Biosynthetic biliverdin-based plasmid vector for visual detection of cadmium ions, biosensor thereof and quantitative detection method of biosynthetic biliverdin-based plasmid vector

Abstract

The invention discloses a plasmid vector for visually detecting cadmium ions based on biosynthetic biliverdin as well as a biosensor and a quantitative detection method of the plasmid vector. The sequence of the plasmid vector pET21a-cadR-C448SCY-ho1 is as shown in SEQ ID NO. 1. According to the whole-cell biosensor prepared by the invention, far-red fluorescence of a biosensor cell culture solution can be used as an output signal, and blue-green of a biosensor cell precipitate can also be used as an output signal to quantitatively detect the cadmium ion concentration in a real environment, which is reflected on a structural element of the biosensor, and is also reflected on the basis of a detection result. The invention further provides a novel method for quantifying the color change of the cell precipitate.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a plasmid vector for visually detecting cadmium ions based on biosynthesized biliverdin, a biosensor and a quantitative detection method thereof. Background Art

[0002] In recent years, cadmium pollution has become a growing concern because it poses a serious risk to human health through drinking water and food chain transfer. Therefore, it is very necessary to remove cadmium from industrial and agricultural wastewater and mining wastewater. However, monitoring should be carried out at the same time to assess compliance with regulatory requirements to reduce health risks. Due to its simplicity, low cost and good stability, the research and application of transcription factor-based whole-cell biosensors for cadmium detection are increasing. In particular, these biosensors can provide information on the bioavailability and toxicity of heavy metals, which is incomparable to traditional quantitative methods (such as AAS, AFS, ICP-OES, etc.). These traditional methods require expensive instruments and equipment, complex pretreatment, and are very time-consuming and require professionals. Chemical sensors and molecular-based biosensors can also overcome these difficulties. However, they cannot identify the bioavailable part of environmental analytes, which is more important for risk assessment. In addition, compared with traditional materials, bacteria can self-renew and resist harsh environments, making them very suitable for heavy metal detection in environmental samples with complex components.

[0003] At present, the technology of detecting cadmium using whole-cell biosensors mainly lies in the reading and characterization methods of the output signals. The signal reading methods of whole-cell biosensors are mainly fluorescence, chemiluminescence and color signals. In contrast, color signals are more convenient to use and have great development potential in in situ detection. The color signal of whole-cell biosensors can be generated in various ways. β-galactosidase can convert substrates into colored products, but the substrate needs to be added exogenously; the bioluminescence catalyzed by luciferase requires energy provided by cell metabolism. This process is thermally unstable and sometimes requires the addition of substrates from the outside; the fluorescent color produced by fluorescent proteins requires additional excitation light sources.

[0004] Using the color of biosynthesized natural pigments as output signals is a method that does not require substrates and additional light sources. Chinese Patent 2023117049885 discloses a whole-cell biosensor for detecting cadmium and its application, Chinese Patent 2021103459902 discloses the construction and application of a lead ion microbial whole-cell biosensor with a water-soluble blue pigment as an output signal, and Chinese Patent 2021103459796 discloses the construction and application of a mercury ion microbial whole-cell biosensor with violacein as an output signal. The above patents use indigoidine, violacein and its derivatives to prepare biosensors, and the defects of these pigments are that they are produced in small amounts in cells and the color is not obvious. Most of the time, they need to be extracted from a large number of cells, but extracting pigments from cells requires complex procedures; synthetic small molecule pigments are also unfixed and easy to fade, which seriously affects the reading of color signals. In addition, these methods for identifying color signals are qualitative, and quantitative methods still require colorimetry and rely on colorimeters. Chinese Patent 2019110190062 discloses a fusion gene, a recombinant vector and a preparation method thereof, a cadmium ion whole-cell biosensor and a preparation method and application thereof. Although the invention patent uses the red color of biosynthesized phycobiliprotein to identify cadmium exposure, it does not establish a quantitative method for cell color, making it difficult to apply in actual environmental testing.

[0005] Cyanobacterial phytochromes can automatically bind to biliverdin (BV) (XJWu, JYQu, CTWang, YPZhang, PPLi, Biliverdin incorporation into the cyanobacteriochrome SPI1085g3 from Spirulina, Front. Microbiol. 13 (2022) 952678.). Currently, far-red and near-infrared fluorescent proteins combined with BV developed from cyanobacterial phytochromes have been used for in vivo molecular labeling and imaging, but whether BV can be used in whole-cell biosensors has never been reported and confirmed.

