 1 is the amplification product of RPA-F4 / R4 primers.

[0023] Figure 4 : This is a performance verification result diagram of the RPA-CRISPR / Cas12b detection kit of Example 2. Among them, PCR tube 1 is a positive reaction tube containing the target bacterium Vibrio parahaemolyticus DNA, PCR tube 2 is a negative control without the addition of Cas12b protein; PCR tube 3 is a negative control without the addition of sgRNA; PCR tube 4 is a negative control without the addition of Vibrio parahaemolyticus DNA; PCR tube 5 is a negative control with only the presence of fluorescent signal molecules.

[0024] Figure 5 This is the result of the single DNA template specificity test of the RPA-CRISPR / Cas12b detection system in Example 3. Among them, PCR tube 1 contains Vibrio parahaemolyticus, PCR tubes 2-9 contain non-target bacteria, followed by Vibrio mimicus, Vibrio alginolyticus, Aeropsymonas hydrophila, Edwardsiella, Vibrio campendii, Vibrio anguillarum, Pseudomonas aeruginosa, and Salmonella enteritidis, and PCR tubes 10-11 are negative controls.

[0025] Figure 6 This is a result diagram of the specificity test of the mixed DNA template of the RPA-CRISPR / Cas12b detection system in Example 3. PCR tubes 1-2 contain mixed DNA templates containing Vibrio parahaemolyticus, PCR tubes 3-4 contain mixed DNA templates without Vibrio parahaemolyticus, and PCR tubes 5-6 are negative controls.

[0026] Figure 7Result diagram of the sensitivity test of the RPA-CRISPR / Cas12b detection system in Example 4. The DNA of the Vibrio parahaemolyticus bacterial solution was used as the detection template, wherein the concentrations of the Vibrio parahaemolyticus bacterial solution in PCR tubes 1-7 were 10 5 CFU / mL, 10 4 CFU / mL, 10 3 CFU / mL, 10 2 CFU / mL, 10 1 CFU / mL, 10 0 CFU / mL, 10 -1 CFU / mL, PCR tubes 8-9 are negative controls.

[0027] Figure 8 This is a graph of the detection results of the RPA-CRISPR / Cas12b detection system for isolates from different sources in Example 5. Among them, PCR tubes 1-15 are human isolates, 16-24 are marine isolates, 25-34 are freshwater product isolates, 35-44 are marine farm isolates, and 45-56 are freshwater farm isolates. The above order corresponds to Table 3, 57 is a positive control, and 58-59 are negative controls.

[0028] Fig. 9 This is a result diagram of the simulated contamination detection using the RPA-CRISPR / Cas12b detection kit of Example 6. PCR tube 1 is a positive control, 2-4 are shrimp meat samples tested after simulated contamination by Vibrio parahaemolyticus, PCR tubes 5-6 are blank shrimp meat samples not contaminated by Vibrio parahaemolyticus, and PCR tubes 7-8 are negative controls. DETAILED DESCRIPTION

[0029] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0030] Example 1. Design and screening of sgRNA and RPA primers and establishment of RPA-CRISPR / Cas12b detection system 1. Design of sgRNA

[0031] First, the conserved sequences in Vibrio parahaemolyticus from different sources were screened by using freshwater food source strains, freshwater aquaculture source strains, seawater food source strains, seawater aquaculture source strains, and clinical source strains preserved in the laboratory (specific strain information is shown in Table 1), and the Blastn online alignment software (http: / / blast.ncbi.nlm.nih.gov / Blast.cgi) was used in NCBI to search for Vibrio parahaemolyticus-specific conserved sequences in the whole genome database to ensure that the sequence can distinguish Vibrio parahaemolyticus from other species. Finally, a 20bp gene sequence (SEQ ID NO.1) was selected as the specific detection target for Vibrio parahaemolyticus.

