Staphylococcus epidermidis symbiotic bacterium CGMCC NO.31064 and application

Abstract

The invention discloses a probiotic candidate strain, the preservation number of the strain is CGMCC (China General Microbiological Culture Collection Center) NO.31064, the preservation date is June 24, 2024, the preservation classification is named as Staphylococcus epidermidis, and the preservation unit is China General Microbiological Culture Collection Center. The strain is harmless to animals and has a remarkable effect of relieving clinical symptoms of atopic dermatitis.

Description

Technical Field

[0001] The invention relates to a symbiotic bacteria candidate strain, bacterial components and applications thereof, and belongs to the field of microorganisms. Background Art

[0002] Atopic dermatitis is the inflammatory skin disease with the highest incidence rate, and its clinical manifestations include skin symptoms such as epidermal exfoliation, severe itching and lichenoid lesions. The etiology of atopic dermatitis is relatively complex, mainly due to dysbiosis of the skin microbiome, impaired skin barrier, abnormal immune signals, genetic factors, environmental factors, etc. Atopic dermatitis brings great trouble to patients' lives, because atopic dermatitis lasts for a long time and recurs repeatedly; the skin lesions are secondarily infected with pathogens such as Staphylococcus aureus; some patients will also develop allergic asthma, allergic rhinitis, allergic conjunctivitis, etc. Atopic dermatitis is widely prevalent worldwide. According to data from a survey by the World Health Organization, it is estimated that at least 230 million people in the world suffer from atopic dermatitis, and 15-30% of children and 10% of adults are affected by it. In clinical practice, for patients with mild atopic dermatitis, topical glucocorticoids, antihistamines, etc. are applied. For severe patients, systemic glucocorticoids and immunosuppressants are used. Because atopic dermatitis patients may cause bacterial, viral and fungal infections, corresponding antimicrobial drugs are also used. However, long-term use of glucocorticoids and immunosuppressants can cause strong side effects, such as low immunity, digestive symptoms such as diarrhea, intestinal microecological imbalance, etc., and the recurrence rate is very high. Therefore, it is very necessary to study a safe, side-free and green intervention method for atopic dermatitis.

[0003] Host-microbe interactions coordinate skin homeostasis. In recent years, microbial therapy has been studied for the prevention and treatment of allergic diseases, such as food allergies, asthma, allergic rhinitis, atopic dermatitis, neurodermatitis, contact dermatitis, etc. Microbial therapy is carried out in the form of topical application of bacterial lysates or skin flora transplantation. It has shown good results in animal and human trials. It can not only restore the balance of skin microbiota by reducing pathogenic bacteria and increasing beneficial bacteria, but also play an immunomodulatory role by affecting the host's biochemical and metabolic pathways.

[0004] Staphylococcus epidermidis is a normal skin commensal bacterium on the human body. Studies have shown that Staphylococcus epidermidis has an immunomodulatory effect. The purpose of the present invention is to provide a skin commensal bacterium that has the function of alleviating atopic dermatitis. Summary of the invention

[0005] Based on the above invention purpose, the present invention first provides a strain of Staphylococcus epidermidis M2024, the deposit number of the strain is CGMCC NO. 31064, the deposit date is June 24, 2024, and the deposit classification is named Staphylococcus epidermidisStaphylococcus epidermidis The depository is the General Microbiology Center of China Microbiological Culture Collection Committee, located at Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, zip code: 100101, telephone: 8610-64807355. The strain was isolated from the skin surface of a healthy person.

[0006] In a preferred embodiment, the sequence of 16S rRNA of the strain is shown as SEQ ID NO.1.

[0007] Secondly, the present invention also provides the use of the above-mentioned strain and its bacterial components in the preparation of drugs for the treatment and / or prevention of skin allergic diseases.

[0008] In a preferred embodiment, the skin allergic disease is atopic dermatitis.

[0009] In a more preferred embodiment, the drug for treating and / or preventing atopic dermatitis refers to a drug that promotes the transcription and / or expression of the AhR gene.

[0010] In another preferred embodiment, the atopic dermatitis treatment and / or prevention drug is a drug that inhibits Tslp Drugs that modulate gene transcription and / or expression.

[0011] Thirdly, the present invention also provides the use of the above-mentioned strain or its bacterial components in the preparation of health products.

[0012] Finally, the present invention provides a composition containing the above strain.

[0013] In a preferred embodiment, the composition further contains a pharmaceutically acceptable carrier and / or excipient.