[0006] The existing cadmium whole-cell biosensor signal output and reading methods still rely on instruments and equipment, and color production depends on exogenous substrates and excitation light sources. For example, if natural pigments are used as output signals, the unbound free small molecule pigments cannot accumulate in large quantities in the cells, resulting in unclear color development, unstable pigments, complex extraction, and small molecules that are easily disturbed and faded. Summary of the invention

[0007] Purpose of the invention: In order to solve the above technical problems, the present invention aims to provide a plasmid vector for visual detection of cadmium ions based on biosynthesized biliverdin, which solves the problems of unstable cell color development, dependence on instruments and equipment, complex pigment extraction and easy fading, and difficulty in quantitative detection using color.

[0008] The invention also provides a biosensor for visually detecting cadmium ions and a quantitative detection method.

[0009] The present invention also provides a detection method using far-red fluorescence as an output signal of the whole-cell biosensor.

[0010] Technical solution: In order to achieve the above-mentioned purpose, the present invention provides a plasmid vector pET21a-cadR-C448S_CY-ho1 for visual detection of cadmium ions, and the sequence of the plasmid vector pET21a-cadR-C448S_CY-ho1 is shown in SEQ ID NO.1.

[0011] The construction method of the plasmid vector pET21a-cadR-C448S_CY-ho1 of the present invention comprises the following steps:

[0012] (1) Amplifying the cadmium ion response element cad promoter and the transcription factor cadR coding sequence, and inserting the amplified product into the expression vector pET21a after restriction digestion to obtain the expression plasmid pET21a-cadR;

[0013] (2) amplifying the C448S_CY sequence, digesting the amplified product and ligating it with the plasmid pET21a-cadR obtained in step (1) to obtain the plasmid pET21a-cadR-C448S_CY;

[0014] (3) Amplify the heme oxygenase ho1 sequence, and after restriction digestion, connect the amplified product with the pET21a-cadR-C448S_CY obtained in step (2) to construct the recombinant plasmid pET21a-cadR-C448S_CY-ho1.

[0015] Preferably, the method for constructing the plasmid vector of the present invention comprises the following steps:

[0016] (1) The cadR gene, cad operator, two consecutive repeats of the cad promoter, and the corresponding multiple cloning site were synthesized by a biological company to generate a new DNA fragment, and restriction sites Bgl II and Xho I were added to both ends of the DNA fragment. The fragment was double-digested with restriction endonucleases Bgl II and Xho I, and inserted into the expression vector pET21a double-digested with the same enzymes to obtain the expression plasmid pET21a-cadR;

[0017] (2) Using the C448S_CY sequence as a template, primers were designed for amplification. The product was double-digested with restriction endonucleases SacⅠ and HindⅢ, and then ligated with the expression plasmid pET21a-cadR that had been double-digested with the same enzymes to obtain a new expression plasmid pET21a-cadR-C448S_CY;

[0018] (3) The heme oxygenase ho1 gene was synthesized by a biological company, and restriction sites NdeⅠ and Xho I were added to both ends of the DNA fragment. The fragment was double-digested with restriction endonucleases NdeⅠ and XhoⅠ, and ligated with the expression plasmid pET21a-cadR-C448S_CY double-digested with the same enzymes, and finally the recombinant plasmid pET21a-cadR-C448S_CY-ho1 was obtained.

[0019] The invention discloses an application of the plasmid vector for visually detecting cadmium ions in preparing a cell biosensor for detecting cadmium ions.

[0020] The present invention also provides a cell biosensor for visually detecting cadmium ions, comprising the plasmid vector for visually detecting cadmium ions.

[0021] The plasmid vector or the cell biosensor of the present invention is used in visually detecting the concentration of cadmium ions.

[0022] Furthermore, the plasmid vector or the cell biosensor of the present invention is used for visual detection of cadmium ion concentration in water.

[0023] Furthermore, the application process is: culturing cells carrying the plasmid vector pET21a-cadR-C448S_CY-ho1 described in claim 1, then mixing the bacterial solution with the water sample to be tested, centrifuging to obtain the cell sediment, taking pictures, and calculating the G / Y value of the sample to obtain the cadmium ion concentration.

[0024] Preferably, the bacterial liquid and the mixed solution of the water sample to be tested are reacted at 16° C. for 5 hours.

[0025] Furthermore, the cells carrying the plasmid vector pET21a-cadR-C448S_CY-ho1 were Escherichia coli LB21 (DE3), and the cells were cultured to OD 600 The value is 0.6-0.8.

