Genetically engineered exosome as well as slow release method and application thereof

Abstract

The invention discloses a gene engineering exosome and a slow release method and application thereof, the gene engineering exosome is derived from human adipose-derived stem cells, si-tgfbr2 is loaded in the gene engineering exosome, the si-tgfbr2 is specific siRNA aiming at a Tgfbr2 gene, and the gene engineering exosome can regulate and control proliferation of VSMCs, inhibit transformation of the VSMCs from a contraction phenotype to a synthetic phenotype when the VSMCs are stimulated, and inhibit the growth of the VSMCs. According to the present invention, the gene engineering exosome can be used to maintain the normal structure and the function of the blood vessel, and the sustained release effect of the content in the gene engineering exosome can be achieved by wrapping the gene engineering exosome in the PHA biodegradable material, such that the local treatment concentration can be easily stabilized, the drug administration frequency can be easily reduced, the lasting time of the treatment effect can be easily prolonged, and the treatment gene can be effectively delivered to the target cell; the treatment effect is improved; when being used for modifying a small-caliber artificial blood vessel, the small-caliber artificial blood vessel can be improved in biocompatibility and functionality, and can be prevented from being implanted into the blood vessel for remodeling unbenign hyperplasia stenosis; the invention not only provides a new thought and method for the treatment of vascular diseases, but also has important clinical application value and popularization prospect.

Description

Technical Field

[0001] The present invention relates to the technical field of small-caliber artificial blood vessels, and in particular to a genetically engineered exosome and a sustained-release method and application thereof. Background Art

[0002] Cardiovascular disease, as one of the most deadly diseases worldwide, has always been the focus of research in the medical field for its treatment and prevention. In clinical practice, due to the limited resources of autologous blood vessels, especially the increasing demand for small-caliber blood vessels (diameter ≤ 6 mm), traditional artificial blood vessel materials such as e-PTFE (expanded polytetrafluoroethylene) and PET (polyester) have good mechanical strength, but poor biocompatibility and anti-thrombotic properties, making it difficult to meet long-term clinical needs. Small-caliber artificial blood vessels often face multiple challenges after implantation, including impaired endothelial function caused by poor biocompatibility, increased risk of thrombosis and blockage, and excessive proliferation and transformation of smooth muscle cells to secretory type caused by changes in the microenvironment of vascular tissue, all of which will further aggravate the problem of vascular stenosis and blockage. Therefore, the development of new artificial blood vessel materials should not only have good mechanical properties, but also significantly improve their biocompatibility, promote vascular endothelialization, and effectively inhibit the occurrence of poor vascular remodeling and proliferative stenosis.

[0003] Transforming growth factor β receptor 2 (Tgfbr2), as a key receptor of the transforming growth factor β (TGF-β) signaling pathway, plays an important role in regulating biological processes such as cell proliferation, differentiation, migration and apoptosis. The Tgfbr2-mediated signaling pathway is closely related to the vascular remodeling process, and its abnormal activation or inhibition can lead to pathological phenomena such as poor vascular remodeling and proliferative stenosis. Therefore, intervention in the Tgfbr2-mediated signaling pathway provides new ideas and targets for the treatment of cardiovascular diseases.

[0004] Exosomes are vesicles with a lipid bilayer structure secreted by mother cells. They are not only rich in a variety of bioactive molecules, but also have high biocompatibility and targeting. In recent years, the research on exosomes in the fields of medicine and biology has continued to deepen, and their application potential in disease diagnosis, treatment and drug delivery has become increasingly prominent. In particular, the ability of exosomes to deliver intervention molecules as carriers provides the possibility for precise intervention in Tgfbr2-mediated signaling pathways. Exosomes derived from human adipose-derived stem cells (hADSCs) play an important role in mediating angiogenesis. Although hADSCs-derived exosomes show great potential in mediating angiogenesis, their safety and effectiveness in clinical application still need to be further verified, and there is no evidence of their intervention in Tgfbr2-mediated signaling pathways through genetic engineering. Therefore, how to achieve precise intervention and treatment of Tgfbr2-mediated signaling pathways through genetic engineering of exosomes is of great significance for the treatment strategy of cardiovascular diseases caused by adverse vascular remodeling and proliferative stenosis caused by Tgfbr2-mediated signaling pathways. Summary of the invention

[0005] Aiming at the problems of small-caliber artificial blood vessels in clinical applications, especially the abnormal Tgfbr2-mediated signaling pathway leading to pathological phenomena such as poor vascular remodeling and proliferative stenosis, how to use exosomes to achieve precise intervention and treatment is of great significance to the treatment strategy of cardiovascular diseases. The present invention aims to provide a genetically engineered exosome and its sustained release method and application.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] The present invention provides a genetically engineered exosome with the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells. The genetically engineered exosome is derived from hADSCs and loaded with si-tgfbr2, which is a specific siRNA for the Tgfbr2 gene.