[0032] Table 1

[0033] Serial number name Strain number 1 Vibrioparahaemolyticus RIMD2210633 2 Vibriomimicus ATCC33653 3 Vibrioalginolyticus EPGS 4 Aeromonashydrophila ATCC35654 5 Edwardsiellatarda EIB202 6 Vibriocampbellii ATCC25920 7 Vibrio anguillarum ATCC43309 8 Pseudomonas plecoglossicida ATCC700383 9 Salmonella Enteritidis P125109

[0034] like Figure 1 As shown, the specific target spacer (SEQ ID NO.1) was combined with the sgRNA fixed sequence to design a Vibrio parahaemolyticus-specific sgRNA-space (SEQ ID NO.12: GAAATTAATACGACTCACTATAGG GGTCTAGAGGACAGAATTTTTCAACGGGTGTGCCAATGGCCACTTTCCAGGTGGC AAAGCCCGTTGAGCTTCTCAAATCTGAGAAGTGGCACACTGTGGTGTTGCCTTTG TC). The plasmid pUC18-sgRNA containing the target sequence was constructed. The pUC18-sgRNA recombinant plasmid was synthesized by GenScript Biotech Co., Ltd.

[0035] 2. RPA Primer Design and Screening

[0036] Primer design and synthesis: RPA primers (SEQ ID NO. 2-9) were artificially designed based on the specific conservative sequences of Vibrio parahaemolyticus obtained by screening and the requirements for RPA primer design. RPA primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0037] Table 2

[0038]

[0039] 1. Genome extraction

[0040] The genome of Vibrio parahaemolyticus RIMD2210633 was extracted using a genomic DNA extraction kit (Tiangen Biochemical Technology (Beijing) Co., Ltd.), and the extracted DNA was accurately quantified using a Nanodrop ultra-micro-volume spectrophotometer (Thermo Fisher Scientific).

[0041] 2. Primer amplification

[0042] The RPA amplification reaction was performed using the DNA isothermal amplification kit of Anpu Future Biotech Co., Ltd. The specific ratio of the reaction system was as follows: 29.7 μL Buffer A, 5 μL template DNA, 9 μL ddH2O, and 2 μL each of upstream and downstream primers (10 μM) were added to the RPA enzyme lyophilized powder, and finally 2.5 μL Buffer B was added. The tube was inverted 8-10 times, quickly centrifuged, placed in a metal bath, and incubated at 43°C for 30 min.

[0043] RPA primers F1 / R1, F2 / R2, F3 / R3, and F4 / R4 were used for RPA amplification, respectively. Under the same conditions of template concentration, reaction time, primer concentration and other reagent concentrations, the amplification was carried out at 39°C for 30 min. After the reaction, 10 μL of the amplified product was taken for agarose gel electrophoresis verification.

[0044] The results are as follows Figure 2 As shown: the electrophoresis bands of the amplification products of F1 / R1 primers and F3 / R3 primers are bright, but there are many non-specific bands, indicating that the primers are not specific; the amplification product of F2 / R2 primers is single, but the amplification band is light in color and low in concentration, indicating that the primer amplification efficiency is low.

[0045] The F4 / R4 primer band has high brightness and few non-specific bands, so the F4 / R4 primer amplification temperature was increased to 43°C for amplification. Figure 3 As shown in the figure, after increasing the amplification temperature, the electrophoresis bands of the amplified products of F4 / R4 are bright and obvious, indicating that the primers have high amplification efficiency, high sensitivity and the best performance. In subsequent experiments, unless otherwise specified, the RPA primers used were F4 / R4 primers.

[0046] 3. Establishment of RPA-CRISPR / Cas12b detection system

[0047] 1. sgRNA in vitro transcription and purification

[0048] The sgRNA-spacer sequence was synthesized by GenScript Biotech and linked into the pUC18 plasmid to construct the sgRNA-spacer-pUC18 plasmid. The plasmid was used as a template, and the transcription template was amplified using T7-sgRNA-F and Target spacer-R primers (SEQID NO.10-11). The Thermo Fisher Scientific TranscriptAid T7 High Yield Transcription Kit and Novazon VAHTS RNAClean Beads were then used for in vitro transcription and purification. The specific process is shown below.

