Primer probe combination for simultaneously detecting multiple pathogens of swine atrophic rhinitis, kit and application

Abstract

The invention discloses a primer probe combination for simultaneous detection of multiple pathogens of swine atrophic rhinitis, a kit and application, and further realizes rapid detection, screening and distinguishing of swine atrophic rhinitis caused by co-infection or independent infection of Bordetella bronchiseptica and swine toxin-producing pasteurella multocida through a dual fluorescent quantitative PCR (polymerase chain reaction) method. The kit has the advantages of simple operation, high accuracy and good specificity, and can realize rapid clinical diagnosis and pathogen control.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a primer-probe combination, a kit and applications for simultaneous detection of multiple pathogens of porcine atrophic rhinitis. Background Art

[0002] Swine infectious atrophic rhinitis is a chronic consumptive respiratory disease caused by infection with Bordetella Bronchiseptica and Toxigenic Pasteurellamultocida. The main clinical manifestations are atrophy and deformation of the nasal turbinates, facial wrinkles, and nasal bleeding. Autopsy shows significant lesions such as nasal turbinates damage, nasal septum bending, and nasal cavities. Bordetella bronchiseptica and Pasteurella multocida can cause the disease alone or together. Co-infection can cause severe nasal turbinates damage and atrophy, making the nasal turbinates unable to block and filter other pathogens, aggravating respiratory disease infections in pigs, and causing huge losses to the pig industry. In addition, the two pathogens can infect alone or in combination, making it difficult to distinguish clinically. It is time-consuming to separate, identify, purify, and microscopically examine the bacteria, and rapid diagnosis cannot be achieved. Real-time fluorescence quantitative PCR has the advantages of simplicity, speed, good specificity and high sensitivity. However, there is currently no fluorescence quantitative PCR detection method that can simultaneously detect and distinguish the two pathogens that cause porcine atrophic rhinitis. Summary of the invention

[0003] The purpose of the present invention is to provide a primer-probe combination, a kit and an application for the simultaneous detection of multiple pathogens of porcine atrophic rhinitis, which can detect and distinguish different pathogens that cause porcine atrophic rhinitis individually or simultaneously, and the detection process is fast, accurate and convenient.

[0004] In order to achieve the above technical objectives, the technical solution adopted by the present invention is:

[0005] In the first aspect, the present invention provides a primer-probe combination for simultaneous detection of multiple pathogens of porcine atrophic rhinitis, wherein the multiple pathogens of porcine atrophic rhinitis are porcine bronchiseptic Bordetella and porcine toxigenic Pasteurella multocida; the primer sequences for detecting porcine bronchiseptic Bordetella are shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe sequence is shown in SEQ ID NO.3; the primer sequences for detecting porcine toxigenic Pasteurella multocida are shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe sequence is shown in SEQ ID NO.6.

[0006] Preferably, the 5' fluorescent group and 3' fluorescent group of the probe for detecting porcine Bordetella bronchiseptica are FAM and BHQ1, respectively; and / or, the 5' fluorescent group and 3' fluorescent group of the probe for detecting porcine toxigenic Pasteurella multocida are VIC and BHQ2, respectively.

[0007] In a second aspect, the present invention provides a kit for simultaneous detection of multiple pathogens of porcine atrophic rhinitis, comprising the primer-probe combination of claim 1 or 2 and other necessary reagents for realizing multiplex fluorescence quantitative PCR detection.

[0008] Preferably, in the primer-probe combination, the other necessary reagents include: 2×Ex Taq Mix, negative control substances, and positive control substances.

[0009] Preferably, the negative control substance is ddH2O, and the positive control substance is genomic DNA of Bordetella bronchiseptica and genomic DNA of Pasteurella multocida.

[0010] In a third aspect, the present invention provides an application of the primer-probe combination described in the first aspect or the kit described in the second aspect for detecting Bordetella bronchiseptica and / or Pasteurella multocida of porcine toxigenicity at a non-diagnostic destination, wherein the application is to use dual fluorescence quantitative PCR to detect whether a sample contains Bordetella bronchiseptica and / or Pasteurella multocida of porcine toxigenicity.

