Rapid genetic transformation method of peanuts

Abstract

The invention provides a rapid genetic transformation method of peanuts, which mainly comprises the following operation steps: disinfecting peanut seeds, stripping stem tips, performing agrobacterium infection, and continuously treating for 1-3 times; placing the explant on a co-culture medium for 2-5 days, transferring the explant to a bud induction screening medium, subculturing for 1-3 times, and then carrying out bud elongation culture and rooting culture. The rapid genetic transformation method of the peanuts, provided by the invention, has important significance on effectively reducing mechanical damage and accelerating genetic transformation, and provides a new thought for further researching the genetic transformation method of the peanuts.

Description

Technical Field

[0001] The invention mainly relates to the field of crop tissue culture, and in particular to a rapid genetic transformation method for peanut. Background Art

[0002] Peanut (Arachis hypogaea L.) is an important oil and cash crop in my country. It has rich nutritional value and contains rich protein, unsaturated fatty acids and dietary fiber. The annual output of peanuts in my country is about 18.3 million tons, but with the increasing demand for peanuts, the amount of peanuts that need to be imported each year is gradually increasing. Therefore, high-yield and high-quality peanut varieties are urgently needed in production. In order to solve this problem, genetic engineering technology is currently mainly used to introduce exogenous excellent genes to improve the ability of plants to resist adverse environments, thereby improving the yield and quality of peanuts. At present, the genome sequencing of peanuts has made a breakthrough, and on this basis, a number of potential genes that affect the agronomic traits of peanuts have been excavated. However, due to the imperfect genetic transformation system of peanuts, the gene function research and breeding application of peanuts are seriously restricted.

[0003] At present, the genetic transformation methods for peanut mainly use gene guns, pollen tube methods, etc. Among them, the gene gun method will cause greater mechanical damage to the callus tissue during the genetic transformation process, thereby causing deformity and sterility of the transformed seedlings, or even loss of exogenous genes, and has the disadvantages of low transformation rate, consuming time up to 10 to 11 months and high price; while the pollen tube method has poor transformation and repeatability, and its transformation mechanism is still controversial, thus limiting the application of this method in the genetic transformation process. In recent years, more and more studies have been conducted on Agrobacterium infection and transformation using embryo leaflets as explants, but there are still problems such as long time consumption and low transformation efficiency. CN118516403 A discloses an Agrobacterium-mediated peanut embryo tip transformation method, which includes the steps of using peanut embryos as explants, infecting peanut embryos with Agrobacterium liquid, ultrasonic treatment, vacuum-assisted infection, and then co-cultivating to obtain the infected peanut embryos, which is not directly regenerating seedlings from non-embryo explants.

[0004] In order to better improve the above shortcomings, it is necessary to study and develop a rapid genetic transformation method for peanut. Summary of the invention

[0005] The purpose of the present invention is to provide more efficient optional methods for the genetic transformation of peanut at the current stage by proposing a rapid genetic transformation method of peanut.

[0006] In order to solve the above technical problems, the present invention provides a method for rapid genetic transformation of peanut, comprising the following steps:

[0007] S1 sterilizes peanut seeds and peels off the stem tips;

[0008] S2 was infected with Agrobacterium at the stem tip, and the treatment was repeated 1-3 times;

[0009] S3: Place the explants on co-culture medium GP and culture for 2-5 days;

[0010] S4: Transfer the explants to bud induction screening medium A2 and subculture 1-3 times;

[0011] S5 was then subjected to shoot elongation culture and subcultured 1-2 times;

[0012] S6 rooting culture, culture for 3-4 weeks;

[0013] S7 T0 generation transformed plants were obtained.

[0014] Preferably, the peanut seeds in S1 are disinfected using a 5% hydrogen peroxide solution in a light incubator at 22° C., placed away from light for 14-16 hours for disinfection, and then rinsed three times with sterile water.