[0049] (1) Preparation of DNA transcription template

[0050] (2) sgRNA in vitro transcription

[0051] a. Mix the DNA transcription template, 5× Transcript Max reaction buffer, Transcript Max EnzymeMix, NTPmix, and nuclease-free water thoroughly, centrifuge briefly, and incubate at 37°C for 10 h for in vitro transcription.

[0052] b. After the incubation at 37°C, add 2 μL of DNase I reaction solution to 20 μL of in vitro transcription product and incubate at 37°C for 30 min to remove the DNA template in the transcription system.

[0053] (3) Magnetic bead purification of sgRNA transcription products

[0054] a. First, take the magnetic beads out of the 4°C refrigerator and place them at room temperature for about 30 minutes to allow the temperature to equilibrate to room temperature. Invert or vortex to mix the magnetic beads thoroughly, pipette 1.8 times the volume of magnetic beads into the sgRNA sample to be purified, and mix thoroughly with a pipette.

[0055] b. Incubate at room temperature for 5 minutes to allow the RNA to bind to the magnetic beads.

[0056] c. Place the sample on the magnetic rack for 5 minutes. After the solution becomes clear, carefully remove the supernatant.

[0057] d. Keep the sample on the magnetic rack, add 200 μL of freshly prepared 80% ethanol, rinse the magnetic beads, incubate at room temperature for 30 seconds, and carefully remove the supernatant.

[0058] e. Repeat step 4 and rinse 2 times in total.

[0059] f. Keep the sample on the magnetic rack at all times and open the lid to air-dry the magnetic beads for 5 minutes.

[0060] g. Remove the sample from the magnetic rack, add 32 μL of nuclease-free water, pipette to mix thoroughly, and let stand at room temperature for 5 minutes.

[0061] h. Place the sample on a magnetic stand for 5 minutes. After the solution is clarified, carefully transfer the supernatant to a new nuclease-free PCR tube to obtain the purified sgRNA.

[0062] 2. Establishment of RPA-CRISPR / Cas12b detection system

[0063] The Cas12b protein used was AacCas12b (C2c1) and supporting reagents from Tolo Biotechnology Company.

[0064] The RPA-CRISPR / Cas12b detection system includes: Buffer A, RPA upstream and downstream primers (10 μM), Buffer B, Cas12b protein (5 mM), sgRNA (5 mM), fluorescent signal reporter molecule (5 mM, FAM-nnnnnnnnnnnn-BHQ1), 10×HOLMES Buffer, and ddH2O.

[0065] First, RPA amplification was performed, including: adding 29.7 μL Buffer A, 5 μL template DNA, 9 μL ddH2O, 2 μL each of upstream and downstream primers (10 μM) to the RPA enzyme lyophilized powder, and finally adding 2.5 μL Buffer B, inverting 8-10 times, quickly centrifuging, placing in a metal bath, and amplifying at 43°C for 30 minutes.

[0066] The above-mentioned amplified product was then used for CRISPR / Cas12b detection, specifically including: 1 μL Cas12b protein (5mM), 1 μL sgRNA (5mM), 1 μL of the above-mentioned RPA amplification product, 1 μL of fluorescent signal reporter molecule (5mM, FAM-nnnnnnnnnnnn-BHQ1), 2 μL 10×HOLMES Buffer, and ddH2O was added to 20 μL, mixed and placed in a metal bath.

[0067] Reaction procedure: incubate at 48°C for 30 min. The experiment was repeated three times in parallel, and PBS buffer was used as a control.

[0068] After the reaction is completed, the fluorescence signal is observed with the naked eye under 485nm blue excitation light, and the negative control is used as a comparison to determine the test results.

[0069] Example 2, RPA-CRISPR / Cas12b detection kit performance verification

[0070] The feasibility of the kit reaction procedure was verified using the RPA-CRISPR / Cas12b detection method described in Example 1.

[0071] The genome of the standard strain of Vibrio parahaemolyticus RIMD2210633 was extracted as a detection template and RPA amplification was performed.