[0026] Furthermore, the cell sediment image obtained after the photo was processed by ImageJ software, and the colored circular image was separated into three channels according to the CIELab color space theory: the L value represents the brightness; the a value represents the color range change from green to red; the b value represents the color change from blue to yellow; the a channel indicates the green change of BV, the b channel indicates the yellow change of Escherichia coli itself, the grayscale is used to represent the color depth of each channel, and the grayscale value is calculated using ImageJ software, and the grayscale value of the circular image corresponding to each concentration is represented by a value and b value, wherein a is a negative number indicating that the color of the image is green, and the size represents the green value G value; b is a positive number indicating that the color of the image is yellow, and the size represents the yellow value Y value, G / Y is defined as the degree of color change of the biosensor cells, and the G / Y value of each concentration is calculated to obtain the linear relationship between cadmium concentration and color change as a standard curve.

[0027] An application of utilizing the plasmid vector or the cell biosensor to detect cadmium ion concentration by using far-red fluorescence as an output signal.

[0028] Furthermore, the application process is: culturing cells carrying the plasmid vector pET21a-cadR-C448S_CY-ho1, then mixing the bacterial solution with the water sample to be tested, exciting the culture with 645nm excitation light, and detecting the fluorescence intensity of the culture solution at a wavelength of 700nm.

[0029] Preferably, cells carrying the plasmid vector pET21a-cadR-C448S_CY-ho1 described in claim 1 are cultured, and then the bacterial solution is mixed and cultured with the water sample to be tested, the culture is excited with an excitation light of 645nm, and the fluorescence intensity of the culture solution at a wavelength of 700nm is detected to obtain the linear relationship between the cadmium concentration and the fluorescence intensity change as a standard curve.

[0030] Furthermore, the bacterial liquid and the mixed solution of the water sample to be tested are reacted at 16-18° C. for 4-5 hours.

[0031] Preferably, the bacterial liquid and the mixed solution of the water sample to be tested are reacted at 16° C. for 5 hours.

[0032] The whole-cell biosensor of the present invention is formed by integrating the promoter, transcription activator cadR, cyanobacterial photosensitive pigment C448S_CY and heme oxygenase ho1 that respond to cadmium. C448S_CY can efficiently bind to biosynthesized biliverdin (BV), and BV is converted from endogenous heme in the cell. The present invention uses the green color of BV as the output signal of the whole-cell biosensor, and indicates the concentration of cadmium ions by the change of the green color of the cell precipitate. This conversion depends only on the catalytic action of ho1. Compared with the transcription repressor CadC, the transcription activator CadR can have stricter control over the transcription of C448S_CY and ho1, thereby reducing signal leakage. In addition, the present invention also proposes a quantitative method for the color of sensor cells, and uses this method to detect the concentration of cadmium ions in various environmental water bodies. Again, in addition, the biosensor constructed by the present invention can directly use the far-red fluorescence of the culture solution as a signal output to detect the concentration of cadmium ions. Since the far-red fluorescence greater than 700nm has strong penetrating power and low fluorescence background (such as the fluorescence background of culture medium or organic impurities), the far-red fluorescence exhibited by this biosensor has significant advantages as a reporter template over the green fluorescence, orange fluorescence, and red fluorescence of traditional cell biosensors.

[0033] The present invention is the first to use the bile pigment protein of cyanobacterial phytochrome C448S_CY combined with chlorophyll (BV) to construct a whole-cell biosensor, and is the first to propose the use of the biosensor for detecting heavy metal ions (including cadmium ions), with a very excellent detection effect.

[0034] The plasmid vector pET21a-cadR-C448S_CY-ho1 for visually detecting cadmium ions constructed by the present invention can be used to prepare a whole-cell biosensor for detecting cadmium ions. Unlike the existing phycocyanin (CpcB) that combines with red PEB, relies on the catalysis of lyase, and uses CadC as a regulatory factor, the cyanobacterial phytochrome (C448S_CY) in the present invention automatically combines with green BV, uses CadR as a regulatory factor, and adopts two promoters; unlike the existing whole-cell biosensor, the present invention adopts a new plasmid construction method, and there are significant differences in the signal generation process.

[0035] The green color of the cells in the present invention is the color of biosynthesized BV, and the amount of BV produced is related to the color depth. In the present invention, the amount of BV produced is regulated to regulate the color depth. The working principle of the whole-cell biosensor prepared in the present invention is: the amount of BV produced is regulated by the promoter and transcription factor. When cadmium ions are present, it combines with the transcription factor CadR to activate the promoter, producing a large amount of BV, and when the cadmium ion concentration is low, a small amount of BV is produced. In the present invention, the production of BV depends on the cadmium ion concentration, and the green color of cell BV depends on the production of BV. Therefore, the green color of the cell can reflect the cadmium ion concentration. Since other substances cannot bind to CadR to activate the promoter, BV cannot be synthesized, and the green color of BV cannot be regulated by other substances, and cannot indicate the concentration of other substances.