[0008] The sequence of the Tgfbr2 gene is shown in SEQ ID NO.1.

[0009] Furthermore, the smooth muscle cells are vascular smooth muscle cells (VSMCs).

[0010] The method for constructing the above-mentioned genetically engineered exosomes with the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells includes: extracting hADSCs exosomes; designing and synthesizing siRNA that silences the Tgfbr2 gene; loading siRNA into hADSCs exosomes to obtain genetically engineered exosomes with the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells.

[0011] The sequence of the siRNA for silencing the Tgfbr2 gene is any one of SEQ ID NO.2 to SEQ ID NO.4.

[0012] The present invention provides a biodegradable biological coating, which comprises a polyhydroxyalkanoates (PHA) solution and the above-mentioned genetically engineered exosome solution having the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells.

[0013] The mass concentration of the PHA solution is 4 mg / mL to 6 mg / mL, and the solvent of the PHA solution is a 0.15 M sodium chloride aqueous solution; in terms of protein mass concentration, the mass concentration of the genetically engineered exosomes in the genetically engineered exosome solution having the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells is 80 μg / mL to 200 μg / mL, and the solvent is a PBS solution.

[0014] The invention provides a sustained-release system capable of inhibiting excessive proliferation and phenotype transformation of smooth muscle cells. The sustained-release system comprises the above-mentioned biological coating with biodegradable characteristics.

[0015] The present invention provides a small-caliber artificial blood vessel for slowly releasing genetically engineered exosomes, wherein the inner and outer walls of the small-caliber artificial blood vessel are adsorbed with the above-mentioned biological coating with biodegradable properties.

[0016] The present invention provides a method for preparing the above-mentioned small-caliber artificial blood vessel for sustained-release genetically engineered exosomes, comprising:

[0017] (1) placing the small-caliber artificial blood vessel to be treated in the above-mentioned biodegradable biological coating and soaking it for 20 to 30 minutes, washing it, and obtaining a small-caliber artificial blood vessel with a biological coating adsorbing genetically engineered exosomes with the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells;

[0018] (2) Repeat step (2) 4 to 5 times, wash, and obtain a small-caliber artificial blood vessel that slowly releases genetically engineered exosomes.

[0019] The use of the above-mentioned genetically engineered exosomes with the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells, or the above-mentioned bio-coating with biodegradable properties, or the above-mentioned sustained-release system with the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells in the preparation of drugs for inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells.

[0020] Compared with the prior art, the present invention has the following beneficial effects:

[0021] The present invention provides a genetically engineered exosome with the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells. The genetically engineered exosome is loaded with si-tgfbr2, which is a specific siRNA for the Tgfbr2 gene. The Tgfbr2 gene is a key receptor in the TGF-β signaling pathway and has an important influence on the proliferation and phenotypic transformation of smooth muscle cells. By specifically silencing the Tgfbr2 gene, the genetically engineered exosome can inhibit the excessive proliferation of smooth muscle cells caused by TGF-β signals, thereby blocking the TGF-β signaling pathway to achieve precise control of smooth muscle cell proliferation. Regulation; VSMCs will transform from a contractile phenotype to a synthetic phenotype when stimulated. The genetically engineered exosomes can effectively prevent the phenotypic transformation of VSMCs by inhibiting Tgfbr2, thereby maintaining the normal structure and function of blood vessels and preventing or slowing down the occurrence of related diseases; The genetically engineered exosomes are derived from hADSCs. As natural nanocarriers, hADSCs exosomes have excellent biocompatibility and permeability, can easily cross the cell membrane barrier, and efficiently deliver the carried bioactive substances to the target cells. Using exosomes as carriers can more effectively deliver therapeutic genes to target cells, thereby improving the therapeutic effect.

[0022] The invention provides a method for constructing genetically engineered exosomes. hADSCs are used as a source of exosomes, which have good biocompatibility and stability, thereby reducing safety risks in clinical applications. Specific siRNA is designed and synthesized for the Tgfbr2 gene, thereby further ensuring the specificity and effectiveness of the siRNA. The siRNA technology is used to silence the Tgfbr2 gene, and the designed siRNA is loaded into the hADSCs exosomes to form genetically engineered exosomes with the function of reducing the proliferation and phenotypic transformation of VSMCs. The exosomes can not only protect the siRNA from degradation, but also efficiently deliver the siRNA to VSMCs through its natural targeting and penetration, thereby specifically silencing the Tgfbr2 gene, thereby achieving effective inhibition of excessive proliferation and phenotypic transformation of VSMCs. The method can achieve efficient silencing of the Tgfbr2 gene, thereby helping to achieve a therapeutic effect in a short time, and reducing the number of medications and the pain of patients. The exosomes can continuously release siRNA, thereby achieving long-term silencing of the Tgfbr2 gene, thereby helping to maintain the therapeutic effect and reduce the risk of recurrence.

