Molecular marker for identifying sex of channa maculata and application of molecular marker

Abstract

The invention discloses a molecular marker closely linked with a channa maculata sex gene, which can accurately identify the genetic sex of channa maculata. The invention further provides a specific KASP primer for amplifying the molecular marker closely linked with the channa maculata sex gene, the genetic sex of channa maculata can be detected, and the primer is simple and easy to use, high in analysis flux, high in accuracy and suitable for detection of a large number of samples. The molecular marker provided by the invention has important practical significance for quickly and accurately screening pseudo-female channa maculata and super-male channa maculata, shortening the breeding time and improving the breeding efficiency.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a molecular marker for identifying the sex of Channa maculata and an application thereof. Background Art

[0002] Channa maculata is a species of the order Perciformes. Anabantiformes ) Channa genus (Channa) of the family Channidae, mainly distributed in the waters south of the Yangtze River, such as Guangdong, Guangxi, Fujian, Yunnan, Hunan, Hainan, etc. Channa maculata has the characteristics of delicate and delicious meat, high protein, few fish bones, fast growth and high yield, becoming an important economic freshwater aquaculture fish in my country.

[0003] Channa maculata has significant sexual dimorphism. Under the same culture conditions, the growth rate of male Channa maculata is significantly higher than that of female Channa maculata. Therefore, through sex control, the construction of an all-male culture group of Channa maculata can greatly increase the culture output of Channa maculata and improve the culture efficiency, which has great economic significance. The female-to-male ratio in the Channa maculata population is about 1:1, and its sex determination type is genetically determined, and it is considered to be XY type after research. In the process of constructing an all-male population of Channa maculata, it is difficult to distinguish the sex of Channa maculata by appearance. Therefore, in order to identify the sex of Channa maculata and select pseudo-female Channa maculata (Channa maculata with male genetic sex and female physiological sex, and XY chromosome type) and super-male Channa maculata (fish with YY sex chromosomes in female homogametic fish), molecular markers linked to the sex of Channa maculata are required.

[0004] Some molecular markers related to the genetic sex of Channa maculata have been developed both at home and abroad. However, the existing markers for identifying the genetic sex of Channa maculata are either dominant markers with low accuracy and poor stability, and are not suitable for large-scale molecular marker-assisted selection breeding. Or they rely on specific instruments and reagents, and have poor versatility, flexibility and ease of use, which seriously affects the purification speed of the all-male and super-male lines of Channa maculata and the variety breeding process. Summary of the invention

[0005] The first aspect of the present invention provides an InDel marker tightly linked to the sex gene of Channa maculata, characterized in that the InDel marker is a nucleotide sequence located on chromosome 2 of the Channa maculata genome and contains a polymorphic "AAG / ---" site at 34302196 to 34302199, wherein - represents a base deletion.

[0006] The physical location of the InDel markers in the present invention is based on the Channa maculata genome assembly ASM2049675v1.

[0007] In one or more embodiments of the present invention, the homozygous genotype with the polymorphic site base "---" corresponds to a female Channa maculata, the heterozygous genotype with the polymorphic site base "AAG / ---" corresponds to a male Channa maculata, and the homozygous genotype with the polymorphic site base "AAG" corresponds to a super male Channa maculata.

[0008] The second aspect of the present invention provides KASP primers for amplifying the InDel marker of the first aspect,

[0009] comprising a first primer, a second primer and a third primer;

[0010] The first primer contains the nucleotide sequence shown in SEQ ID NO.1;

[0011] The second primer contains the nucleotide sequence shown in SEQ ID NO.2;

[0012] The nucleotide sequence of the third primer is shown in SEQ ID NO.3;

[0013] SEQ ID NO.1: ATTGGTATTGATTATGAAATCTGGCAAG (5' to 3');

[0014] SEQ ID NO.2: ATTGGTATTGATTATGAAATCTGGCAAA (5' to 3');

[0015] SEQ ID NO. 3: ACCCTTTAAATGTCTCCTCTTACAGGTTATAA (5' end to 3' end).

[0016] In one or more embodiments of the present invention,

[0017] The 5' end of the first primer is added with a label sequence A corresponding to the A fluorescence;

[0018] The 5' end of the second primer is added with a label sequence B corresponding to the B fluorescence;

[0019] The A fluorescence is different from the B fluorescence.