[0072] Pipette 1μL of the above RPA amplification product and add it to the CRISPR / Cas12b detection system. The specific system is: 1μL Cas12b protein (5mM), 1μL sgRNA (5mM), 1μL fluorescent signal reporter molecule (5mM, FAM-nnnnnnnnnnnn-BHQ1), 2μL 10×HOLMES Buffer, ddH2O to make up to 20μL, mix well and put it in the metal bath. Configure according to the above system, and observe the signal after the reaction is completed.

[0073] according to Figure 4 It can be seen that a strong fluorescence signal can be observed with the naked eye in the positive reaction tube PCR tube 1 compared with the negative reaction tubes PCR tubes 2-5, indicating that the system can detect Vibrio parahaemolyticus, and the Cas protein exerts trans-cutting activity to generate fluorescence signals, indicating that the detection system is feasible.

[0074] The inventors also studied the detection time of the RPA-CRISPR / Cas12b system. When there is enough sample, obvious fluorescence differences can be observed after the CRISPR system reacts for 30 minutes.

[0075] Example 3, specific detection of RPA-CRISPR / Cas12b detection system

[0076] 1. Verification of the specificity of the RPA-CRISPR / Cas12b detection system using a single bacterial template

[0077] The RPA-CRISPR / Cas12b detection method described in Example 1 was used to verify the specificity of the kit.

[0078] The genomes of Vibrio parahaemolyticus and non-Vibrio parahaemolyticus in Table 1 were extracted as detection templates and amplified by RPA.

[0079] Pipette 1μL of the above RPA amplification product and add it to the CRISPR / Cas12b detection system. The specific system is: 1μL Cas12b protein (5mM), 1μL sgRNA (5mM), 1μL fluorescent signal reporter molecule (5mM, FAM-nnnnnnnnnnnn-BHQ1), 2μL 10×HOLMES Buffer, ddH2O to make up to 20μL, mix well and put it in the metal bath. Configure according to the above system and observe the signal after the reaction is completed.

[0080] according to Figure 5 It can be seen that PCR tube No. 1 contains Vibrio parahaemolyticus and produces a fluorescent signal, while PCR tubes No. 2-9 containing non-Vibrio parahaemolyticus DNA have no signal feedback, indicating that it has not been detected.

[0081] The results showed that the detection method had strong specificity and produced a fluorescent signal response only when only the target Vibrio parahaemolyticus was present in the detection system.

[0082] 2. Verification of the specificity of the RPA-CRISPR / Cas12b detection system using mixed bacterial templates

[0083] The genomes of Vibrio parahaemolyticus and non-Vibrio parahaemolyticus in Table 1 were extracted respectively. Using genomic DNA containing Vibrio parahaemolyticus (a mixture of 9 bacterial genomes in Table 1) and mixed bacteria without Vibrio parahaemolyticus (a mixture of 8 bacterial genomes in Table 1) as templates, the RPA-CRISPR-Cas12b method was used to detect the specificity of Vibrio parahaemolyticus.

[0084] First, perform RPA amplification, draw 1μL RPA amplification product and add it to the CRISPR / Cas12b detection system. The specific system is: 1μL Cas12b protein (5mM), 1μL sgRNA (5mM), 1μL fluorescent signal reporter molecule (5mM, FAM-nnnnnnnnnnnn-BHQ1), 2μL 10×HOLMES Buffer, ddH2O to make up to 20μL, mix well and put it in the metal bath. Configure according to the above system and observe the signal after the reaction is completed.

[0085] according to Figure 6 It can be seen that the mixed DNA detection tubes containing Vibrio parahaemolyticus in PCR tubes 1-2 produced fluorescent signals, while the mixed DNA detection tubes containing no Vibrio parahaemolyticus in PCR tubes 3-4 had no significant difference from the negative control group, indicating that no detection was made.

[0086] The results showed that the detection method has strong specificity and only produces a fluorescent signal response when the target Vibrio parahaemolyticus exists in the detection system. It can be used for mixed bacteria detection.

[0087] Example 4, sensitivity detection of RPA-CRISPR / Cas12b detection system

[0088] The sensitivity of the kit was verified using the RPA-CRISPR / Cas12b detection method described in Example 1.