[0036] In the present invention, the green color change represents the synthesis change of BV, and the synthesis amount of BV is related to the induction of cadmium ions. Cadmium ions bind to CadR and induce the promoter to start, prompting HO1 to express, thereby catalyzing heme to synthesize BV.

[0037] The present invention uses far-red fluorescence as the output signal of the whole-cell biosensor for the first time to detect analytes. This far-red fluorescence is produced by the change in the conjugated structure of BV after the bile pigment BV and the cyanobacterial phytochrome C448S_CY combine. The transcription of genes related to BV synthesis is regulated by the binding of cadmium ions and CadC, thereby achieving cadmium ion-dependent fluorescence output of the sensor cell.

[0038] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages:

[0039] The present invention constructs a plasmid vector and a brand-new whole-cell biosensor for visual detection of cadmium ions, which is not only reflected in the structural elements of the biosensor, but also in the innovation of the detection method and the detection process, and can realize simple, easy-to-operate, cheap, and highly sensitive quantitative detection of cadmium ions in wastewater with minimal instruments. The detection limit of the biosensor of the present invention is as low as 6.7nM, which is significantly lower than the threshold value (27.6nM) of the drinking water cadmium concentration specified by the World Health Organization, and can use the color of the biosensor cell precipitate as the output signal to quantitatively detect the cadmium ion concentration in wastewater treatment.

[0040] The present invention visualizes the color of biliverdin and is the first to quantitatively measure the color change of BV after using mobile phone imaging. In addition, due to the fixation of BV by protein and the protection of cells, the color displayed by cells is very stable. BV is not easy to degrade and fade, nor is it secreted outside the cell. It is completely fixed in the cell, so it is very convenient for quantification. At the same time, due to the isolation effect of the cell, it can resist the interference of other components in the water sample.

[0041] Compared with the existing ICP-MS, the whole-cell biosensor prepared by the present invention is simple to operate, has low detection cost, does not require large instruments, and can visually judge cadmium exposure by using changes in cell color. In addition, it can also detect bioavailable cadmium ions in water and soil to assess the real environmental risks caused by cadmium.

[0042] The present invention is the first to propose a precedent for using far-red fluorescence as the output signal of a whole-cell biosensor. Due to its inherent characteristics (strong penetration, low background, and low toxicity), this far-red fluorescence will play an important role in the method of detecting analytes using a whole-cell biosensor.

[0043] The present invention can use far-red fluorescence as an output signal. This fluorescent signal has significant advantages over traditional short-wavelength fluorescent signals and can avoid the influence of background fluorescence (because whether it is a biological sample or an environmental sample, its sample impurities may produce blue or green background fluorescence, or even red background fluorescence, but will not produce far-red background fluorescence). For example, when the traditional GFP (green fluorescent protein) that has been reported is used as an output signal, the background fluorescence generated by the cell culture medium will mask the fluorescence signal of GFP. Therefore, the fluorescent signal of the culture solution cannot be directly detected, and the fluorescent signal of the cell can only be detected after the culture medium is removed by centrifugation, which increases the detection procedure. Therefore, the use of far-red fluorescence reduces background interference and simplifies the detection process. In addition, the long-wavelength far-red fluorescence has strong penetrating power and is suitable for the detection of complex samples. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Schematic diagram of the whole-cell biosensor plasmid based on biosynthetic biliverdin;

[0045] Figure 2 For visualization of standard cadmium solution and separation of cell colors;

[0046] Figure 3 The fluorescence excitation and emission spectra of the whole-cell biosensor;

[0047] Figure 4 is the linear relationship between cadmium ion concentration and G / Y value;

[0048] Figure 5 is the linear relationship between cadmium ion concentration and fluorescence intensity;

[0049] Figure 6 Detection of environmental water samples by biosensors. DETAILED DESCRIPTION

[0050] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0051] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources. Experimental methods without specific conditions specified in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0052] The gene sequences in the examples were synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0053] Plasmid pETDuet-C448S_CY, see the literature Biliverdin incorporation into the cyanobacteriochrome SPI1085g3 from Spirulina, Front.Microbiol.13(2022)952678 for details.