[0011] Preferably, the reaction procedure of the dual fluorescence quantitative PCR detection is: 50°C for 2 min, 95°C for 1 min, 95°C for 15 s, 60°C for 30 s, and 45 cycles.

[0012] Preferably, the result determination method of the dual fluorescence quantitative PCR detection is: judging the positive and negative of the result by the size of the Ct value of the fluorescence amplification curve graph to determine whether the sample contains porcine bronchiseptica Bordetella and / or porcine toxigenic Pasteurella multocida.

[0013] Preferably, when the Ct value is ≤38, there is a specific amplification curve and the result is positive; when the Ct value of the amplification curve is >38 or there is no Ct value, the result is negative.

[0014] Compared with the prior art, the present invention has the following beneficial effects:

[0015] So far, there is no dual fluorescence quantitative PCR method that can simultaneously detect porcine atrophic rhinitis caused by co-infection of porcine bronchiseptica Bordetella and porcine toxin-producing Pasteurella multocida. Therefore, the present invention designs a primer probe combination for simultaneous detection of multiple pathogens of porcine atrophic rhinitis, which can be applied to a kit, and realizes rapid detection, screening and differentiation of porcine atrophic rhinitis caused by co-infection or single infection of Bordetella bronchiseptica and porcine toxin-producing Pasteurella multocida by dual fluorescence quantitative PCR method, which is simple to operate, has high accuracy and good specificity, and can realize rapid clinical diagnosis and control of pathogens. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for describing the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative labor. Among them:

[0017] Figure 1 It is an amplification curve diagram of a 10-fold dilution gradient series of positive standard samples of the dual fluorescence quantitative PCR kit for porcine bronchiseptica and porcine toxin-producing Pasteurella multocida in Example 2 of the present invention; wherein, Target 1 represents the FAM channel of porcine bronchiseptica, and Target 2 represents the VIC channel of porcine toxin-producing Pasteurella multocida.

[0018] Figure 2 It is a quantitative standard curve diagram of the FAM channel of porcine bronchiseptica Bordetella in Example 2 of the present invention; wherein Target 1 represents the FAM channel of porcine bronchiseptica Bordetella, and Target 2 represents the VIC channel of porcine toxigenic Pasteurella multocida.

[0019] Figure 3 It is a quantitative standard curve diagram of the VIC channel of porcine toxigenic Pasteurella multocida in Example 2 of the present invention; wherein, Target 1 represents the FAM channel of porcine Bordetella bronchiseptica, and Target 2 represents the VIC channel of porcine toxigenic Pasteurella multocida.

[0020] Figure 4 It is a graph of the amplification results of the positive control sample in Example 3 of the present invention; wherein, Target 1 represents the FAM channel of porcine bronchiseptica Bordetella, and Target 2 represents the VIC channel of porcine toxigenic Pasteurella multocida.

[0021] Figure 5It is a graph of the amplification results of the negative control sample in Example 3 of the present invention; wherein, Target 1 represents the FAM channel of porcine bronchiseptica Bordetella, and Target 2 represents the VIC channel of porcine toxigenic Pasteurella multocida.

[0022] Figure 6 It is a specific detection result diagram of the dual fluorescence PCR detection method in Example 3 of the present invention; wherein Target 1 represents the FAM channel of porcine bronchiseptica Bordetella, and Target 2 represents the VIC channel of porcine toxigenic Pasteurella multocida. DETAILED DESCRIPTION

[0023] In the description of the present invention, it should be noted that, if the specific conditions are not specified in the examples, the experiments were carried out according to conventional conditions or the conditions recommended by the manufacturer. The reagents or instruments used, if the manufacturer is not specified, are all conventional products that can be purchased commercially.

[0024] The present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments, which are intended to explain the present invention rather than to limit it.