[0089] Acquisition of test samples: Adjust the bacterial solution of the standard strain of Vibrio parahaemolyticus to an OD of 1, dilute it in a 10-fold gradient and spread it for counting. After counting, use PBS buffer to dilute it in a gradient to 10 -1 , 10 0 , 10 1 , 10 2 , 10 3 , 10 4 , 10 5 A total of 7 CFU / mL concentrations were prepared for use, and the DNA template was obtained by the boiling method.

[0090] RPA amplification was performed using the above bacterial suspension DNA of different concentrations as the detection template.

[0091] Pipette 1μL of the above RPA amplification product and add it to the CRISPR / Cas12b detection system. The specific system is: 1μL Cas12b protein (5mM), 1μL sgRNA (5mM), 1μL fluorescent signal reporter molecule (5mM, FAM-nnnnnnnnnnnn-BHQ1), 2μL 10×HOLMES Buffer, ddH2O to make up to 20μL, mix well and put it in the metal bath. Configure according to the above system and observe the signal after the reaction is completed.

[0092] according to Figure 7 It can be seen that PCR tubes 1-6 all produce fluorescent signals, while PCR tube 7, with a target concentration of 10 -1 There is no signal feedback when CFU / mL.

[0093] The results showed that the detection method had high sensitivity, and the detection limit of the RPA-CRISPR / Cas12b detection system was 10 0 CFU / mL.

[0094] Example 5. Detection of isolates from different sources by RPA-CRISPR / Cas12b detection system

[0095] Acquisition of test samples: As shown in Table 3, based on the known serotypes, isolates of Vibrio parahaemolyticus from different sources that were previously isolated and identified in our laboratory were selected: clinical human sources (15 strains), marine products (9 strains), freshwater products (10 strains), marine aquaculture farms (10 strains), and freshwater aquaculture farms (12 strains). A total of 56 isolates were used for genome extraction as backup for testing.

[0096] Table 3

[0097]

[0098]

[0099]

[0100] The genome of the above-mentioned isolate was used as a detection template for RPA amplification.

[0101] Pipette 1μL of the above RPA amplification product and add it to the CRISPR / Cas12b detection system. The specific system is: 1μL Cas12b protein (5mM), 1μL sgRNA (5mM), 1μL fluorescent signal reporter molecule (5mM, FAM-nnnnnnnnnnnn-BHQ1), 2μL 10×HOLMES Buffer, ddH2O to make up to 20μL, mix well and put it in the metal bath. Configure according to the above system and observe the signal after the reaction is completed.

[0102] according to Figure 8 It can be seen that PCR tubes 1-57 all produce obvious fluorescent signals.

[0103] The results showed that all isolates could be detected by the RPA-CRISPR / Cas12b system.

[0104] Example 6, Application of RPA-CRISPR / Cas12b Detection System

[0105] 1. Vibrio parahaemolyticus simulated contaminated samples

[0106] 1. Soak the shrimp meat sample in 75% alcohol, rinse and wipe the surface to eliminate the interference of background microorganisms.

[0107] 2. Place 1g of shrimp meat sample into 10 9 The shrimp samples were completely immersed in a solution of Vibrio parahaemolyticus RIMD2210633 with CFU / mL at room temperature for 40 minutes to simulate contamination, and the shrimp samples of the non-contaminated group were completely immersed in PBS buffer. 9 mL of PBS was added to the contaminated shrimp samples for mixing, and 1 mL of the filtrate was aspirated for RPA-CRISPR / Cas12b detection.

[0108] according to Fig. 9 It can be seen that PCR tubes 2-4 all produce obvious fluorescent signals, while PCR tubes 5-6 have no signal feedback.

[0109] The results showed that the detection system was feasible in actual sample detection.