[0023] The biodegradable biological coating of the present invention comprises a PHA solution and a genetically engineered exosome solution. PHA, as a solvent, can not only stably preserve the exosomes, but also prevent them from being degraded or inactivated during the preparation, storage and application processes, which is essential for maintaining the biological activity and function of the exosomes. As a biomaterial, PHA also has good biocompatibility, does not induce obvious immune response or rejection reaction, can be gradually degraded and absorbed in the body, avoids complications that may be caused by long-term implants, reduces the need for subsequent surgery to remove implants, and reduces the patient's pain and medical costs. The genetically engineered exosomes themselves have high stability and tolerance, can maintain the integrity of their structure and function under various environments, thereby ensuring long-term therapeutic effects in the body. The biological coating can achieve sustained release control of genetically engineered exosomes, and has technical advantages such as dual stability guarantee, excellent biocompatibility and degradability, sustained release technology to achieve continuous treatment, precise treatment and targeting, and broad application prospects, bringing new breakthroughs and development opportunities to the biomedical field.

[0024] The present invention provides a sustained-release system capable of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells. The genetically engineered exosomes in the sustained-release system are designed to silence the Tgfbr2 gene, which plays a key role in the proliferation and phenotypic transformation of VSMCs. Therefore, the system can accurately intervene in the pathological process of VSMCs and reduce the side effects that may be caused by non-specific treatment. By adjusting the concentrations of PHA and PBS solutions, the sustained-release control of the genetically engineered exosomes can be achieved. This sustained-release mechanism enables the exosomes to be continuously and stably released to target sites such as vascular walls, thereby prolonging the therapeutic effect and improving the therapeutic efficiency. Therefore, the exosomes can continuously act on the vascular wall and prolong the therapeutic effect. Compared with a single administration, the sustained-release system can provide a longer treatment window, reduce the frequency of administration and the discomfort of the patient. The sustained-release system capable of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells provided by the present invention has significant advantages such as accurate treatment, sustained release, good biocompatibility, significant therapeutic effect and broad application prospects.

[0025] The small-caliber artificial blood vessels for sustained-release genetically engineered exosomes provided by the present invention have biological coatings with biocompatible PHA as solvent adsorbed on their inner and outer walls. The biological coatings can not only stably preserve the genetically engineered exosomes, but also gradually degrade and be absorbed in the body, thereby reducing the immune response and rejection response caused by implantation. The biological coatings also have the function of promoting the growth and migration of endothelial cells, accelerating the endothelialization process of the artificial blood vessels, and further improving the patency and service life of the blood vessels. As natural carriers for intercellular communication, genetically engineered exosomes have low immunogenicity, further enhancing the small-caliber artificial blood vessels. The biocompatibility of the artificial blood vessels can effectively inhibit the proliferation and phenotypic transformation of VSMCs, thereby reducing the occurrence of vascular intimal hyperplasia and restenosis, and improving the long-term patency of the blood vessels; through the sustained release of genetically engineered exosomes, it ensures that the therapeutic molecules can act on the blood vessel wall continuously and stably, prolonging the treatment effect. The small-caliber artificial blood vessels have been optimized in structure and function, and have shown significant technical advantages in biocompatibility, anti-proliferation, long-term patency and clinical application, making the surgical implantation process simpler and faster, and have important clinical value and broad application prospects.

[0026] The method for preparing a small-caliber artificial blood vessel with sustained release of genetically engineered exosomes provided by the present invention is simple and easy to operate, low in cost, and easy to carry out batch production. Through multiple soaking and washing steps, it can be ensured that the biological coating is uniformly and stably attached to the surface of the small-caliber artificial blood vessel; compared with the traditional surface modification method, the method of the present invention can significantly improve production efficiency and reduce production costs, which is of great significance for promoting the clinical application of small-caliber artificial blood vessels. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is an electron microscopic identification image of the exosomes in the present invention;

[0028] Figure 2 This is an immunoblot identification diagram of the exosome-specific marker protein in the present invention;

[0029] Figure 3 This is a diagram showing the structure of the genetically engineered exosomes of the present invention that have the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells;

[0030] Figure 4 The effects of hADSCs exosomes and the genetically engineered exosomes of the present invention on the proliferation of smooth muscle cells;

[0031] Figure 5 The effects of hADSCs exosomes and the genetically engineered exosomes of the present invention on the phenotypic transformation of smooth muscle cells;

[0032] Figure 6 Prepare sustained release profiles of bio-coatings for different biodegradable materials;

[0033] Figure 7 The present invention is a flow chart for preparing the bio-coating with biodegradable properties;

[0034] Figure 8 The present invention is a flow chart for preparing a small-caliber artificial blood vessel for sustained-release of genetically engineered exosomes. DETAILED DESCRIPTION

[0035] In order to enable those skilled in the art to better understand the scheme of the present invention, the technical scheme in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0036] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the art can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be obtained commercially.