[0014] In a more preferred embodiment, the composition is prepared as capsules, lyophilized powder or bacterial liquid preparation.

[0015] The present invention separates and purifies the epidermidis Staphylococcus atopic dermatitis-relieving strain from the skin surface of healthy people. Experiments show that the separated Staphylococcus atopic dermatitis-relieving strain Staphylococcus epidermidis M2024 is harmless to animals, and has been confirmed by animal experiments to have the function of relieving atopic dermatitis. Staphylococcus epidermidis M2024 can effectively relieve the symptoms of atopic dermatitis, reduce dandruff in the lesioned area, reduce the thickness of the skin epidermis, and reduce the level of skin inflammatory factors. It has a significant alleviating effect on atopic dermatitis and shows excellent application prospects in the preparation of drugs for the treatment and / or prevention of skin allergic diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1It shows that applying M2024 can significantly alleviate the ear symptoms of atopic dermatitis model mice and the H&E staining and toluidine blue staining sections of each group; Figure 2 It showed that applying M2024 could significantly reduce the ear thickness of mice in atopic dermatitis model; Figure 3 It showed that applying M2024 could significantly reduce the ear epidermal thickness of atopic dermatitis model mice; Figure 4 It was shown that applying M2024 can significantly reduce the number of mast cells in the ears of mice with atopic dermatitis model; Figure 5 The IgE protein content in the serum of mice in each group is shown; Figure 6 It was shown that applying M2024 can significantly reduce the number of Il-4 Transcription levels of genes; Figure 7 It was shown that applying M2024 can significantly reduce the number of Il-1β Transcription levels of genes; Figure 8 It showed that applying M2024 could significantly reduce the IL-4 protein content in the ears of mice with atopic dermatitis model; Fig. 9 It showed that applying M2024 could significantly reduce the IL-1β protein content in the ears of atopic dermatitis model mice; Fig.10 It showed that applying M2024 can significantly reduce the early ear inflammation in atopic dermatitis model mice Tslp Transcription levels of genes; Fig.11 It showed that applying M2024 could significantly reduce the TSLP protein content in the ears of mice with atopic dermatitis in the early stage; Fig.12 It showed that applying M2024 can significantly reduce the early ear inflammation in atopic dermatitis model mice Il-33 Transcription levels of genes; Fig.13 It showed that applying M2024 could significantly reduce the IL-33 protein content in the ears of mice with atopic dermatitis model in the early stage; Fig.14 It showed that applying M2024 can significantly enhance the early ear function of atopic dermatitis model mice Ahr Transcription levels of genes; Fig.15 It showed that applying M2024 can significantly enhance the early ear function of atopic dermatitis model mice Cyp1a1 Transcription levels of genes; Fig.16It showed that applying M2024 could significantly enhance the CYP1A1 protein content in the early ears of atopic dermatitis model mice; Fig.17 Shows the ear symptoms of each group of mice after application of AhR inhibitor; Fig.18 Shows the ear thickness of mice in each group after application of AhR inhibitor; Fig.19 It shows the IgE protein content in the serum of each group of mice after the application of AhR inhibitor; Fig. 20 It showed that after the application of AhR inhibitor, Tslp Transcription levels of genes; Fig.21 Shows the TSLP protein content in the mouse ears at the early stage after the application of AhR inhibitor; Fig. 22 It shows that after the application of AhR inhibitor, Il-4 Transcription levels of genes; Fig.23 It shows that after the application of AhR inhibitor, Il-1β Transcription level of genes. DETAILED DESCRIPTION

[0017] The present invention will be further described below in conjunction with specific implementation examples, and the advantages and features of the present invention will become clearer as the description proceeds. However, these embodiments are merely exemplary and do not constitute any limitation to the scope of protection of the present invention.

[0018] Example 1: Isolation, identification and preservation of Staphylococcus epidermidis M2024 strain 1. Isolation of Staphylococcus epidermidis M2024 strain 1) Prepare BHI blood agar medium, sterilize it by high pressure sterilization at 121℃ for 15 min, then add 20% defibrinated sheep blood and mix well, pour into a culture dish, and use it for strain isolation after solidification; 2) Use a cotton swab to wipe the surface of healthy human skin into a 1.5 mL Eppendorf tube pre-filled with 1000 μL sterile PBS, and perform a 10-fold gradient dilution; 3) Take 100 μL of samples with different dilutions and spread them on BHI solid culture medium, and culture them in a 37°C constant temperature incubator for 48 h.