[0015] Specifically, the Agrobacterium infection method in S2 is to use the Agrobacterium suspension suspended in the infection medium QR, then treat it with ultrasound at 40-50kHz for 1-5min, put it in a shaking incubator at an ambient temperature of 28°C for 5-30min, infect it twice continuously and dry it.

[0016] Preferably, the Agrobacterium infection method is to suspend the OD 600 =0.3-0.6 Agrobacterium suspension, then ultrasonically treated at 45kHz for 3 minutes, placed in a shaking incubator at an ambient temperature of 28°C for 15 minutes, infected twice continuously and placed on sterile filter paper for air drying.

[0017] Specifically, in S3, the co-cultured GPs were cultured at a temperature of 22-26°C and a photoperiod of 14-18 / 6-10 for 3 days;

[0018] After being transferred to the bud induction screening medium A2 in S4, the cells are moved to a light incubator for treatment; the cells are first cultured at 33-37°C for 1-5 days, and then moved to 26-30°C with a photoperiod of 14-18 / 6-10 for further culture; preferably, the cells are subcultured once every 3-4 weeks, and the roots and main stems of the explants are removed during subculture, and the cells are subcultured twice;

[0019] Preferably, the culture is first placed in an environment with a temperature of 35°C for 3 days, and then moved to an environment with a temperature of 28°C and a photoperiod of 16 / 8 for continued cultivation.

[0020] In a specific embodiment, during the shoot elongation culture in S5, during the subculture process, the newly grown green lateral shoots are transferred to the shoot elongation medium SB1 for culture, and the subculture is performed once every 3-4 weeks, and the number of subcultures is 1-2.

[0021] Specifically, the rooting culture in S6 is to transfer the explants into the rooting medium G2, and place them in an environment of 26-30° C. for 3-4 weeks.

[0022] Specifically, the T0 generation transformed plants in S7 are obtained by transferring them to water at a temperature of 26-30°C for 1 week when the roots are dense, and then transplanting them to soil at an environmental temperature of 28-35°C and cultivating them for 2 weeks to obtain T0 generation transformed plants.

[0023] In the above method, the pH value of the infection medium QR is 5.2-5.6, and the main components are: INO medium (DZPM0522) 5.0-5.4 g / L, glucose 28-32 g / L, INO vitamin (DZPM0522-1) 0.8-1.2 mL / L, 6-BA (benzyladenine) 0.8-1.2 mg / L, NAA (naphthaleneacetic acid) 0.08-0.12 mg / L, AS (acetosyringone) 0.15-0.25 mM / L;

[0024] Specifically, the pH value of the infection medium QR is 5.4, and the main components are: INO medium (DZPM0522) 5.2 g / L, glucose 30 g / L, INO vitamin (DZPM0522-1) 1 mL / L, 6-BA 1 mg / L, NAA 0.1 mg / L, and AS 0.2 mM / L.

[0025] The pH value of the co-culture medium GP is 5.2-5.6, and the main components are: INO medium (DZPM0522) 5.0-5.4 g / L, glucose 28-32 g / L, INO vitamin (DZPM0522-1) 0.8-1.2 mL / L, 6-BA 0.8-1.2 mg / L, NAA 0.08-0.12 mg / L, cysteine ​​180-220 mg / mL, and spectinomycin 140-160 mg / L;

[0026] The pH value of the bud induction screening A2 medium is 5.4-5.8, and the main components are: MS medium (PM1301) containing vitamin B5 4.2-4.6 g / L, glucose 18-22 g / L, calcium gluconate 1.1-1.5 g / L, plant gel 2.5-3.5 g / L, 6-BA 0.4-0.6 mg / L, NAA 0.08-0.12 mg / L, spectinomycin 80-120 mg / L, cephalosporin 180-220 mg / L, and carbenicillin 180-220 mg / L;