[0020] In one or more embodiments of the present invention, the A fluorescence is selected from any one of FAM fluorescence, HEX fluorescence, TET fluorescence, ROX fluorescence, TAMRA fluorescence, JOE fluorescence, Cy3 fluorescence, Cy5 fluorescence, VIC fluorescence, BHQ1 fluorescence, BHQ2 fluorescence, BHQ3 fluorescence, JOE fluorescence, VIC fluorescence, Texas-Red fluorescence, and MGB fluorescence, and the B fluorescence is selected from any one of FAM fluorescence, HEX fluorescence, TET fluorescence, ROX fluorescence, TAMRA fluorescence, JOE fluorescence, Cy3 fluorescence, Cy5 fluorescence, VIC fluorescence, BHQ1 fluorescence, BHQ2 fluorescence, BHQ3 fluorescence, JOE fluorescence, VIC fluorescence, Texas-Red fluorescence, and MGB fluorescence.

[0021] In one or more embodiments of the present invention, the 5' end of the first primer is added with a label sequence SEQ ID NO.4 corresponding to FAM fluorescence, and the nucleotide sequence of the first primer is shown in SEQ ID NO.5;

[0022] The 5' end of the second primer is added with a label sequence corresponding to HEX fluorescence, SEQ ID NO.6, and the nucleotide sequence of the second primer is shown in SEQ ID NO.7;

[0023] SEQ ID NO.4: GAAGGTGACCAAGTTCATGCT (5' to 3');

[0024] SEQ ID NO.5:

[0025] GAAGGTGACCAAGTTCATGCT ATTGGTATTGATTATGAAATCTGGCAAG (5' to 3');

[0026] SEQ ID NO.6: GAAGGTCGGAGTCAACGGATT (5' to 3');

[0027] SEQ ID NO.7:

[0028] GAAGGTCGGAGTCAACGGATT ATTGGTATTGATTATGAAATCTGGCAAA (5' to 3').

[0029] The third aspect of the present invention provides a detection reagent or a kit containing the primers of the second aspect.

[0030] In one or more embodiments of the present invention, the detection reagent or kit further contains a probe, a DNA polymerase, dNTP and MgCl2, the probe is a double-stranded structure, containing a complementary first strand and a second strand, the probe includes a first probe and a second probe, the first strand of the first probe is at least partially complementary to the label sequence A and is labeled with the A fluorescence, the second strand of the first probe is labeled with a quenched fluorescence corresponding to the A fluorescence, the first strand of the second probe is at least partially complementary to the label sequence B and is labeled with the B fluorescence, and the second strand of the second probe is labeled with a quenched fluorescence corresponding to the B fluorescence.

[0031] The fourth aspect of the present invention provides the use of any one of the InDel marker of the first aspect, the KASP primer of the second aspect, and the detection reagent or kit of the third aspect in any of the following aspects:

[0032] 1) Used to identify the sex of Channa maculata;

[0033] 2) Molecular marker-assisted breeding related to sex of Channa maculata;

[0034] 3) Used for genotyping of Channa maculata;

[0035] 4) Used to construct the DNA fingerprint of Channa maculata.

[0036] A fifth aspect of the present invention provides a method for identifying the sex of Channa maculata, comprising the following steps:

[0037] 1) extracting genomic DNA of Channa maculata to be tested;

[0038] 2) using the DNA as a template and performing PCR amplification using the KASP primers of the second aspect;

[0039] 3) Analyze the PCR amplification products and determine the sex of Channa maculata based on the genotype of the polymorphic sites contained in the amplification products.

[0040] In one or more embodiments of the present invention, if fluorescence corresponding to A fluorescence is detected in the amplified product, the base at this site is a "---" homozygous genotype, and the corresponding Channa is female; if two different fluorescences are detected in the amplified product, the base at this site is a "AAG / ---" heterozygous genotype, and the corresponding Channa is male; if fluorescence corresponding to B fluorescence is detected in the amplified product, the base at this site is a "AAG" homozygous genotype, and the corresponding Channa is super male.

[0041] The beneficial effects of the present invention are:

[0042] The invention provides a molecular marker which is closely linked to the sex gene of Channa maculata and can accurately identify the genetic sex of Channa maculata.