[0019] 2. Identification of Staphylococcus epidermidis strain M2024 Preliminary identification of Staphylococcus epidermidis M2024 strain by 16s rRNA gene sequencing 1) Use a sterile white pipette tip to pick up an appropriate amount of moist, round, convex yellow colonies cultured in the previous step and place them in an Eppendorf tube containing 100 μL of sterile water; 2) After mixing by pipetting, the sample was placed in a 98°C metal bath and boiled for 15 min, followed by centrifugation at 5000 rpm for 5 min. 5 μL of the supernatant was used as a PCR template for 16S rRNA gene amplification. 3) The amplified products were sent to Ruibo Xingke for sequencing, and then the spliced ​​amplified sequences were preliminarily identified by Nucleotide BLAST comparison (rRNA / ITS databases) on NCBI. The comparison results showed that the 16s rRNA sequence of Staphylococcus epidermidis M2024 strain was consistent with Staphylococcus epidermidis The sequence identity of strain NBRC 100911 was 99.893%, supporting that the S. epidermidis strain M2024 belonged to the species S. epidermidis .

[0020] 2.2 Accurate identification of Staphylococcus epidermidis M2024 strain by comparing ANI and DDH with the model strain Digital DNA-DNA hybridization (dDDH, <70%) and average nucleotide identity (Average Nucleotide Identity, ANI, <95%) are the gold standards for determining prokaryotic species. Both methods are completed online (dDDH, http: / / ggdc.dsmz.de; ANI, http: / / enve-omics.ce. gatech.edu / ani / ).

[0021] 1) According to the instructions, use the DNA extraction kit produced by Nanjing Novozyme Biotechnology Co., Ltd. to extract the genome of the target strain; 2) Cold chain transportation to Beijing Novogene Technology Co., Ltd. to complete the draft genome sequencing; the draft results showed that the genome size of Staphylococcus epidermidis M2024 strain was 2470146 bp and the GC content was 32.06%; 3) The type strain of Staphylococcus epidermidis ATCC 14990 was selected to compare the dDDH and ANI with the Staphylococcus epidermidis M2024 strain; the results showed that the dDDH and ANI between the Staphylococcus epidermidis M2024 strain and the type strain were 74.7% and 96.87%, respectively, supporting that the M2024 strain belongs to Staphylococcus epidermidis.

[0022] 3. Observation of colony appearance and bacterial morphology of Staphylococcus epidermidis M2024 strain According to the 16s rRNA results, a strain of Staphylococcus epidermidis M2024 was obtained. This strain is an aerobic bacterium and grows well in a 37 ℃ incubator. The colony morphology is round, lemon yellow, smooth, convex, with neat edges and opaque. Gram-positive cocci can be seen under Gram staining.

[0023] 4. Preservation of bacterial strains This laboratory uses BHI medium containing 50% glycerol as the bacterial preservation medium for frozen preservation of bacterial strains. The method is as follows: 1) Prepare the bacterium preservation solution, sterilize it by high pressure, and dispense it into sterile 2 mL bacterium preservation tubes; 2) Streak the identified Staphylococcus epidermidis M2024 strain in three zones on BHI solid culture medium, pick a single colony and subculture it twice, then use an inoculation loop to scrape the bacteria into the incubation tube containing the incubation solution in the previous step, pipette and mix well so that the bacteria are evenly distributed in the incubation solution, and store in a -80℃ refrigerator.

[0024] 5. Strain preservation and accession number The deposit number of Staphylococcus epidermidis M2024 strain is CGMCC NO. 31064, the deposit date is June 24, 2024, and the deposit classification is named Staphylococcus epidermidis Staphylococcus epidermidis The depository is the General Microbiology Center of China Culture Collection Administration, whose address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Postal Code: 100101, Tel: 8610-64807355.

[0025] Example 2. Evaluation of the effect of Staphylococcus epidermidis M2024 on alleviating atopic dermatitis 1. Experimental animals Female SPF C57BL / 6J mice weighing 18-20 g were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. with a license number of SYXK (Beijing) 2022-0029. They were kept in the Laboratory Animal Center of the Chinese Center for Disease Control and Prevention, with 6 mice per cage in a barrier environment with a 12-h light / dark cycle, and mice had free access to water and food. All animal experiments were conducted in accordance with the Ethical Guidelines for Laboratory Animal Welfare of the Laboratory Animal Center of the Chinese Center for Disease Control and Prevention (approval number: 2023-025).