[0037] Example 1: hADSCs exosome extraction and identification

[0038] This embodiment provides a method for extracting and identifying hADSCs exosomes, and the specific process is as follows:

[0039] 1. hADSCs were resuspended in DMEM medium containing 10% by mass of fetal bovine serum and 1% by mass of double antibody (penicillin-streptomycin solution), and the mixed cell suspension was evenly spread in a culture dish and cultured in a 37°C incubator. The culture medium was replaced every 3 days. When the cell density reached 85%, the cells were passaged. The 3rd to 4th generations could be used for subsequent experiments.

[0040] The DMEM culture medium is a high-glucose culture medium containing 4.5 g / L D-glucose, 4.5 g / L L-glutamine and 110 mg / L sodium pyruvate.

[0041] 2. Extraction of Exosomes

[0042] (1) When the density of hADSCs grew to 90%, the culture medium was replaced with DMEM containing 10% fetal bovine serum without exosomes and 1% double-antibiotic penicillin-streptomycin solution and cultured in a 37°C incubator for 48 h, and the culture medium was collected.

[0043] (2) Centrifuge at 1320 rpm and 4°C for 10 min, collect the supernatant, and store it at -80°C.

[0044] (3) Centrifuge at 3400 rpm and 4°C for 10 min and collect the supernatant.

[0045] (4) Centrifuge at 10,000 g, 4°C for 30 min and collect the supernatant.

[0046] (5) Centrifuge at 120,000 g for 90 min at 4 °C, discard the supernatant, and leave 200 μL-300 μL of culture medium. Repeatedly blow the exosome precipitate until the precipitate is dissolved in the culture medium. Pipette the exosomes into EP tubes, aliquot, and store at -80 °C.

[0047] 3. Exosome Identification

[0048] 5 μL of freshly extracted exosomes were applied to a 3 mm carbon-coated grid and the excess liquid was gently removed with filter paper. 5 μL of 1% uranyl acetate solution was applied to the grid to stain lipids and increase the contrast of the exosome membrane relative to the grid. Transmission electron microscopy (TEM) was then performed to characterize the morphology of the exosomes. The specific results are shown in the attached Figure 1 , exosomes have a distinct double-layer lipid membrane outline and a diameter of approximately 120 nm.

[0049] 4. Protein immunoblotting (Western blot) identification

[0050] Exosomes were identified using Western blot technology.

[0051] (1) Sample preparation

[0052] RIPA, protease inhibitors, protein phosphatase inhibitors and EDTA were mixed at a volume ratio of 100:1:1:1 to obtain RIPA lysis buffer. Exosomes and RIPA lysis buffer were mixed at a volume ratio of 1:1 by pipetting, oscillated to mix, and allowed to stand on ice for 15 min. Loading Buffer (5X) was added at a volume ratio of 4:1, and the protein was denatured by heating at 105°C in a metal bath for 5 min to facilitate subsequent SDS-PAGE electrophoresis and stored at -20°C.

[0053] (2) Preparation of electrophoresis gel and electrophoresis

[0054] Prepare separation gel and concentration gel, mix the sample by centrifugation and oscillation, add the processed sample into the electrophoresis tank, start electrophoresis with a voltage of 80V, and after the sample runs to the separation gel, adjust the voltage to 120V until the sample runs to the bottom and stop electrophoresis.

[0055] (3) Transfer and color development

[0056] Transfer the protein on the gel to the solid phase carrier, pour in the transfer solution to start transfer, 100V, 2h; then preliminarily confirm the transfer effect by Ponceau staining, Ponceau staining, wash with distilled water, wash with TBST for 10min, add blocking solution to block nonspecific binding sites for 2h; wash with TBST 3 times, 10min each time, incubate with primary antibody at 4℃ for 16h, wash with TBST 3 times, 10min each time, incubate with secondary antibody at room temperature for 2h, wash with TBST 3 times, 10min each time, use ECL (enhanced chemiluminescence) technology to detect the signal on the membrane, and collect images. For specific results, see the attached Figure 2 , TSG101, ALix or HSP70 are positive protein markers of exosomes, and the positive protein markers TSG101, ALix or HSP70 are expressed on the membrane, indicating that exosomes have been successfully separated and detected from the sample; Calnexin is a negative protein marker of exosomes, and Calnexin is not expressed on the membrane, further verifying that the detected samples are exosomes. This experiment successfully transferred the proteins on the gel to the solid phase carrier, and detected the specific protein markers of exosomes by Western Blotting technology, verifying the effectiveness and accuracy of the experiment.