[0027] The pH value of the bud elongation medium SB1 is 5.4-5.8, and the main components are: MS medium (PM1301) containing vitamin B5 4.2-4.6 g / L, glucose 18-22 g / L, calcium gluconate 1.1-1.5 g / L, agar 7-9 g / L, 6-BA 0.2-0.4 mg / L, NAA 0.08-0.12 mg / L, spectinomycin 80-120 mg / L, cephalosporin 80-120 mg / L, and carbenicillin 80-120 mg / L;

[0028] The rooting medium G2 has a pH value of 5.2-5.6, and its main components are: MS medium (PM1301) containing vitamin B5 4.2-4.4 g / L, glucose 12-18 g / L, agar powder 5-7 g / L, and IBA 0.3-0.5 mg / L;

[0029] More specifically, the pH value of the co-culture medium (GP) is 5.4, and the main components are: INO medium (DZPM0522) 5.2 g / L, glucose 30 g / L, INO vitamin (DZPM0522-1) 1 mL / L, 6-BA 1 mg / L, NAA 0.1 mg / L, cysteine ​​200 mg / mL, and spectinomycin 150 mg / L.

[0030] In the above method, the pH value of the bud induction screening (A2) medium is 5.6, and the main components are: MS medium (containing vitamin B5) (PM1301) 4.4g / L, glucose 20g / L, calcium gluconate 1.3g / L, plant gel 3g / L, 6-BA 0.5mg / L, NAA 0.1mg / L, spectinomycin 100mg / L, cephalosporin 200mg / L, and carbenicillin 200mg / L.

[0031] In the above method, the pH value of the bud elongation medium (SB1) is 5.6, and the main components are: MS medium (containing vitamin B5) (PM1301) 4.4g / L, glucose 20g / L, calcium gluconate 1.3g / L, agar 8g / L, 6-BA 0.3mg / L, NAA0.1mg / L, spectinomycin 100mg / L, cephalosporin 100mg / L, and carbenicillin 100mg / L.

[0032] In the above method, the pH value of the rooting medium (G2) is 5.4, and the main components are: MS medium (containing vitamin B5) (PM1301) 4.4g / L, glucose 15g / L, agar powder 6g / L, IBA (indole-3-butyric acid) 0.4mg / L.

[0033] The present invention proposes a rapid genetic transformation method using peanut stem tips, which is of great significance for effectively reducing mechanical damage and accelerating genetic transformation, and provides a new idea for further research on genetic transformation methods of peanuts. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 Schematic diagram of peanuts before and after disinfection in the present invention.

[0035] Figure 2 It is a schematic diagram of the peanut stem tip in the present invention.

[0036] Figure 3 This is the growth condition of the peanut shoot tip in the bud induction screening medium (A2) of the present invention.

[0037] Figure 4 This is a diagram showing the screening effect of spectinomycin on transgenic peanuts in the present invention

[0038] Figure 5 The growth process of the transgenic peanut in the bud elongation medium (SB1) of the present invention is shown in FIG.

[0039] Figure 6 The figure shows the growth condition of peanut shoot tip in the bud elongation medium (SB1) of the present invention.

[0040] Figure 7 This is the growth condition of peanut in the rooting medium (G2) culture medium of the present invention.

[0041] Figure 8 It is the rooting state of peanut in the present invention.

[0042] Fig. 9 This is a picture of the transgenic peanut plant in the present invention.

[0043] Fig.10 This is a diagram of the PCR identification results of the aada gene in the present invention.

[0044] Fig.11 It is a comparison diagram of the Sanger sequencing results of the EGFP sequence, positive plants and plasmids in the present invention. DETAILED DESCRIPTION

[0045] The following is a more detailed description of the contents of the present invention in conjunction with the specific implementation scheme of the experiment. This experiment is only used for the main content of the present invention, and all technologies that realize the present invention belong to the scope of the present invention.