[0026] 2. Animal experiment design and sample collection The mice were randomly divided into three groups, with 12 mice in each group, namely Vehicle group (blank control group, only anhydrous ethanol was applied to the ears of mice), MC903 (carbotriol) group (model group, 1 nmol MC903 was applied to the ears of mice every day), and MC903+M2024 group (intervention group, 1 nmol MC903 was applied to the ears of mice every day for 1 hour and then 200 μL of Staphylococcus epidermidis M2024 suspension was applied to the ears of mice).

[0027] After one week of adaptation, the right ears of mice in the Vehicle group were smeared with 10 μL of anhydrous ethanol every day, and the right ears of mice in the MC903 group were smeared with 1 nmol MC903 (dissolved in 10 μL of anhydrous ethanol, and the drug acts on the skin after the anhydrous ethanol evaporates) every day. The right ears of mice in the MC903+M2024 group were smeared with 1 nmol MC903 every day for 1 hour, and then smeared with 200 μL of Staphylococcus epidermidis M2024 suspension (2×10 8 CFU / mouse), and the MC903 group was smeared with the same volume of PBS for 12 consecutive days. Photos were taken and the thickness of the ears was measured with a micrometer every day to record the induction status. Six mice were killed on the 5th and 12th days respectively, and serum was taken for IgE protein content determination. The ears were removed and quickly frozen in liquid nitrogen and transferred to -80 ℃ for storage, used for tissue fixation and embedding to make paraffin sections, and RNA was extracted for cytokine detection ( Il-1β , Il-4 , Tslp , Il-33 ) mRNA transcription, and for determining cytokine protein content (IL-1β, IL-4, TSLP, IL-33).

[0028] 3. Sample testing method 3.1 ELISA to detect IgE protein content in mouse serum The mouse serum was diluted 50 times, and the IgE protein content in the mouse serum was detected using a related kit (Mouse IgE Uncoated ELISA, invitrogen, Cat# 88-50460-88) according to the experimental steps in the instruction manual.

[0029] 3.2 ELISA detection of cytokine protein levels in mouse ears The mouse ears were taken out of the -80℃ refrigerator, 1 mL of PBS was added and homogenized with a high-throughput tissue grinder, and the supernatant was aspirated after centrifugation for later use. The cytokine content in the supernatant of the mouse ear homogenate was detected using relevant kits according to the experimental steps in the instructions, including IL-1β (Mouse IL-1 beta Uncoated ELISA, invitrogen, Cat#88-7013A-88), IL-4 (Mouse IL-4 Uncoated ELISA, invitrogen, Cat#88-7044-88), TSLP (Mouse TSLP Uncoated ELISA, invitrogen, Cat#88-7490-88), and IL-33 (Mouse IL-33 Uncoated ELISA, invitrogen, Cat#88-7333-88).

[0030] 3.3 Real-time fluorescence quantitative PCR technology to detect changes in cytokine gene expression in mouse ears 3.3.1 Total RNA extraction from mouse ears After soaking the mouse ears in RNAlater (Beyotime, Cat#R0116) overnight, transfer them to 1 mL Trizol and homogenize them with a high-throughput tissue grinder to extract ear RNA; incubate on ice for 10 min, add 200 µL chloroform, mix by inverting, and let stand at room temperature for 5 min; centrifuge at 12,000 rpm at 4 °C for 15 min, pipette 400 µL supernatant into a new 1.5 mL centrifuge tube, add an equal volume of isopropanol, mix by inverting, and incubate at room temperature for 5 min; centrifuge at 12,000 rpm at 4 °C for 15 min, discard the supernatant, and RNA is visible as a white precipitate; add 1 mL 70% anhydrous ethanol to wash the RNA precipitate, and centrifuge at 12,000 rpm at 4 °C for 10 min; discard the supernatant, wait for the RNA to dry, and add 50 µL RNase-Free water to dissolve the RNA.

[0031] 3.3.2 Reverse transcription Using PrimeScript TM Reverse transcription was performed using the RT Master Mix (Perfect Real Time) kit (Takara, Cat#RR036A). The system used was: 5× PrimeScript RT Master Mix (Perfect Real Time): 2 μL; RNA: 1 μg; RNase Free dH2O: make up to 10 μL. Reverse transcription reaction conditions were: 37 ℃, 15 min; 95 ℃, 5 s.