[0054] Example 1

[0055] Construction of recombinant plasmid pET21a-cadR-C448S_CY-ho1

[0056] The DNA sequence of the cadmium response element (composed of the cadR gene, the cad promoter, and the operator gene) was obtained from NCBI (gene accession number: AF071413.3). A multiple cloning site was designed on the sequence to insert C448S_CY and heme oxygenase HO1. Two repeated cad promoters and ribosome binding sites were also designed. Each promoter activated a gene. The DNA fragment containing the cadmium response element and the multiple cloning site was synthesized by Nanjing GenScript Biotechnology Co., Ltd., and restriction sites Bgl II and Xho I were added to both sides of the synthesized DNA fragment. Its sequence is shown in SEQ ID NO. 2. The fragment shown in SEQ ID NO. 2 was double-digested with restriction endonucleases Bgl II and Xho I, inserted into the expression vector pET21a double-digested with the same enzymes, and after enzyme ligation transformation and plasmid extraction, the expression plasmid pET21a-cadR was obtained.

[0057] Using the C448S_CY sequence as a template (XJWu, JYQu, CTWang, YPZhang, PPLi, Biliverdin incorporation into the cyanobacteriochrome SPI1085g3 from Spirulina, Front. Microbiol. 13 (2022) 952678.), primers were designed for PCR amplification (upstream primer: CATGGAGCTCTATCCGACGTTCTTTAAACCT; downstream primer: GCGTAAGCTTGATTGTGCCTGCATTTGTTG). The plasmid pETDuet-C448S_CY was used as a template for amplification, and the PCR product was double-digested with restriction endonucleases SacⅠ and HindⅢ to obtain a linearized plasmid, which was then ligated with the expression plasmid pET21a-cadR double-digested with the same enzymes as mentioned above (T4 DNA ligase kit was provided by ThermoScientific, catalog number EL0011). After enzyme ligation transformation and plasmid extraction, a new expression plasmid pET21a-cadR-C448S_CY was constructed. The heme oxygenase ho1 sequence was obtained from NCBI (gene accession number: WP_017304095). The fragment was synthesized by Nanjing GenScript Biotechnology Co., Ltd., and restriction sites and NdeⅠ and XholⅠ were added on both sides of the gene. The fragment was double-digested with restriction endonucleases NdeⅠ and XhoⅠ to obtain a linearized plasmid, which was ligated with the expression plasmid pET21a-cadR-C448S_CY double-digested with the same enzymes. After enzyme ligation transformation and plasmid extraction, the final sensor recombinant plasmid pET21a-cadR-C448S_CY-ho1 was constructed. The plasmid is as shown in Figure 1 The sequence of the recombinant plasmid is shown in SEQ ID NO.1. The plasmid pET21a-cadR-C448S_CY-ho1 was added to the pre-prepared E. coli BL21 (DE3) competent cells (prepared by CaCl2 method), and the cells were quickly ice-bathed for 2 minutes after heat shock at 42°C for 90 seconds. A small amount of fresh liquid LB medium was added and cultured at 37°C for 45 minutes to allow the cells to recover. The cells transformed with the plasmid were spread on solid LB medium and cultured at 37°C overnight. The transformants were selected and cultured in liquid LB medium at 37°C until OD 600 The value is about 0.6, that is, the sensor cells are in the logarithmic phase, which are used as biosensors for subsequent experimental test cells.

[0058] Example 2

[0059] Recombinant plasmid pET21a-cadR-C448S_CY-ho1 to detect cadmium concentration (cell colorimetric method)

[0060] Take 6 equal portions of the biosensor cells prepared in Example 1 and place them in 1.5 mL centrifuge tubes, 1 mL each, centrifuge to remove the culture medium to obtain a cell pellet, add 0.8 mL of fresh culture medium of 1.25x LB to resuspend the cells, and add 0.2 mL of cadmium standard solution at the same time, so that the final concentration of cadmium is 0, 50, 100, 150, 200, 250 nM. Shake 1 mL of the mixture at 16 ° C for 5 hours, and the shaker speed is 200 rpm. Collect the cells and centrifuge to remove the liquid culture medium to obtain a cell pellet.

[0061] like Figure 2 As shown, the obtained cell precipitates are arranged in a row on white paper and imaged with a smart phone, keeping the cell precipitates in the centrifuge tubes parallel to the mobile phone camera, and the heights of each centrifuge tube and the mobile phone camera are kept consistent. The change in the green degree of the cell precipitate is positively correlated with the cadmium ion concentration. Therefore, the present invention prepares a visual biosensor that can judge the exposure of cadmium ions by the green change of biliverdin accumulated in the biosensor cells.