[0043] The present invention also provides a specific KASP primer for amplifying a molecular marker closely linked to the sex gene of Channa maculata, which can detect the genetic sex of Channa maculata, is simple and easy to use, has high analysis throughput, high accuracy, and is suitable for the detection of a large number of samples. The molecular marker provided by the present invention has important practical significance for quickly and accurately screening pseudo-female Channa maculata and super male Channa maculata, shortening breeding time, and improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Results of Cmhen 4 marker detection in 96 Channa maculata. DETAILED DESCRIPTION

[0045] The present invention is further described in detail below by specific examples. Unless otherwise specified, the raw materials, reagents or devices used in the examples and comparative examples can be obtained from conventional commercial sources or can be obtained by prior art methods. Unless otherwise specified, the experiments or test methods are conventional methods in the art, such as Sambrook et al. Molecular Cloning: a Laboratory Manual (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or according to the conditions recommended by the manufacturer's instructions.

[0046] Example 1: Development of a molecular marker (InDel marker Cmhen 4) tightly linked to the sex gene of Channa maculata

[0047] 1. High-multiplier resequencing of female and male Channa maculata

[0048] The tail fins of 20 female and 20 male Channa maculata were taken, and DNA was extracted by CTAB method. The extracted DNA samples were subjected to double-end resequencing by BGI Biotechnology Co., Ltd. using Illumina Xten platform, with a read length of 150 bp and a sequencing depth of 10×.

[0049] 2. Female and male specific sequence analysis

[0050] The sequencing data of 20 female and 20 male Channa maculata were aligned to the reference genome of Channa maculata (Channa maculata genome assembly ASM2049675v1, which is the complete genome sequence of Channa maculata published by Ou et al., see www.ncbi.nlm.nih.gov / datasets / genome / GCA_020496755.1 for details) using bwa (v0.7.17-r1188) software. Based on the results of sequence alignment, the male Channa maculata-specific sequence (Chr2:34302105-34302472) was screened out. Since the Y chromosome has an additional sequence than the X chromosome genome, the high-multiplier sequencing method was used to find the sequence by comparing the reads coverage. This sequence is a sequence specific to the Y gene. Based on this sequence, markers co-linked with this sequence were found around it.

[0051] 3. Development of KASP markers

[0052] Based on the location of the male-specific sequence on the chromosome, InDel sites that differ between females and males were searched around it (Chr2: 34302196 to 34302199).

[0053] The InDel site information of marker Cmhen 4 is as follows:

[0054] >C.maculata female

[0055] TTAAGTCATAAACCATAGATCAATAAAAGGGTGCACTTAAGGAAATGAGATAAAGGATTTATTTTTATTGGTATTGATTATGAAATCTGGCA --- AGAGAGAGAGCGGGAGAGATAAAGTATT GGATCCATATTACTCTTGTAAGAAGAAAGGTGTGGCAAAAAAGCAGATTTACGGATTGGCAAATGTTTCTATTTTGACTGTTAAGTTTTATTTAATGGTCCTTTTGTCAGTTTTTTATTTCTTATAACCTGTAAGAGGACATTTAAAGGGTGGGGTTTTCAGAGTAGAATGTTTGTTATAGCCCCTGCATTTAATAACATTGTGTATGTTGAGAAATATACTTTATTATTTATATTTGCGTTTGT (SEQ ID NO:8).

[0056] >C.maculata male

[0057] TTAAGTCATAAACCATAGATCAATAAAGGGTGCACTTAAGGAAATGAGATAAAGGATTTA TTTTTATTGGTATTGATTATGAAATCTGGCA AAG / --- AGAGAGAGAGCGGGAGAGATAAA GTATTGGATCCATATTACTCTTGTAAGAAGAAAGGGTGGCAAAAAAGCAGATTTACGGATTGGCAAATGTTTCTATTTTGACTGTTAAGTTTTATTTAATGGTCCTTTTGTCAGTTTTTTATTTCTTATAACCTGTAAGAGGAGACATTTAAAGGGTGGGGTTTTCAGAGTAGAATGTTTGTTATAGCCCCTGCATTTAATAACATTGTGTATGTTGAGAAATATACTTTATTATTTATATTTGCGTTTTGT(SEQ ID NO:9)。