[0032] 3.3.3 Real-time fluorescence quantification Real-time fluorescence quantification was performed using 2× ChamQ Universal SYBR qPCR Master Mix (Vazyme, Cat#Q711-03) to detect the expression of SYBR in the mouse ears. Il-1β , Il-4 , Tslp , Il-33) Changes in gene expression. The reverse transcription product obtained in the previous step was diluted 5 times and used as a template. The qPCR system was as follows: 2× ChamQ Universal SYBR qPCRMaster Mix: 10 μL; F: 0.8 μL; R: 0.8 μL; cDNA template: 2 μL; RNase Free dH2O: make up to 20 μL. The reaction conditions were: 95 ℃ pre-denaturation for 30 s; then 95 ℃ denaturation for 10 s, 60 ℃ annealing for 30 s, and 40 cycles. The system collected fluorescence signals at the end of each cycle. The relative level of mRNA expression of each group of samples was calculated by the delta-delta CT method, in which the Vehicle group sample was 1, and the expression level in the MC903+M2024 group samples was obtained and compared with the MC903 group.

[0033] The primers used in this experiment were synthesized by Sangon Biotechnology Co., Ltd. The primer sequences are as follows: mβ-actin-F: ATATCGCTGCGCTGGTCG (SEQ ID NO. 2); mβ-actin-R: TTCCCACCATCACACCCTGG (SEQ ID NO.3); mIL-1β-F: TGGAAGTCTGTCTGCTCAGTATT (SEQ ID NO.4); mIL-1β-R:GGTTTGGAAGCAGCCCTTCAT (SEQ ID NO.5); mIL-4-F: GGTCTCAACCCCCAGCTAGT (SEQ ID NO. 6); mIL-4-R: GCCGATGATTCTCTCAAGTGAT (SEQ ID NO. 7); IL-33-F: TCCAACTCCAAGATTTCCCCG (SEQ ID NO.8); IL-33-R: CATGCAGTAGACATGGCAGAA (SEQ ID NO.9); mTSLP-F: ACGGATGGGGCTAACTTACAA (SEQ ID NO. 10); mTSLP-R: AGTCCTCGATTTGCTCGAACT (SEQ ID NO. 11); mAhR-F: CTGGTTGTCACAGCAGATGCCT (SEQ ID NO. 12); mAhR-R: CGGTCTTCTGTATGGATGAGCTC (SEQ ID NO. 13); mCYP1A1-F: CATCACAGACAGCCTCATTGAGC (SEQ ID NO. 14); mCYP1A1-R: CTCCACGAGATAGCAGTTGTGAC (SEQ ID NO. 15).

[0034] 3.4 Statistical analysis methods All data are expressed as mean ± SD and analyzed using GraphPad Prism 8 (GraphPad Inc., San Diego, CA, USA). The differences among the groups were analyzed by one-way ANOVA and t-test, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0035] 4. Research Results 4.1 Application of Staphylococcus epidermidis M2024 strain can relieve symptoms of atopic dermatitis To observe the effect of Staphylococcus epidermidis M2024 in alleviating atopic dermatitis, the modeling agent MC903 was applied to the right ears of mice in the MC903 group and the MC903+M2024 group to establish a mouse atopic dermatitis model. Mice in the MC903+M2024 group were applied with 200 μL of Staphylococcus epidermidis M2024 suspension (2×10 8 CFU / mouse / day), the MC903 group was smeared with the same volume of PBS. The mice were killed after 12 consecutive days of modeling. The effect of Staphylococcus epidermidis M2024 strain on alleviating atopic dermatitis was evaluated by comparing the thickness of the ears, ear pathology, serum IgE content, and multiple cytokine levels in the ears of mice in the MC903 group and the MC903+M2024 group. The results showed that the application of Staphylococcus epidermidis M2024 strain could significantly alleviate the symptoms of atopic dermatitis. Compared with the MC903 group, the dandruff in the MC903+M2024 group was reduced with the naked eye ( Figure 1 ), ear thickness reduced ( Figure 2, p<0.0001, Vehicle group 253.3±1.708μm, MC903 group 559.7±31.30μm, MC903+M2024 group 330.8±17.50μm); Pathological section results showed that the skin thickness of mice in the Vehicle group was normal, without obvious infiltration of inflammatory cells and mast cells; the skin of mice in the MC903 group was significantly thickened, with a large number of inflammatory cells and mast cells infiltration; compared with the MC903 group, the skin thickness of mice in the MC903+M2024 group was significantly improved, and the infiltration of inflammatory cells and mast cells was significantly reduced ( Figure 1 ). Further analysis of pathological sections showed that the epidermal thickness of the lesion site in the MC903+M2024 group of mice was significantly reduced compared with that in the MC903 group ( Figure 3 , p<0.0001, Vehicle group 17.77±0.2517μm, MC903 group 103.9±11.49μm, MC903+M2024 group 29.87±4.796μm), the number of mast cells was significantly reduced ( Figure 4 , p<0.001, 21.33±1.528 in the Vehicle group, 60.33±1.528 in the MC903 group, and 30.33±2.082 in the MC903+M2024 group). ELISA was used to detect the IgE content in mouse serum. The results showed that the MC903 group and the MC903+M2024 group were significantly higher than those in the Vehicle group, and there was no significant difference between the MC903 group and the MC903+M2024 group ( Figure 5 , P>0.05, Vehicle group 182.1±95.60 ng / mL, MC903 group 12870±7515 ng / mL, MC903+M2024 group 8511±4184 ng / mL). The above results show that applying Staphylococcus epidermidis M2024 can relieve the symptoms of atopic dermatitis.