[0046] Genetic transformation was performed by Agrobacterium infection of peanut stem tips as explants. When Agrobacterium infection was performed, 15 mL of Agrobacterium suspension (suspended in infection medium QR, OD 600=0.3-0.6), ultrasonic treatment at 45kHz for 3min, shaking at 28℃ and 80rpm / min for 15min, repeated treatment twice and placed on sterile filter paper for drying.

[0047] The peanut variety used in the following example is Huayu 60, which has a high adaptability to climate and is widely planted in both the north and the south.

[0048] The 5% hydrogen peroxide solution in the following example is prepared from 40 mL of hydrogen peroxide (30%) and 200 mL of sterile water.

[0049] Table 1. Composition of different culture media

[0050]

[0051]

[0052] The shoot induction screening medium (A2) and shoot elongation medium (SB1) were obtained by performing 3 replicate experiments and data analysis on each medium.

[0053] After 3 weeks of culture on each medium, the number of sprouting explants, the amount of bud growth and the number of cluster bud elongation were counted, and the sprout induction rate and bud elongation rate were calculated respectively.

[0054] Table 2. Experimental scheme and induction status of main components of bud induction screening medium (A2) and bud elongation medium (SB1)

[0055]

[0056] The calculation formula of the bud induction rate is: bud induction rate (%) = (number of sprouting explants / number of inoculated explants) × 100%.

[0057] The calculation formula of bud elongation rate is: bud elongation rate (%) = (number of elongated cluster buds / number of explants) × 100%.

[0058] The values ​​after the bud induction rate and bud elongation rate represent the differences in the data in different experimental schemes. The larger the value, the greater the difference, and the smaller the value, the smaller the difference.

[0059] In the bud growth amount, the more + there are, the more bud growth there is.

[0060] By comparing the bud induction rate, bud growth amount and bud elongation rate of different schemes in Table 2, it was determined that the content of 6-BA in the bud induction screening medium (A2) was 0.5 mg / L and the content of NAA was 0.1 mg / L; the content of 6-BA in the bud elongation medium (SB1) was 0.3 mg / L and the content of NAA was 0.1 mg / L.

[0061] The rooting medium (G2) was obtained through three repeated experiments and data analysis.

[0062] After 2 weeks of cultivation on each medium, the number of roots was counted and the rooting conditions were recorded.

[0063] Table 3. Experimental scheme and rooting status of main components of rooting medium (G2)

[0064] Group IBA (indole-3-butyric acid) / (mg / L) Rooting rate (%) Rooting 1 0.2 50.67±1.53 Roots are thin and short, with few lateral roots 2 0.3 62.00±2.00 The roots are slender and have many lateral roots. 3 0.4 68.67±2.52 Roots are slender and have many lateral roots 4 0.5 37.33±2.52 The roots are short and thick, with few lateral roots. 5 0.6 34.67±0.58 Roots are short and thick, with few lateral roots

[0065] The calculation formula of the rooting rate is: rooting rate = (number of rooted plants / total number of uncontaminated plants in the same treatment) × 100%.

[0066] The value after the rooting rate represents the difference in data in different experimental schemes. The larger the value, the greater the difference, and the smaller the value, the smaller the difference.

[0067] By comparing the rooting rates and rooting conditions of different schemes in Table 3, the content of IBA (indole-3-butyric acid) in the rooting medium (G2) was determined to be 0.4 mg / L.

[0068] Specific steps of the experiment:

[0069] A Peanut Seed Disinfection

[0070] 50 g of peanut seeds were selected, placed in a 22° C. incubator for 14-16 h with 5% hydrogen peroxide solution for sterilization while being protected from light, and then rinsed with sterile water for 3 times.

[0071] B. Stem apex stripping

[0072] From the sterilized peanut seeds, peel off the stem apex meristem below the cotyledons, 60-70 seeds / portion (the approximate number of stem apexes that can be peeled off from 50g of peanuts), and put them into a conical flask filled with 50mL of sterile water.