[0110] 2. Detection of Vibrio parahaemolyticus in actual samples

[0111] 1. Sample collection and DNA extraction

[0112] A total of 147 samples of seawater and freshwater products were collected from markets and supermarkets. 30 mL of enrichment solution was added to the samples for enrichment for 24 hours. After enrichment, 1 mL of bacterial solution was aspirated, and the precipitate was obtained by 8000×g centrifugation. The precipitate was suspended and washed with PBS buffer, and the bacteria were resuspended in 100 μL ultrapure water. The samples were boiled at 100°C for 10 minutes and centrifuged at 12000×g for 3 minutes to obtain the supernatant as a DNA template.

[0113] 2. Detection of Vibrio parahaemolyticus in samples

[0114] The RPA-CRISPR / Cas12b detection method described in Example 1 was used to verify the actual samples collected.

[0115] At the same time, Vibrio parahaemolyticus was identified using conventional isolation and culture medium culture method.

[0116] The results of RPA-CRISPR / Cas12b detection and conventional pathogen isolation, culture and identification methods are shown in Table 4:

[0117] Table 4

[0118]

[0119]

[0120] A total of 32 strains of Vibrio parahaemolyticus were detected by RPA-CRISPR / Cas12b, with an isolation rate of 21.77%; 25 strains were isolated by traditional isolation and culture methods, with an isolation rate of 17.01%. Compared with the traditional isolation and culture methods, the positive coverage rate of RPA-CRISPR / Cas12b was 100%.

[0121] The RPA-CRISPR / Cas12b detection method established in the present invention can realize on-site rapid detection of Vibrio parahaemolyticus in actual samples, and the results are accurate and reliable.

Claims

1. A sgRNA for detecting Vibrio parahaemolyticus, characterized in that: The sgRNA comprises the Vibrio parahaemolyticus target sequence shown in SEQ ID NO.

1.

2. The method for preparing sgRNA for detecting Vibrio parahaemolyticus according to claim 1, characterized in that: The method comprises the following steps: combining the Vibrio parahaemolyticus target sequence shown in SEQ ID NO.1 with the sgRNA fixed sequence, and then connecting with the pUC 18 plasmid to construct a sgRNA-spacer-pUC18 recombinant plasmid; amplifying, in vitro transcribing and purifying using the recombinant plasmid as a template to obtain sgRNA.

3. Use of the sgRNA shown in claim 1 in preparing a kit for detecting Vibrio parahaemolyticus.

4. A Vibrio parahaemolyticus RPA-CRISPR / Cas12b detection kit, characterized in that: The kit includes an sgRNA comprising a Vibrio parahaemolyticus target sequence as shown in SEQ ID NO.1, and a primer pair for amplifying the Vibrio parahaemolyticus target sequence as shown in SEQ ID NO.

1.

5. The detection kit according to claim 4, characterized in that The nucleotide sequences of the primer pairs are shown in SEQ ID NOs. 8-9.

6. The detection kit according to claim 4, characterized in that The kit also includes RPA amplification reagents and CRISPR / Cas12b detection reagents, positive and negative controls.

7. The detection kit according to claim 6, characterized in that The RPA amplification reagent includes polymerase dry powder, Buffer A, Buffer B, and ddH2O.

8. The detection kit according to claim 6, characterized in that The CRISPR / Cas12b detection reagent includes a detection buffer 10×HOLMES Buffer, a fluorescent signal reporter molecule, ddH2O, and a Cas12b protein.

9. A Vibrio parahaemolyticus RPA-CRISPR / Cas12b detection method, characterized in that: First, the sample to be tested is subjected to RPA amplification, and the nucleotide sequences of the primers used are shown in SEQ ID NO. 2-3; The RPA amplification product is then subjected to CRISPR / Cas12b detection using the sgRNA described in claim 1. After the CRISPR / Cas12b detection is completed, the fluorescent signal is read by the naked eye under 485nm excitation light. If there is a fluorescent signal, the sample to be tested contains Vibrio parahaemolyticus. If there is no fluorescent signal, the sample to be tested does not contain Vibrio parahaemolyticus.

10. The detection method according to claim 9, characterized in that: The reaction conditions for the RPA amplification were 43°C for 30 min; the reaction conditions for the CRISPR / Cas12b detection were 48°C for 30 min.

Images