[0036] 4.2 Effects of smearing Staphylococcus epidermidis M2024 on cytokines in atopic dermatitis model mice Real-time fluorescence quantitative PCR was used to detect inflammation-related genes in the ears of mice on the 12th day of modeling ( Il-4 and Il-1β ) and allergy initiating factors in the ears of mice on the 5th day of modeling ( Tslp and Il-33 ) transcriptional level changes, the results showed that compared with the MC903 group, the MC903+M2024 group mice ears Il-4 The gene expression level was significantly decreased ( Figure 6, p<0.01, Vehicle group 1.131±0.5944, MC903 group 34.29±21.99, MC903+M2024 group 5.898±3.94), Il-1β The gene expression level was significantly decreased ( Figure 7 , p<0.05, Vehicle group 1.172±0.6057, MC903 group 53.81±30.10, MC903+M2024 group 21.47±11.90), Tslp The gene expression level was significantly decreased ( Fig.10 , p<0.0001, Vehicle group 1.168±0.7710, MC903 group 23400±6002, MC903+M2024 group 1959±1577) Il-33 The gene expression level was significantly decreased ( Fig.12 , p<0.05, Vehicle group 1.002±0.08017, MC903 group 1.837±0.2792, MC903+M2024 group 1.223±0.1140). ELISA was used to detect the protein levels of IL-4 and IL-1β in the ears of mice on the 12th day of modeling, and TSLP and IL-33 in the ears of mice on the 5th day of modeling. The results showed that compared with the MC903 group, the protein level of IL-4 in the ears of mice in the MC903+M2024 group was significantly reduced ( Figure 8 , p<0.05, Vehicle group 8.528±4.556 pg / mL, MC903 group 177.0±78.58 pg / mL, MC903+M2024 group 69.69±63.87 pg / mL), IL-1β protein content was significantly decreased ( Fig. 9 , p<0.05, Vehicle group 15.74±2.454 pg / mL, MC903 group 113.9±46.53 pg / mL, MC903+M2024 group 46.95±17.98 pg / mL), TSLP protein content was significantly decreased ( Fig.11 , p<0.0001, Vehicle group 17.34±3.390 pg / mL, MC903 group 1285±78.04 pg / mL, MC903+M2024 group 392.2±118.6 pg / mL), IL-33 protein content was significantly decreased ( Fig.13, p<0.0001, Vehicle group 510.3±96.60 pg / mL, MC903 group 1185±173.1 pg / mL, MC903+M2024 group 518.7±63.47 pg / mL). The above results show that applying Staphylococcus epidermidis M2024 can reduce the level of atopic dermatitis-related inflammatory factors and the level of early allergy initiation factors.

[0037] Example 3. Exploring the mechanism of Staphylococcus epidermidis M2024 strain in alleviating atopic dermatitis 1. Experimental animals Female SPF C57BL / 6J mice weighing 18-20 g were purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. with a license number of SYXK (Beijing) 2022-0029. They were kept in the Laboratory Animal Center of the Chinese Center for Disease Control and Prevention, with 6 mice per cage in a barrier environment with a 12-h light / dark cycle, and mice had free access to water and food. All animal experiments were conducted in accordance with the Ethical Guidelines for Laboratory Animal Welfare of the Laboratory Animal Center of the Chinese Center for Disease Control and Prevention (approval number: 2023-025).