[0057] 5. Nanoparticle Tracking Analysis (NTA) Exosome identification The particle size and concentration of exosomes were further confirmed by NTA.

[0058] The instrument was calibrated using polystyrene microspheres with a particle size of 100 nm (Zetaview-PMX120-Z, Germany) to ensure the accuracy of the measurement results. The sample pool was then washed with 1X PBS buffer, and the exosome sample was diluted with 1X PBS buffer to ensure that there would be no overlap or aggregation due to excessive particle concentration during measurement, thereby affecting the measurement accuracy. The diluted exosome sample was injected into the sample pool of the NTA instrument, and the particle movement trajectory was tracked by laser scattering and camera technology to calculate the particle size and concentration. Finally, the particle concentration within a specific particle size range was analyzed using ZetaView (version 8.05.14SP7) software to further confirm the existence and characteristics of exosomes. The results showed that the size of exosomes was in the range of 60-120 nm.

[0059] 6. Measurement of Exosome Concentration

[0060] The exosome concentration was determined by the microBCA (microbicinchoninic acid) method.

[0061] (1) Take solution A and solution B from the microBCA kit (ThermoFisher, catalog number: 23235), and mix thoroughly at a volume ratio of solution A: solution B = 50:1 to prepare BCA working solution;

[0062] (2) Add 200 μL of BCA working solution to each well of a 96-well plate;

[0063] (3) Add protein standard diluent according to different concentrations (protein concentrations are 0 mg / mL, 0.025 mg / mL, 0.05 mg / mL, 0.1 mg / mL, 0.2 mg / mL, 0.3 mg / mL, 0.4 mg / mL and 0.5 mg / mL);

[0064] (4) preparing RIPA lysis buffer by mixing RIPA, protease inhibitor, protein phosphatase inhibitor and EDTA in a volume ratio of 100:1:1:1;

[0065] (5) Lysis of exosomes: Mix the exosome sample and RIPA lysis buffer in a volume ratio of 1:1, pipette and shake to mix, and place on ice for 15 min to obtain a lysed exosome mixture;

[0066] (6) Determine absorbance and calculate concentration: Pipette an equal volume of the exosome lysate mixture obtained in step (5) and the protein standard into the wells containing the BCA working solution in step (2), and use a microplate reader or spectrophotometer to measure the absorbance of each well at 570 nm. Draw a standard curve based on the absorbance of the protein standard and the known concentration, and calculate the concentration of the protein in the exosome sample by comparing the absorbance of the exosome sample with the standard curve.

[0067] Example 2: Genetic Engineering of Exosomes from Human Adipose Stem Cells

[0068] Based on Example 1, this example uses the hADSCs exosomes obtained in Example 1 for genetic modification, including: designing and synthesizing siRNA to silence the Tgfbr2 gene; loading the siRNA into hADSCs exosomes to obtain genetically engineered exosomes with the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells. The specific structure is shown in the attached Figure 3 As shown, the genetically engineered exosomes were loaded with si-Tgfbr2.

[0069] The construction specifically includes the following steps:

[0070] siRNA designed against Tgfbr2 gene.

[0071] The sequence of Tgfbr2 (as shown in SEQ ID NO.1) is as follows:

[0072]

[0073] The siRNA designed for the Tgfbr2 gene is shown below, the positive strand of the siRNA sequence:

[0074] (1)GAAGAATATAACACCAGCAAT(SEQ ID NO.2)

[0075] (2)CTTCTACTGCTACCGCGTTAA(SEQ ID NO.3)

[0076] (3)CAACAACGGTGCCAGTCAAGTT(SEQ ID NO.4)

[0077] The above sequence is loaded into human adipose stem cell-derived exosomes using electroporation or chemical transfection.

[0078] The specific electroporation method is as follows: exosomes are loaded with siRNA by electroporation using the Gene PulserXcell (Bio-Rad, Hercules, CA) electroporation system; exosomes are diluted to 0.5 mg / mL in electroporation buffer (Bio-Rad, Hercules, CA); the diluted mixture of exosomes and siRNA is transferred to an ice-cold 0.4 cm cuvette and electroporated at 400 V and 125 μF capacitance with a pulse time of 10 ms to 15 ms; the samples are kept on ice for at least 10 min before and after the electroporation pulse; after electroporation, the samples are centrifuged at 7000 × g for 5 min to precipitate aggregates and remove possible aggregates or exosomes that have not been successfully loaded with siRNA.