[0073] The sterile water in the conical flask is to prevent the stem tip from losing water.

[0074] Agrobacterium C preparation

[0075] The recombinant vector M1-2 (recombinant expression vector of GFP protein and aada protein) was transferred into the Agrobacterium strain GV3101 to obtain Agrobacterium containing the target gene and the spectinomycin resistance gene, and glycerol was added and stored in a refrigerator at -80°C. Before use, the culture medium was streaked on a solid LB medium containing 50 mg / mL kanamycin and 25 mg / mL rifampicin. After culturing in the dark at 28°C for 48 h, a single clone was picked out and inoculated into a liquid LB medium containing 50 mg / mL kanamycin and 25 mg / mL rifampicin and cultured at 28°C with shaking.

[0076] The next day, the bacterial suspension was transferred into a 50 mL sterile centrifuge tube in a clean bench and centrifuged at 5000 rpm / min for 10 min. The supernatant was discarded and the bacteria were suspended in infection medium (QR). The light absorption value OD of the Agrobacterium suspension was measured by a spectrophotometer. 600 =0.3-0.6.

[0077] The spectinomycin resistance gene used is the aada gene, whose nucleotide sequence is shown in sequence 1 in the sequence table, and the target gene used is the green fluorescent protein GFP gene, whose nucleotide sequence is shown in sequence 2 in the sequence table.

[0078] Agrobacterium infection

[0079] Add 15 mL of Agrobacterium suspension (suspended in infection medium (QR) and OD 600 =0.3-0.6), then ultrasonically treated at 45kHz for 3min, placed in a shaking incubator at 28°C and 80rpm / min for 15min, infected twice in succession and placed on sterile filter paper for drying.

[0080] E co-culture

[0081] The explants were placed on a glass dish containing 5 mL of co-cultivation medium (GP) and cultured at 24°C and a photoperiod of 16 / 8 for 3 days.

[0082] The above glass dish contains sterile filter paper.

[0083] F screening culture (bud induction culture)

[0084] The explants were transferred to the bud induction screening medium (A2) and then placed in a light incubator for culture at 35°C for 3 days.

[0085] Then move to an environment with a temperature of 28°C and a photoperiod of 16 / 8 for continued cultivation.

[0086] During the culture period on the bud induction screening medium (A2), subculture is required every 3-4 weeks. During subculture, the roots and main stems of the explants are removed and subculture is repeated twice. Figure 3 The growth status of peanut shoot tips in bud induction screening medium (A2).

[0087] G bud elongation culture

[0088] During the subculture process, the newly grown green lateral shoots were transferred to the shoot elongation medium (SB1) for culture, and subcultured every 3-4 weeks for 2 times. Figure 4 This is a picture showing the screening effect of spectinomycin on transgenic peanuts. Figure 5 This is a diagram of the growth process of transgenic peanuts in the sprout elongation medium (SB1). Figure 6The growth conditions of peanut shoot tips in the shoot elongation medium (SB1).

[0089] H rooting culture

[0090] The explants were transferred to rooting medium (G2) for rooting culture. Figure 7 That is, the growth status of peanut in rooting medium (G2) culture medium, Figure 8 That is the rooting state of peanuts.

[0091] When the roots are dense, transfer them to water for hardening, and then transplant them into soil to obtain T0 generation transformed plants. Fig. 9 This is a picture of a genetically modified peanut plant.

[0092] Identification of transgenic plants

[0093] DNA was extracted from young leaves of wild-type and transgenic peanut plants for PCR detection.

[0094] The sequences of aada primers are: 35S-F1: GACGCACAATCCCACTATCC, aada-R2: GACCTACCAAGGCAACGCTA.

[0095] The PCR reaction program was as follows: preheating at 95°C for 5 min, 30 cycles of (95°C for 30 s; 58°C for 30 s; 72°C for 30 s), extension at 72°C for 7 min, and storage at 4°C.