[0038] 2. Animal experiment design and sample collection The mice were randomly divided into 5 groups, with 12 mice in each group, namely Vehicle group (blank control group, only anhydrous ethanol was applied to the ears of mice), MC903 group (model group, 1 nmol MC903 was applied to the ears of mice every day), MC903+M2024 group (intervention group, 1 nmol MC903 was applied to the ears of mice every day for 1 hour and then 200 μL of Staphylococcus epidermidis M2024 suspension was applied to the ears of mice), CH+MC903 group (AhR inhibitor+model group, 1 nmol MC903 was applied to the ears of mice every day and then CH223191 was applied), CH+MC903+M2024 group (AhR inhibitor+intervention group, 1 nmol MC903 and CH223191 were applied to the ears of mice every day for 1 hour and then 200 μL of Staphylococcus epidermidis M2024 suspension was applied to the ears of mice).

[0039] After one week of adaptation, the right ears of mice in the Vehicle group were smeared with 10 μL of anhydrous ethanol every day, the right ears of mice in the MC903 group were smeared with 1 nmol MC903 (dissolved in 10 μL of anhydrous ethanol, and the drug acts on the skin after the anhydrous ethanol evaporates), and the right ears of mice in the MC903+M2024 group were smeared with 1 nmol MC903 every day and then smeared with 200 μL of Staphylococcus epidermidis M2024 suspension (2×10 8The right ears of mice in the CH+MC903 group were smeared with 1 nmol MC903 every day, followed by 10 μL of 10 μmol / L AhR inhibitor CH223191 (MCE, Cat#HY-12684). The right ears of mice in the CH+MC903+M2024 group were smeared with 1 nmol MC903 and CH223191 every day, followed by 200 μL of Staphylococcus epidermidis M2024 suspension (2×10 8 CFU / mouse), and the same volume of PBS was applied to the MC903 group and the CH+MC903 group for 12 consecutive days. Photos were taken and the thickness of the ears was measured with a micrometer every day to record the induction. The mice were killed on the 5th and 12th days, and serum was taken for IgE protein content determination. The ears were removed and quickly frozen in liquid nitrogen and transferred to -80 ℃ for storage. RNA was extracted for cytokine detection ( Il-1β , Il-4 , Tslp , Ahr, Cyp1a1 ) mRNA transcription, used to determine the cytokine protein content (TSLP) and the extraction of total ear protein.

[0040] 3. Sample testing method 3.1 ELISA to detect IgE protein content in mouse serum Refer to Example 2, 3.1 3.2 ELISA detection of cytokine protein levels in mouse ears Refer to 3.2 of Example 2 3.3 Real-time fluorescence quantitative PCR technology to detect changes in cytokine gene expression in mouse ears 3.3.1 Total RNA extraction from mouse ears Refer to 3.3.1 of Example 2.

[0041] 3.3.2 Reverse transcription Refer to 3.3.2 of Example 2.

[0042] 3.3.3 Real-time fluorescence quantification Refer to 3.3.3 of Example 2.

[0043] 3.4 Western blot detection of protein expression in mouse ears The cells were lysed with NP-40 cell lysis buffer (Beyotime, Cat#P0013F), then centrifuged at 12,000 g for 10 min, and 5× protein buffer was added at a ratio of 1:4 after discarding the precipitate. The membrane was boiled at 100°C for 10 min, and the sample was electrotransferred to a nitrocellulose membrane. The nitrocellulose membrane was blocked in 5% skim milk at room temperature for 2 h, washed three times with phosphate-buffered saline (PBST) (5 min / time), and rabbit CYP1A1 polyclonal antibody (Beyotime, Cat#AF6642) was added and incubated at room temperature for 1.5 h, washed three times with PBST (5 min / time), and HRP-labeled goat anti-rabbit IgG secondary antibody (Beyotime, Cat#A0352) was added. The membrane was incubated at room temperature in the dark for 45 min, washed three times with PBST (5 min / time), and scanned using a membrane scanner.

[0044] 3.5 Statistical analysis methods All data are expressed as mean ± SD and analyzed using GraphPad Prism 8 (GraphPad Inc., San Diego, CA, USA). The differences among the groups were analyzed by one-way ANOVA and t-test, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001.