[0079] The chemical transfection method was as follows: siRNA was loaded using the chemical transfection reagent Exo-Fect (System Biosciences, Palo Alto, CA, USA); 150 μg to 300 μg of exosomes were suspended in 50 μL PBS to obtain an exosome solution, and the exosome solution was incubated with Exo-Fect and 50-300 pmol of siRNA at 37°C for 10 min to promote the binding of siRNA to exosomes; then the exosomes were collected by incubating with ExoQuick-TC reagent (System Biosciences, Palo Alto, CA) on ice for 30 min and then centrifuged at 13,000 × g for 5 min. The exosome pellet was washed with PBS to remove excess reagents and unbound siRNA, and then resuspended in PBS for subsequent experiments.

[0080] Example 3: Functional Verification

[0081] In this example, based on Example 1-2, a functional verification test was performed on the genetically engineered exosomes of the present invention.

[0082] 1. Effects on Smooth Muscle Cell Proliferation in Vitro

[0083] This experiment mainly investigated the effects of hADSCs exosomes (hADSCs-exo) and the genetically engineered exosomes of the present invention (hASDCs-exos loaded with si-tgfbr2, si-tgfbr2-hADSCs-exos) on the proliferation of human umbilical vein smooth muscle cells (HUVSMCs).

[0084] HUVSMCs were seeded in 96-well plates (Beyotime biotechnology, Shanghai, China) (2×10 3 / well) and cultured in a cell culture incubator (ThermoFisher, Massachusetts, USA) at 37°C and 5% CO2. The cells were treated with 30 ng / mL of PDGF-BB and co-incubated with the genetically engineered exosomes of the present invention (100 μg / mL). The control group treated the cells with the same volume of serum-free cell culture medium; after 22 hours, CCK-8 solution (10 μL / well) was added and incubated for 2 hours, and finally the absorbance at 450 nm was measured. The results are shown in the attached Figure 4 shown.

[0085] By the attached Figure 4 The data show that compared with the control group, the absorbance value at 450nm of the hADSCs-exo treatment group was significantly reduced, indicating that hADSCs-exo can significantly inhibit the proliferation of HUVSMCs; the inhibitory effect of si-tgfbr2-hADSCs-exos of the present invention on the proliferation of HUVSMCs is more significant, indicating that loading si-tgfbr2 into hASDCs exosomes through genetic engineering technology significantly enhances the inhibitory effect of exosomes on the proliferation of HUVSMCs, and si-tgfbr2 affects the TGF-β signaling pathway by silencing the Tgfbr2 gene, thereby inhibiting the proliferation of HUVSMCs.

[0086] Compared with unmodified exosomes, the genetically engineered exosomes of the present invention can more accurately regulate the functions of target cells. By loading si-tgfbr2, targeted modification of exosome functions can be achieved, thereby improving their therapeutic effects, providing preliminary evidence for the application of exosomes in regulating smooth muscle cell proliferation.

[0087] 2. Inhibition of smooth muscle cell phenotypic transformation in vitro

[0088] This experiment mainly investigated the effects of hADSCs-exo and the si-tgfbr2-hADSCs-exos of the present invention on the phenotypic transformation of HUVSMCs.

[0089] When the HUVSMCs confluence reached 60%, 100 μg / mL of hASDCs-exos and si-tgfbr2-hASDCs-exos were used to treat HUVSMCs for 4 h, and the control group was added with an equal amount of PBS solution. After 4 hours, the cell supernatant was removed, the culture medium was replaced with new culture medium, and 30 ng / mL of platelet-derived growth factor BB (PDGF-BB) was added to induce HUVSMCs to transform into a secretory phenotype; after 24 hours, the cells were lysed and proteins were collected, and the expression levels of contractile phenotype markers α-SMA and SM22α were detected by immunoblotting. For specific results, see the attached Figure 5 shown.

[0090] By the attached Figure 5 The data show that PDGF-BB treatment significantly reduced the expression levels of contractile phenotype markers α-SMA and SM22α, indicating that HUVSMCs did undergo a transformation to a secretory phenotype under the action of PDGF-BB; the genetically engineered exosomes si-tgfbr2-hADSCs-exos of the present invention can significantly inhibit the transformation of HUVSMCs to a secretory phenotype after treatment, as manifested by the maintenance or increase of the expression levels of α-SMA and SM22α, indicating that silencing the Tgfbr2 gene through exosome delivery of siRNA and then blocking the TGF-β signaling pathway is an effective strategy to inhibit the phenotypic transformation of smooth muscle cells. Since the TGF-β signaling pathway plays an important role in regulating the phenotype of smooth muscle cells, this finding has important biological and potential clinical significance.

[0091] As a gene delivery carrier, exosomes have better biocompatibility and lower immunogenicity than traditional gene delivery methods, and can more effectively deliver biologically active molecules such as siRNA to target cells to achieve precise gene regulation; smooth muscle cell phenotypic transformation is closely related to the occurrence and development of various cardiovascular diseases. Therefore, by inhibiting the phenotypic transformation of smooth muscle cells, it is helpful to prevent and treat these diseases. As a new type of biological treatment strategy, the genetically engineered exosomes of the present invention have broad clinical application prospects.