[0025] Embodiment 1:

[0026] In this example, primers and probe sets with high sensitivity and good specificity for amplifying the alcA gene of porcine Bordetella bronchiseptica and the KMT1 gene of porcine toxigenic Pasteurella multocida were screened out, and their sequences are as follows:

[0027] The primer probe used in the present invention is:

[0028] Upstream and downstream primers and probes for Bordetella bronchiseptica:

[0029] Bb-F1: 5'-CTGGTCCTGGGTCTTGGTT-3', SEQ ID NO.1;

[0030] Bb-R1: 5'-CGCAGATAGTCCGCGCTAT-3', SEQ ID NO.2;

[0031] Bb-Proble1: 5'-CACGTCGATCGCAGCACGCT-3', SEQ ID NO. 3; the 5' fluorescent group and 3' fluorescent group are FAM and BQH1 respectively;

[0032] Upstream and downstream primers and probes for porcine toxigenic Pasteurella multocida:

[0033] Pm-F1: 5'-TGAGTGGGCTTGTCGGTAGTC-3', SEQ ID NO.4;

[0034] Pm-R1: 5'-GCCGTTGTCAAGGAAGCAGAT-3', SEQ ID NO.5;

[0035] Pm-Proble1: 5'-CAACACACCAAACTCCGCCCAACA-3', SEQ ID NO. 6; the 5' fluorescent group and the 3' fluorescent group are VIC and BHQ2, respectively.

[0036] During the screening process, another set of primers and probes targeting Bordetella bronchiseptica was obtained:

[0037] Bb-F2: 5'-GATCCCGAAAGCCACAGCTA-3', SEQ ID NO.7;

[0038] Bb-R2: 5'-GCAGATAGTCCCGCGCTATGG-3', SEQ ID NO.8;

[0039] Bb-Proble2: 5'-AGCTTGCGGCAGCGGAACAT-3', SEQ ID NO.9, the 5' fluorescent group and 3' fluorescent group are FAM and BQH1 respectively;

[0040] And another set of primer probes for porcine toxigenic Pasteurella multocida:

[0041] Pm-F2: 5'-GCTYGTTGTGAGTGGGCTTGT-3', SEQ ID NO.10;

[0042] Pm-R2: 5'-GCCGTTGTCAAGGAAGCAGAT-3', SEQ ID NO.11;

[0043] Pm-Proble2: 5'-TTTGTTGGGCRGAGTTTGGTG-3', SEQ ID NO. 12; the 5' fluorescent group and 3' fluorescent group are VIC and BHQ2, respectively.

[0044] The above two groups of primer probes can respectively amplify the alcA gene of porcine bronchiseptica Bordetella and the KMT1 gene of porcine toxin-producing Pasteurella multocida, but the GC content of the upstream and downstream primers of the primer probe group used in the present invention is consistent, the stability and accuracy of the amplification reaction are good, and there is no complementary sequence between the primers, the primer BLAST specificity is strong, and the length of the amplified product finally obtained is 89bp for porcine bronchiseptica Bordetella and 106bp for porcine toxin-producing Pasteurella multocida, respectively, and the length is appropriate. The GC content of the upstream and downstream primers of the other group of primer probes is also consistent, the stability and accuracy of the amplification reaction are also good, and there is no complementary sequence between the primers, the primer BLAST specificity is strong, and the degenerate base can meet the degenerate nature of the codon. Therefore, this group of primer probes was initially selected for subsequent research, but in the actual application process, it was found that this group of primer probes could not effectively bind to the target sequence, resulting in a decrease in specificity and accuracy, and there were one or two false negative results. The length of the amplified product of this set of primers and probes for Bordetella bronchiseptica in pigs is 166bp, which is longer, and the upstream primer is far away from the probe. Finally, the first set of primers and probes was selected, which can ensure stability and accuracy, and also has strong specificity.