[0045] 4. Research Results 4.1 Application of Staphylococcus epidermidis M2024 strain can activate AhR signaling pathway Activation of AhR (aryl hydrocarbon receptor) signaling pathway inhibits early allergic initiation factors in atopic dermatitis Tslp Therefore, real-time fluorescence quantitative PCR and Western blot were used to detect whether the application of Staphylococcus epidermidis M2024 strain would affect the expression of AhR and CYP1A1. The results showed that compared with the MC903 group, the MC903+M2024 group had a higher expression of AhR and CYP1A1 in the ears. AHr The gene expression level was significantly increased ( Fig.14 , p<0.01, Vehicle group 1.004±0.09492, MC903 group 0.4655±0.1337, MC903+M2024 group 0.7178±0.1375), Cyp1a1 The gene expression level was significantly increased ( Fig.15 , p<0.001, Vehicle group 1.019±0.2267, MC903 group 0.6127±0.1483, MC903+M2024 group 1.267±0.3049), among which the Western blot results of CYP1A1 protein were consistent with those of real-time fluorescence quantitative PCR ( Fig.16). The above results show that smearing Staphylococcus epidermidis M2024 strain can activate the AhR signaling pathway.

[0046] 4.2 Application of Staphylococcus epidermidis M2024 strain relieves atopic dermatitis symptoms by activating the AhR signaling pathway To explore whether the application of Staphylococcus epidermidis M2024 strain relieves atopic dermatitis symptoms by activating the AhR signaling pathway, the AhR inhibitor CH223191 (1-methyl-N-[2-methyl-4-[2-(2-methylphenyl)diazenyl]phenyl-1H-pyrazole-5-carboxamide) was applied to the ears of mice before applying M2024. The results showed that the application of CH223191 significantly eliminated the protective effect of M2024 on MC903-induced atopic dermatitis. The redness, scaling, ear swelling symptoms and ear thickness of mice in the CH+MC903+M2024 group were significantly more severe than those in the MC903+M2024 group, and there was basically no difference in symptoms with the CH+MC903 group ( Fig.17 , 18). The results of serum IgE showed that there was no significant difference between the CH+MC903+M2024 group and the CH+MC903 group ( Fig.19 , P>0.05, CH+MC903 group 6101±2288 ng / mL, CH+MC903+M2024 group 5577±3498 ng / mL). Real-time fluorescence quantitative PCR method was used to detect the changes in transcription levels of related cytokines. The results showed that the ears of mice in the CH+MC903+M2024 group and the CH+MC903 group Tslp Gene expression levels ( Fig. 20 , P>0.05, CH+MC903 group 2504±1003, CH+MC903+M2024 group 2064±509.3) Il-4 Gene expression levels ( Fig. 22 , P>0.05, CH+MC903 group 6.768±3.301, CH+MC903+M2024 group 6.997±4.050) and Il-1β Gene expression levels ( Fig.23 , P>0.05, CH+MC903 group 19.05±6.260, CH+MC903+M2024 group 30.94±11.66) had no significant difference, among which the ELISA results of TSLP factor were consistent with the results of real-time fluorescence quantitative PCR ( Fig.21 , P>0.05, CH+MC903 group 2661±77.80 pg / mL, CH+MC903+M2024 group 2503±207.8 pg / mL). The results showed that applying Staphylococcus epidermidis M2024 strain relieved the symptoms of atopic dermatitis by activating the AhR signaling pathway.

Claims

1. A strain of Staphylococcus epidermidis, the deposit number of which is CGMCC NO.31064, the deposit date is June 24, 2024, and the deposit classification is named Staphylococcus epidermidis Staphylococcus epidermidis The preservation unit is the General Microbiology Center of China Microbiological Culture Collection Administration.

2. The Staphylococcus epidermidis strain according to claim 1, characterized in that The sequence of 16S rRNA of the strain is shown as SEQ ID NO.

1.

3. Use of the strain according to claim 1 or 2 in the preparation of drugs for the treatment and / or prevention of skin allergic diseases.

4. The use according to claim 3, characterized in that: The skin allergic disease is atopic dermatitis.

5. The use according to claim 4, characterized in that: The drug for treating and / or preventing atopic dermatitis refers to a drug that promotes the transcription and / or expression of the AhR gene.

6. The use according to claim 4, characterized in that: The atopic dermatitis treatment and / or prevention drug is a drug that inhibits Tslp Drugs that modulate gene transcription and / or expression.

7. Use of the strain and its bacterial components according to claim 1 or 2 in the preparation of health products.

8. A composition comprising the strain according to claim 1 or 2.

9. The composition according to claim 8, characterized in that The composition further contains a pharmaceutically acceptable carrier and / or excipient.

10. The composition according to claim 8, characterized in that The composition is prepared in the form of capsules, freeze-dried powder or bacterial liquid preparation.

Images