[0092] Example 4: Bio-coating

[0093] Based on Example 2, this example provides a biodegradable bio-coating, which includes a PHA solution and a genetically engineered exosome solution. The bio-coating preparation flow chart of the bio-coating is shown in the attached Figure 6 shown.

[0094] The mass concentration of PHA solution was 5 mg / mL, and the solvent was deionized water containing 0.15 M NaCl;

[0095] Measured in terms of protein mass concentration, the mass concentration of exosomes in the genetically engineered exosome solution is 100 μg / mL, and the solvent of the genetically engineered exosome solution is PBS solution.

[0096] This experiment investigates the effects of different biodegradable materials as the genetically engineered exosome solvents of the present invention on the release performance of genetically engineered exosomes, and tests the changes in the release of genetically engineered exosomes over time by bio-coatings obtained from different biodegradable materials. The specific experimental process is as follows: In the PHA bio-coating of this embodiment, PHA is replaced with polyhydroxybutyrate (PHB), polycaprolactone (PCL) and polylactic acid (PLA) biodegradable materials and mixed with the genetically engineered exosome solution of the present invention to obtain a bio-coating as a control, and the bio-coatings obtained from the above different biodegradable materials are immersed in 2mL phosphate buffer (PBS) and placed in a 37°C constant temperature incubator to simulate the in vivo environment; the buffer solution for soaking the bio-coating is collected regularly every day, and the collection time is recorded, and 2mL of fresh PBS is added to each sample to keep the total volume unchanged. The concentration of genetically engineered exosomes in the buffer solution collected daily by the nanoparticle analyzer was used to draw the release curve of genetically engineered exosomes from different biodegradable materials over time, and the release performance of genetically engineered exosomes when different biodegradable materials were used as solvents was compared. For specific test data, please refer to the attached Figure 7 shown.

[0097] By the attached Figure 7 The data shows that in the early stage of the experiment (0-6 days): PCL and PLA materials showed a higher exosome release, reaching more than 60%, while PHA and PHB materials maintained a relatively stable release in the early stage, maintaining at around 50%, showing a more gentle release characteristic; in the middle and late stages of the experiment (8-30 days): PHA materials showed significant advantages. The release concentration of exosomes gradually increased during this stage, while other materials did not show a clear upward trend or the trend was weaker. This shows that PHA materials have a longer drug sustained release time and can better meet the needs of applications that require long-term controlled release.

[0098] Example 5: Small-caliber artificial blood vessels that slowly release genetically engineered exosomes

[0099] Based on Example 4, this example provides a small-caliber artificial blood vessel that slowly releases genetically engineered exosomes. The inner and outer walls of the small-caliber artificial blood vessel are adsorbed with the above-mentioned biodegradable biological coating. The specific preparation method is shown in the attached Figure 8 As shown, including:

[0100] (1) The small-caliber artificial blood vessel to be modified is placed in the biodegradable biological coating (containing genetically engineered exosome solution and PHA solution) of Example 4 and immersed for 20 min to 30 min, and the surface of the small-caliber artificial blood vessel is cleaned to ensure the cleanliness of the small-caliber artificial blood vessel, so as to obtain a small-caliber artificial blood vessel with a biological coating containing genetically engineered exosomes that have the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells;

[0101] (2) Repeat step (1) 4 to 5 times, and wash. Multiple soaking and washing can remove excess coating and ensure that the coating can be more evenly adsorbed during each soaking, thereby improving the overall quality and effect of the coating and obtaining a small-caliber artificial blood vessel that slowly releases genetically engineered exosomes.

[0102] The preparation method of the small-caliber artificial blood vessel for sustained release of genetically engineered exosomes of the present invention is simple and easy to operate, low in cost, and easy to carry out batch production. The small-caliber artificial blood vessel is transformed by using a biodegradable biological coating, which is soaked and washed in the biological coating for many times to remove excess coating, so that the coating can be more evenly adsorbed on the surface of the blood vessel during the next soaking, thereby improving the overall quality and effect of the coating and ensuring the uniformity of the coating; at the same time, the interaction and contamination between different chemical substances are avoided to ensure the product quality during the transformation of the small-caliber artificial blood vessel, and the obtained small-caliber artificial blood vessel for sustained release of genetically engineered exosomes significantly improves the biocompatibility and long-term patency of the blood vessel, providing a new idea and technical means for solving the problem of vascular restenosis, and at the same time can significantly improve the biological performance of the artificial blood vessel, and reduce the smooth muscle cell proliferation and phenotypic transformation caused by its implantation; the transformed small-caliber artificial blood vessel has a wide range of application prospects in medical fields such as vascular reconstruction and vascular transplantation.