[0062] The cell pellet images were processed using ImageJ software. Figure 2 As shown in FIG. 1 , a circular cell cluster of uniform size is cut out from the center of the cell sediment image. According to the CIELab color space theory, the colored circular image is separated into three channels (the L channel represents brightness; the a channel represents the color range change of green to red; the b channel represents the color change of blue to yellow). Among them, the a channel and the b channel are as shown in FIG. Figure 2 As shown, the a channel indicates the green change of BV, and the b channel indicates the yellow change of E. coli itself. Grayscale is used to represent the color depth of each channel. And the grayscale value is calculated using ImageJ software. The grayscale value of the circular image corresponding to each concentration is represented by a value and b value. Where a is a negative number, indicating that the color of the image is green, and the size represents the green value (G value); b is a positive number, indicating that the color of the image is yellow, and the size represents the yellow value (Y value). Therefore, G / Y is defined as the degree of color change of the biosensor cells, and the G / Y value of each concentration is calculated. As shown Figure 4 As shown in Figure 2, the linear relationship between cadmium concentration and color change was obtained as the standard curve. The linear equation, R 2 The value is 0.997, with a good linear relationship, and the minimum detection limit (3 times the standard deviation / slope of the G / Y value in the absence of cadmium ions) is calculated to be 6.7nM. The linear range of detection is 6.7-250nM, which is significantly lower than the threshold of drinking water cadmium concentration specified by the World Health Organization (27.6nM). This means that the G / Y value of biosensor cell precipitation can be used to quantify cadmium ion exposure, which has important application prospects in environmental testing.

[0063] Through the above experimental scheme, without relying on any detection instruments, only using a smartphone to image the cell sediment can achieve the goal of visual detection of cadmium ion concentration easily and conveniently, and utilize the green signal obtained by the cyanobacterial photosensitive pigment that can bind to BV in large quantities in the cell, and the proposed color quantification method to achieve the goal of highly sensitive quantitative detection of cadmium ion concentration.

[0064] Example 3

[0065] Recombinant plasmid pET21a-cadR-C448S_CY-ho1 to detect cadmium concentration (cytofluorescence method)

[0066] The biosensor cells prepared in Example 1 were placed in a 1.5 mL centrifuge tube, the culture medium was centrifuged to obtain a cell pellet, 0.8 mL of fresh culture medium of 1.25x LB was added to resuspend the cells, and 0.2 mL of cadmium standard solution was added at the same time, so that the final concentration of cadmium was 250 nM. 1 mL of the mixed solution was shaken at 16°C for 5 hours, and the shaking speed was 200 rpm to obtain a culture solution, and the fluorescence excitation spectrum and fluorescence emission spectrum of the culture solution were detected by a fluorescence spectrophotometer. Figure 3 As shown in the figure, under the excitation of 645nm, the fluorescence emitted by the biosensor cells can cover the far-red region above 700nm. Therefore, the far-red fluorescence can be used to quantify the concentration of cadmium ions.

[0067] Take 6 equal portions of the biosensor cells prepared in Example 1 and place them in 1.5 mL centrifuge tubes, 1 mL each, centrifuge to remove the culture medium to obtain a cell pellet, add 0.8 mL of fresh culture medium of 1.25x LB to resuspend the cells, and add 0.2 mL of cadmium standard solution at the same time, so that the final concentration of cadmium is 0, 50, 100, 150, 200, 250 nM. Shake 1 mL of the mixed solution at 16 ° C for 5 hours, with the shaker speed at 200 rpm to obtain a culture solution, and directly detect the fluorescence intensity of the culture solution.

[0068] Add various equal amounts of culture medium to the ELISA plate, excite the sample with 645nm excitation light, and collect the fluorescence emission intensity (FL) and cell OD at 700nm. 600 value, establish the cadmium ion concentration and unit fluorescence intensity (FL / OD 600 ) and used as the standard curve. Figure 5 As shown, the linear equation R obtained from the standard curve 2 The value is 0.998, with a good linear relationship, and the detection limit is calculated to be 17.2nM. The linear range of detection is 17.2-250nM, which is significantly lower than the threshold of cadmium concentration in drinking water specified by the World Health Organization (27.6nM). This means that the exposure of cadmium ions in the environment can be detected by the far-red fluorescence of biosensor cells.

[0069] Since far-red fluorescence can avoid the influence of sample background fluorescence in the reaction solution, there is no need to centrifuge to remove the fluorescence interference of nutrients or other impurities in the culture medium, and the fluorescence intensity of the sample reaction solution can be directly detected. Therefore, compared with traditional fluorescence methods, the detection procedure is simplified and shows important application prospects.