[0096] After the PCR reaction is completed, the PCR products are subjected to gel electrophoresis and stored in the image.

[0097] Specific primers were used to amplify the transgenic peanut plants by PCR to obtain a target band of about 820 bp, which is Fig.10 .

[0098] The EGFP primer sequences are: EGFP-F: CCGGTACCATGGTGAGCAAG, EGFP-R: CGAGCTCTTACTTGTACAGCTCG.

[0099] The PCR reaction program was as follows: preheating at 95°C for 5 min, 30 cycles of (95°C for 30 s; 59.5°C for 30 s; 72°C for 45 s), extension at 72°C for 7 min, and storage at 4°C.

[0100] After the PCR reaction, the PCR product was subjected to Sanger sequencing, and the sequencing results were compared with the GFP protein sequence and the plasmid sequence. The sequences overlapped, proving that the genome of the transgenic peanut contained GFP protein. Fig.11 .

[0101] In one transformation experiment, 5-8 positive plants can be obtained.

Claims

1. A method for rapid genetic transformation of peanut, characterized in that: Contains the following steps: S1 sterilizes peanut seeds and peels off the stem tips; S2 was infected with Agrobacterium at the stem tip, and the treatment was repeated 1-3 times; S3: Place the explants on co-culture medium GP and culture for 2-5 days; S4: Transfer the explants to bud induction screening medium A2 and subculture 1-3 times; S5 was then subjected to shoot elongation culture and subcultured 1-2 times; S6 rooting culture, culture for 3-4 weeks; S7 T0 generation transformed plants were obtained.

2. The method according to claim 1, characterized in that: The peanut seeds described in S1 are disinfected using a 5% hydrogen peroxide solution in a light incubator at a temperature of 22°C, placed in the dark for 14-16 hours for disinfection, and then rinsed three times with sterile water.

3. The method according to claim 1, characterized in that The Agrobacterium infection method in S2 is to use an Agrobacterium suspension suspended in an infection medium QR, then treat it with ultrasound at 40-50kHz for 1-5min, place it in a shaker at an ambient temperature of 28°C for 5-30min, and continuously infect twice and dry it.

4. The method according to claim 3, characterized in that The Agrobacterium infection method is to use the infection medium QR to suspend the OD 600 =0.3-0.6 Agrobacterium suspension, then treat with ultrasound at 45kHz for 3min, place in a shaker at an ambient temperature of 28℃ for 15min, infect twice continuously and place on sterile filter paper to dry.

5. The method according to claim 1, characterized in that In S3, the co-cultured GPs were placed in an environment with a temperature of 22-26°C and a photoperiod of 14-18 / 6-10 for 3 days; After being transferred to the bud induction screening medium A2 in S4, the cells are moved to a light incubator for treatment; the cells are first cultured at 33-37°C for 1-5 days, and then moved to 26-30°C with a photoperiod of 14-18 / 6-10 for further culture; preferably, the cells are subcultured once every 3-4 weeks, and the roots and main stems of the explants are removed during subculture, and the cells are subcultured twice; Preferably, the culture is first placed in an environment with a temperature of 35°C for 3 days, and then moved to an environment with a temperature of 28°C and a photoperiod of 16 / 8 for continued cultivation.

6. The method according to claims 1-4, characterized in that: During the shoot elongation culture in S5, the newly grown green lateral shoots were transferred to the shoot elongation medium SB1 for culture during the subculture process, and subcultured once every 3-4 weeks and 1-2 times.

7. The method according to claim 1, characterized in that In S6, the explants are transferred to rooting medium G2 and placed in an environment of 26-30°C for 3-4 weeks.

8. The method according to claim 1, characterized in that The T0 generation transformed plants in S7 are obtained by transferring them to water at a temperature of 26-30°C for 1 week when the roots are dense, and then transplanting them into soil at an environmental temperature of 28-35°C and cultivating them for 2 weeks to obtain T0 generation transformed plants.