[0058] >C.maculata super-male

[0059] TTAAGTCATAAACCATAGATCAATAAAGGGTGCACTTAAGGAAATGAGATAAAGGATTTA

[0060] TTTTTATTGGTATTGATTATGAAATCTGGCA AAG AGAGAGAGAGCGGGAGAGATAAAGTA

[0061] TTGGATCCATATTACTCTTGTAAGAAGAAAGGGTGGCAAAAAAGCAGATTTACGGATTG

[0062] GCAAATGTTTCTATTTTGACTGTTAAGTTTTATTTAATGGTCCTTTTGTCAGTTTTTTATTT

[0063] CTTATAACCTGTAAGAGGAGACATTTAAAGGGTGGGGTTTTCAGAGTAGAATGTTTGTTA

[0064] TAGCCCCTGCATTTAATAACATTGTGTATGTTGAGAAATATACTTTATTATTTATATTTGCGTTTGT (SEQ ID NO: 10).

[0065] The sequence copy number and sequence GC content of this development site were analyzed to ensure that this site meets the high success rate of KASP markers, and then this site was designed as a KASP marker. According to the characteristics of InDel mutation information, a set of competitive allele-specific PCR primers were designed, including Primer X, Primer Y and reverse primers. The ends of the two forward primers are allelic variant bases AAG / ---, and the sequence of the reverse primer should ensure that the amplified fragment is 60-120bp.

[0066] The sequences of Primer X, Primer Y and reverse primer are shown in the following table:

[0067] Table 1

[0068]

[0069] The 5' end of the forward primer is connected to a fluorescent label sequence, wherein the 5' end of Primer X is connected to a FAM fluorescent label sequence 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO: 4), and the 5' end of Primer Y is connected to a HEX fluorescent label sequence 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO: 6).

[0070] The above primer sequences were synthesized by Tianyi Huiyuan Biotechnology Co., Ltd. The KASP genotyping provided by the present invention has a large throughput and is easy to operate. It only needs to add the specific KASP Primer mix and the universal KASP Master mix to the PCR microwell reaction plate containing the DNA sample to perform PCR amplification. The final result can be analyzed using a fluorescence detector.

[0071] KASP Master mix contains the following components: universal FRET cassette fluorescent primer, ROX internal reference dye, KlearTaq DNA polymerase, dNTP and MgCl2, and the KASP Master mix is ​​a product of LGC Company in the UK, and the product catalog number is KBS-1016-002.

[0072] Example 2: InDel marker Cmhen 4 used for marker-assisted selection breeding

[0073] 1. Extract genomic DNA from 96 Channa maculata;

[0074] 2. Dilute DNA concentration: DNA to 18-22ng / μL (preferably 20ng / μL) as a template;

[0075] 3. PCR amplification reaction system: template DNA 5μL, KASP Primer mix 5μL, KASP Master mix 0.14μL;

[0076] 4. PCR reaction conditions: template DNA 5μL, KASP Primer mix 5μL (Primer X concentration is 1μM, Primer Y concentration is 1μM, reverse primer concentration is 3μM), KASP Master mix 0.14μL. PCR reaction program is as follows: 94℃ for 15 minutes; 94℃ for 20 seconds, 65℃-56℃ for 60 seconds, annealing extension temperature is reduced by 0.8℃ for each cycle, 10 cycles; 94℃ for 20 seconds, 57℃ for 60 seconds, 30 cycles;

[0077] 5. Fluorescence scanning of PCR amplification products: Use ARAYA to scan the fluorescence signal of the reaction system; then use INTELLICS for data analysis and genotyping;

[0078] 6. Result analysis: The genotype of female Channa maculata is XX, the genotype of male Channa maculata is XY, and the genotype of super male Channa maculata is YY.

[0079] If the fluorescence corresponding to Primer X is detected in the amplified product, the base at this site is a homozygous genotype of "---", and the corresponding Channa maculata is female; if two different fluorescences are detected in the amplified product, the base at this site is a heterozygous genotype of "AAG / ---", and the corresponding Channa maculata is male. If the fluorescence corresponding to Primer Y is detected in the amplified product, the base at this site is a homozygous genotype of "AAG", and the corresponding Channa maculata is super male.

[0080] The marker typing of Cmhen 4 also has only three genotypes (such as Figure 1 The results of Cmhen 4 typing were consistent with the results of gonad examination, and the results showed that the Cmhen 4 marker can accurately distinguish female, male and super male Channa maculata with high speed and accuracy, so it can be used for molecular marker-assisted selection breeding.