[0070] Example 4

[0071] Detection of cadmium ions in lake water

[0072] Lake water samples were collected from Xuanwu Lake Park in Nanjing. The lake water was filtered with a filter membrane with a pore size of 0.22 μm as the test water sample. The sensor cells in the logarithmic phase obtained in Example 1 were centrifuged and the supernatant was removed to obtain a cell precipitate. 0.8 mL of fresh culture medium of 1.25x LB was added to resuspend the cells, and 0.2 mL of the test water sample was added and mixed. The test water sample was diluted 5 times. 1 mL of the mixed solution was shaken at 16 degrees Celsius for 5 hours, and the shaker speed was 200 rpm. 100 μL of the culture solution was placed in an ELISA plate, excited with 645 nm excitation light, and the fluorescence intensity (FL) emitted at 700 nm and the cell OD were detected. 600 The remaining cells were collected and the liquid medium was removed by centrifugation to obtain a cell pellet. The cell pellet was imaged using a smartphone, such as Figure 2 As shown, the round cell clusters were cut and the a channel (green) and b channel (yellow) were separated. The G and Y values ​​were obtained by ImageJ software, and the G / Y value of the sample was calculated. Figure 4 The linear equation was used to calculate the concentration of cadmium ions in the diluted sample and the concentration of cadmium ions in the original lake water sample was 31.61 nM. Calculate FL / OD 600 Value and pass Figure 5 The linear equation was used to calculate the cadmium ion concentration in the original lake water sample to be 33.94 nM. At the same time, the cadmium ion concentration of the lake water sample was 36.72 nM using the existing conventional ICP-MS method. Figure 6 As shown, the results obtained by the biosensor and the results obtained by ICP-MS are basically consistent, indicating that the two detection methods of the present invention are accurate and reliable.

[0073] Example 5

[0074] Detection of Cadmium Ions in Industrial Wastewater

[0075] The wastewater sample was taken from the water inlet of a sewage treatment plant in Jiangbei, Nanjing. The wastewater was filtered with a filter membrane with a pore size of 0.22μm as the test water sample. The sensor cells in the logarithmic phase obtained in Example 1 were centrifuged, and the supernatant was removed to obtain a cell precipitate. 0.8mL of fresh culture medium of 1.25x LB was added to resuspend the cells, and 0.2mL of the test water sample was added and mixed. The test water sample was diluted 5 times. The mixed solution was shaken at 16 degrees Celsius for 5 hours, and the shaker speed was 200rpm. 100μL of culture solution was taken and placed in an ELISA plate, excited with 645nm excitation light, and the fluorescence intensity (FL) emitted at 700nm and the cell OD were detected. 600 The remaining cells were collected and the liquid medium was removed by centrifugation to obtain a cell pellet. The cell pellet was imaged using a smartphone, such as Figure 4 As shown, the round cell clusters were intercepted and the a channel (green) and b channel (yellow) were separated. The G and Y values ​​were obtained by ImageJ software, and the G / Y values ​​of the samples were calculated. The G and Y values ​​were obtained by ImageJ software, and the G / Y values ​​of the samples were calculated. Figure 3 The linear equation was used to calculate the concentration of cadmium ions in the diluted sample and the concentration of cadmium ions in the original industrial wastewater sample was calculated to be 406.28 nM. Calculate FL / OD 600 Value and pass Figure 5 The linear equation was used to calculate the cadmium ion concentration in the original industrial wastewater sample to be 410.95 nM. At the same time, the cadmium ion concentration in the wastewater was detected by ICP-MS method to be 416.45 nM. Figure 6 As shown, the results obtained by the biosensor and the results obtained by ICP-MS are basically consistent, indicating that the two detection methods of the present invention are accurate and reliable.