9. The method according to claim 3, characterized in that: The pH value of the infection medium QR is 5.2-5.6, and the main components are: INO medium (DZPM0522) 5.0-5.4 g / L, glucose 28-32 g / L, INO vitamin (DZPM0522-1) 0.8-1.2 mL / L, 6-BA 0.8-1.2 mg / L, NAA 0.08-0.12 mg / L, AS 0.15-0.25 mM / L; Specifically, the pH value of the infection medium QR is 5.4, and the main components are: INO medium (DZPM0522) 5.2 g / L, glucose 30 g / L, INO vitamin (DZPM0522-1) 1 mL / L, 6-BA 1 mg / L, NAA 0.1 mg / L, and AS 0.2 mM / L.

10. The method according to claim 1, characterized in that The pH value of the co-culture medium GP is 5.2-5.6, and the main components are: INO medium (DZPM0522) 5.0-5.4 g / L, glucose 28-32 g / L, INO vitamin (DZPM0522-1) 0.8-1.2 mL / L, 6-BA 0.8-1.2 mg / L, NAA 0.08-0.12 mg / L, cysteine ​​180-220 mg / mL, and spectinomycin 140-160 mg / L; The pH value of the bud induction screening A2 medium is 5.4-5.8, and the main components are: MS medium (PM1301) containing vitamin B5 4.2-4.6 g / L, glucose 18-22 g / L, calcium gluconate 1.1-1.5 g / L, plant gel 2.5-3.5 g / L, 6-BA 0.4-0.6 mg / L, NAA 0.08-0.12 mg / L, spectinomycin 80-120 mg / L, cephalosporin 180-220 mg / L, and carbenicillin 180-220 mg / L; The pH value of the bud elongation medium SB1 is 5.4-5.8, and the main components are: MS medium (PM1301) containing vitamin B5 4.2-4.6 g / L, glucose 18-22 g / L, calcium gluconate 1.1-1.5 g / L, agar 7-9 g / L, 6-BA 0.2-0.4 mg / L, NAA 0.08-0.12 mg / L, spectinomycin 80-120 mg / L, cephalosporin 80-120 mg / L, and carbenicillin 80-120 mg / L; The rooting medium G2 has a pH value of 5.2-5.6, and its main components are: MS medium (PM1301) containing vitamin B5 4.2-4.4 g / L, glucose 12-18 g / L, agar powder 5-7 g / L, and IBA 0.3-0.5 mg / L; More specifically, the pH value of the co-culture medium GP is 5.4, and the main components are: INO medium (DZPM0522) 5.2 g / L, glucose 30 g / L, INO vitamin (DZPM0522-1) 1 mL / L, 6-BA 1 mg / L, NAA 0.1 mg / L, cysteine ​​200 mg / mL, and spectinomycin 150 mg / L; The pH value of the bud induction screening A2 medium is 5.6, and the main components are: MS medium (containing vitamin B5) (PM1301) 4.4 g / L, glucose 20 g / L, calcium gluconate 1.3 g / L, plant gel 3 g / L, 6-BA 0.5 mg / L, NAA 0.1 mg / L, spectinomycin 100 mg / L, cephalosporin 200 mg / L, and carbenicillin 200 mg / L; The pH value of the bud elongation medium SB1 is 5.6, and the main components are: MS medium (containing vitamin B5) (PM1301) 4.4 g / L, glucose 20 g / L, calcium gluconate 1.3 g / L, agar 8 g / L, 6-BA 0.3 mg / L, NAA 0.1 mg / L, spectinomycin 100 mg / L, cephalosporin 100 mg / L, and carbenicillin 100 mg / L; The rooting medium G2 has a pH value of 5.4, and its main components are: MS medium (containing vitamin B5) (PM1301) 4.4 g / L, glucose 15 g / L, agar powder 6 g / L, and IBA 0.4 mg / L.

Images