[0103] The surface of the small-caliber artificial blood vessel for sustained-release genetically engineered exosomes of the present invention is adsorbed with a biodegradable biological coating with biocompatible PHA as a solvent. The coating can not only stably preserve the genetically engineered exosomes, but also gradually degrade and be absorbed in the body. The introduction of small-caliber artificial blood vessels further improves the biocompatibility of the small-caliber artificial blood vessels, so that the inflammatory reaction and rejection reaction can be reduced when the small-caliber artificial blood vessels are in contact with blood and surrounding tissues, thereby facilitating the long-term stability and functional recovery of the blood vessels. The coating contains genetically engineered exosomes that can effectively inhibit the abnormal proliferation and phenotypic transformation of smooth muscle cells. The genetically engineered exosomes, as natural carriers for intercellular communication, have low immunogenicity, further enhance the biocompatibility of the small-caliber artificial blood vessels, and can effectively inhibit the proliferation and phenotypic transformation of VSMCs, thereby reducing the occurrence of vascular intimal hyperplasia and restenosis, which is of great significance for improving the long-term patency of blood vessels.

[0104] In summary, the present invention constructs genetically engineered exosomes with specific functions, uses the genetically engineered exosomes to obtain a biodegradable biological coating, and attaches the biocoating to small-caliber artificial blood vessels to obtain small-caliber artificial blood vessels that slowly release genetically engineered exosomes, thereby achieving effective regulation of vascular smooth muscle cell proliferation and phenotypic transformation, reducing the occurrence of vascular intimal hyperplasia and restenosis, which not only provides new ideas and methods for the treatment of vascular diseases, but also has important clinical application value and promotion prospects.

[0105] The above contents are only for explaining the technical idea of ​​the present invention and cannot be used to limit the protection scope of the present invention. Any changes made on the basis of the technical solution in accordance with the technical idea proposed by the present invention shall fall within the protection scope of the claims of the present invention.

Claims

1. A genetically engineered exosome capable of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells, characterized in that: The genetically engineered exosomes are derived from hADSCs and are loaded with si-tgfbr2, which is a specific siRNA targeting the Tgfbr2 gene.

2. The genetically engineered exosomes having the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells according to claim 1, characterized in that: The sequence of the Tgfbr2 gene is shown in SEQ ID NO.

1.

3. The method for constructing the genetically engineered exosomes having the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells according to any one of claims 1 to 2, characterized in that: include: Extract hADSCs exosomes; design and synthesize siRNA that silences the Tgfbr2 gene; load siRNA into hADSCs exosomes to obtain genetically engineered exosomes that have the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells.

4. The method for constructing genetically engineered exosomes having the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells according to claim 3, characterized in that: The sequence of the siRNA for silencing the Tgfbr2 gene is any one of SEQ ID NO.2 to SEQ ID NO.

4.

5. A biodegradable bio-paint, characterized in that: The biological coating comprises a PHA solution and the genetically engineered exosome solution having the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells as claimed in any one of claims 1 to 2.

6. The biodegradable bio-paint according to claim 5, characterized in that: The mass concentration of the PHA solution is 4 mg / mL to 6 mg / mL, and the solvent of the PHA solution is a 0.15 M sodium chloride aqueous solution; in terms of protein mass concentration, the mass concentration of the genetically engineered exosomes in the genetically engineered exosome solution having the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells is 80 μg / mL to 200 μg / mL, and the solvent is a PBS solution.

7. A sustained-release system capable of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells, characterized in that: The sustained-release system comprises the biodegradable biological coating according to any one of claims 5 to 6.

8. A small-caliber artificial blood vessel for sustained release of genetically engineered exosomes, characterized in that: The inner and outer walls of the small-caliber artificial blood vessel are adsorbed with the biodegradable biological coating according to any one of claims 5 to 6.

9. The method for preparing a small-caliber artificial blood vessel for sustained-release of genetically engineered exosomes according to claim 8, characterized in that: include: (1) placing the small-caliber artificial blood vessel to be treated in the biodegradable biological coating according to any one of claims 5 to 6 and soaking it for 20 to 30 minutes, and washing it to obtain a small-caliber artificial blood vessel adsorbed with the biodegradable biological coating; (2) Repeat step (1) 4 to 5 times, wash, and obtain a small-caliber artificial blood vessel that slowly releases genetically engineered exosomes.

10. Use of the genetically engineered exosomes having the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells as described in any one of claims 1 to 2, or the biodegradable biological coating as described in any one of claims 5 to 6, or the sustained-release system having the function of inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells as described in claim 7 in the preparation of drugs for inhibiting excessive proliferation and phenotypic transformation of smooth muscle cells.

Images