[0081] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. An InDel marker closely linked to the sex gene of Channa maculata, wherein the InDel marker is a nucleotide sequence located at 34302196 to 34302199 on chromosome 2 of the Channa maculata genome and containing a polymorphic "AAG / ---" site; wherein, - indicates a base deletion.

2. The InDel marker according to claim 1, characterized in that The homozygous genotype with the base of the polymorphic site being "---" corresponds to female Channa maculata, the heterozygous genotype with the base of the polymorphic site being "AAG / ---" corresponds to male Channa maculata, and the homozygous genotype with the base of the polymorphic site being "AAG" corresponds to super male Channa maculata.

3. KASP primers for amplifying the InDel-labeled protein according to claim 1 or 2, comprising a first primer, a second primer and a third primer; The first primer contains the nucleotide sequence shown in SEQ ID NO.1; The second primer contains the nucleotide sequence shown in SEQ ID NO.2; The nucleotide sequence of the third primer is shown in SEQ ID NO.

3.

4. The KASP primer according to claim 3, characterized in that The 5' end of the first primer is added with a label sequence A corresponding to the A fluorescence; The 5' end of the second primer is added with a label sequence B corresponding to the B fluorescence; The A fluorescence is different from the B fluorescence.

5. The KASP primer according to claim 4, characterized in that The A fluorescence is selected from any one of FAM fluorescence, HEX fluorescence, TET fluorescence, ROX fluorescence, TAMRA fluorescence, JOE fluorescence, Cy3 fluorescence, Cy5 fluorescence, VIC fluorescence, BHQ1 fluorescence, BHQ2 fluorescence, BHQ3 fluorescence, JOE fluorescence, VIC fluorescence, Texas-Red fluorescence, and MGB fluorescence; and the B fluorescence is selected from any one of FAM fluorescence, HEX fluorescence, TET fluorescence, ROX fluorescence, TAMRA fluorescence, JOE fluorescence, Cy3 fluorescence, Cy5 fluorescence, VIC fluorescence, BHQ1 fluorescence, BHQ2 fluorescence, BHQ3 fluorescence, JOE fluorescence, VIC fluorescence, Texas-Red fluorescence, and MGB fluorescence.

6. A detection reagent or kit comprising the KASP primer according to claim 4 or 5.

7. The detection reagent or kit according to claim 6, characterized in that: The detection reagent or kit also contains a probe, a DNA polymerase, dNTP and MgCl2. The probe is a double-stranded structure, containing a complementary first strand and a second strand. The probe includes a first probe and a second probe. The first strand of the first probe is at least partially complementary to the label sequence A and is labeled with the A fluorescence, and the second strand of the first probe is labeled with a quenched fluorescence corresponding to the A fluorescence. The first strand of the second probe is at least partially complementary to the label sequence B and is labeled with the B fluorescence, and the second strand of the second probe is labeled with a quenched fluorescence corresponding to the B fluorescence.

8. Use of any one of the InDel marker according to claim 1 or 2, the KASP primer according to any one of claims 3 to 5, and the detection reagent or kit according to claim 6 or 7 in any of the following aspects: 1) Identify the sex of Channa maculata; 2) Molecular marker-assisted breeding related to sex of Channa maculata; 3) Genotyping of Channa maculata; 4) Construct a DNA fingerprint of Channa maculata.

9. A method for identifying the sex of Channa maculata, comprising the following steps: 1) extracting genomic DNA of Channa maculata to be tested; 2) using DNA as a template and performing PCR amplification using the KASP primers described in claim 4 or 5; 3) Analyze the PCR amplification products and determine the sex of Channa maculata based on the genotype of the polymorphic sites contained in the amplification products.

10. The method according to claim 9, characterized in that If the fluorescence corresponding to the A fluorescence is detected in the amplified product, the base at this site is the "---" homozygous genotype, and the corresponding Channa maculata is female; if two different fluorescences are detected in the amplified product, the base at this site is the "AAG / ---" heterozygous genotype, and the corresponding Channa maculata is male; if the fluorescence corresponding to the B fluorescence is detected in the amplified product, the base at this site is the "AAG" homozygous genotype, and the corresponding Channa maculata is super male.

Images