[0076] Example 6

[0077] Detection of Cadmium Ions in Wastewater from Mining Areas

[0078] The mine wastewater was taken from the surface runoff sewage of a mining area in Youxi, Fujian. The wastewater was filtered with a filter membrane with a pore size of 0.22μm as the test water sample. The sensor cells in the logarithmic phase obtained in Example 1 were centrifuged, and the supernatant was removed to obtain a cell precipitate. 0.8mL of fresh culture medium of 1.25x LB was added to resuspend the cells, and 0.2mL of the test water sample was added to mix, and the test water sample was diluted 5 times. The mixed solution was shaken at 16 degrees Celsius for 5 hours, and the shaker speed was 200rpm. Take 100μL of culture solution and put it into the ELISA plate, excite it with 645nm excitation light, and detect the fluorescence intensity (FL) emitted at 700nm and the cell OD 600 The remaining cells were collected and the liquid medium was removed by centrifugation to obtain a cell pellet. The cell pellet was imaged using a smartphone, such as Figure 4As shown, the round cell clusters were intercepted and the a channel (green) and b channel (yellow) were separated. The G and Y values ​​were obtained by ImageJ software, and the G / Y values ​​of the samples were calculated. The G and Y values ​​were obtained by ImageJ software, and the G / Y values ​​of the samples were calculated. Figure 3 The linear equation was used to calculate the concentration of cadmium ions in the diluted sample and the concentration of cadmium ions in the mining wastewater was calculated to be 603.87 nM. Calculate FL / OD 600 Value and pass Figure 5 The linear equation was used to calculate the cadmium ion concentration in the original sample of the mining wastewater, which was 622.85nM. At the same time, the ICP-MS method was used to detect the wastewater sample filtered by the filter membrane, which was 632.18nM. Figure 6 As shown, the results obtained by the biosensor and the results obtained by ICP-MS are basically consistent, indicating that the two detection methods of the present invention are accurate and reliable.

[0079] Through the above verification, the monitoring technology of cadmium ions of the present invention is simple, cheap, and does not require detection instruments. BV is fixed in cells to show bright colors and changes with the change of cadmium ion concentration. Through the quantitative method proposed by the present invention, the content of cadmium ions in various water bodies can be sensitively and accurately detected without interference from impurities.

Claims

1. A plasmid vector pET21a-cadR-C448S_CY-ho1 for visual detection of cadmium ions, characterized in that: The sequence of the plasmid vector pET21a-cadR-C448S_CY-ho1 is shown in SEQ ID NO.

1.

2. A method for constructing the plasmid vector according to claim 1, characterized in that: The steps include: (1) Amplifying the cadmium ion response element cad promoter and the transcription factor cadR coding sequence, and inserting the amplified product into the expression vector pET21a after restriction digestion to obtain the expression plasmid pET21a-cadR; (2) amplifying the C448S_CY sequence, and then ligating the amplified product with the plasmid pET21a-cadR obtained in step (1) to obtain the plasmid pET21a-cadR-C448S_CY; (3) Amplify the heme oxygenase ho1 sequence, and after restriction digestion, connect the amplified product with the pET21a-cadR-C448S_CY obtained in step (2) to construct the recombinant plasmid pET21a-cadR-C448S_CY-ho1.

3. Use of the plasmid vector for visually detecting cadmium ions according to claim 1 in preparing a cell biosensor for detecting cadmium ions.

4. A cell biosensor for visual detection of cadmium ions, characterized in that: The invention comprises the plasmid vector for visually detecting cadmium ions as described in claim 1.

5. Use of the plasmid vector according to claim 1 or the cell biosensor according to claim 4 in visually detecting cadmium ion concentration.

6. The use according to claim 5, characterized in that: The application process is: culturing cells carrying the plasmid vector pET21a-cadR-C448S_CY-ho1 described in claim 1, then mixing the bacterial solution with the water sample to be tested, centrifuging to obtain the cell sediment, taking pictures and calculating the G / Y value of the sample to obtain the cadmium ion concentration.

7. The use according to claim 6, characterized in that: The cell sediment image obtained after the photography is processed by ImageJ software, and the colored circular image is separated into three channels according to CIELab color space theory: L value represents brightness; a value represents the color range change of green with red; b represents the color change of blue to yellow; a channel indicates the green change of BV, b channel indicates the yellow change of Escherichia coli itself, grayscale is used to represent the color depth of each channel, and grayscale value is calculated by ImageJ software, and the grayscale value of the circular image corresponding to each concentration is represented by a value and b value, wherein a is a negative number indicating that the color of the image is green, and the size represents the green value G value; b is a positive number indicating that the color of the image is yellow, and the size represents the yellow value Y value, G / Y is defined as the degree of color change of the biosensor cell, and the G / Y value of each concentration is calculated to obtain the linear relationship between cadmium concentration and color change as a standard curve.

8. An application of the plasmid vector according to claim 1 or the cell biosensor according to claim 4 to detect cadmium ion concentration by using far-red fluorescence as an output signal.

9. The use according to claim 8, characterized in that: The application process is: culturing cells carrying the plasmid vector pET21a-cadR-C448S_CY-ho1 described in claim 1, then mixing the bacterial solution with the water sample to be tested, exciting the culture with 645nm excitation light, and detecting the fluorescence intensity of the culture solution at a wavelength of 700nm.

10. The use according to claim 6 or 9, characterized in that: The bacterial liquid and the mixed solution of the water sample to be tested are reacted at 16-18° C. for 4-5 hours.

Images