[0045] Embodiment 2:

[0046] This example performs positive standard preparation and sensitivity testing of the dual fluorescence quantitative PCR detection method, as follows:

[0047] (1) Preparation of standard samples: In order to draw the standard curve of dual fluorescence quantitative PCR, we extracted DNA of Bordetella bronchiseptica and Pasteurella multocida as PCR templates, respectively, amplified the corresponding target sequences using the primers in Example 1, and connected the amplified products into vectors to obtain plasmids containing the target sequences of Bordetella bronchiseptica and Pasteurella multocida, i.e., Bordetella bronchiseptica standard and Pasteurella multocida positive standard.

[0048] Conservative nucleotide sequence of alcA gene of Bordetella bronchiseptica (SEQ ID NO.13):

[0049] ctactacatgcgcgagaaccattacctgagccgcgccgagtacacccgctattgccaatgggtagctgcacgcttgccgaacctgcgtttcggctgcgatgtacagggcgtactgcacgatcccgaaagccacagctatctcgtcaccggccaacacaccatgtccggccagcggttcatgttccgctgccgcaagctggtcctgggtcttggttcccagccctatctgccagcgtgctgcgatcgacgtgccgcgcccttcatccatagcgcggactatctgcgccataaatacgaactccagggccgcgcgtcaatcaccatagtgggcagcggacaaagcgcggccgaagtgttccatgatctgctccgtgagagcgggcgacatgattacagtctggcctggatcactcgctctccgcgctttttccagatggagaacacaa

[0050] Conserved nucleotide sequence of the toxigenic Pasteurella multocida KMT1 gene in pigs (SEQ ID NO.14):

[0051] cgagcaaacaatggtggggctttacgctgattaatattgtgctgacattactgctctatccgctatttacccagtggggcggtgcgaatgaaccgattgccgcgaaattgagttttatgccacttgaaatgggaaatggcattattttatggctcgttgtgagtgggcttgtcggtagtcttttatttggcttgtggcaaagaaaagcacagttttgttgggcggagtttggtgtgttgagccaatctgcttccttgacaacggcgcaactgattggacgttatttattactcagcttattgttatttgccggtttatatttccttgtcagtctgatttatcaatatttccatgttgagttacgtttcttatggccattattgaagc

[0052] (2) Sensitivity detection of positive standard samples by dual fluorescence quantitative PCR

[0053] The above-mentioned Bordetella bronchiseptica standard and the positive standard of Pasteurella multocida were diluted 10 times in a gradient manner and used as standards to detect the quantitative range and determine its sensitivity. The diluted plasmid standards were amplified under the optimal amplification conditions.

[0054] The dual fluorescence quantitative PCR amplification reaction system is: 2×Ex TaqMix 10μL; 10μM Bb-F 0.3μL; 10μM Bb-R 0.3μL; 10μM Bb-Proble 0.15uL;

[0055] 10μM Pm-F 0.3μL; 10μM Pm-R 0.3μL; 10μM Pm-Proble 0.15uL; ROX: 0.1uL; DNA template / negative control / positive control 5μL; ddH2O 3.4μL; total volume 20μL. Amplification conditions: 50℃2min, 95℃1min, 95℃15s, 60℃30s, 45 cycles.

[0056] (3) Sensitivity results analysis

[0057] Test results such as Figures 1 to 3 As shown, Figure 1 Amplification curves of 10-fold dilution series of samples of the swine Bordetella bronchiseptica standard and the swine toxigenic Pasteurella multocida positive standard; Figure 2 This is the gradient curve of the FAM channel positive standard of Bordetella bronchiseptica. Figure 3 This is the gradient curve of the VIC channel positive standard of porcine toxigenic Pasteurella multocida. The results show that: 1 ~10 8 The amplification curves of the two channels showed a good linear relationship in the range of copies / μL, and the correlation coefficient R 2 The correlation coefficient R 2 Under the optimal conditions, the detection method established in Example 2 can detect the plasmid standards of Bordetella bronchiseptica and Pasteurella multocida as low as 10 copies / μL, respectively.

[0058] Embodiment 3:

[0059] This example performs specific detection on the primer probe and the dual fluorescence quantitative PCR detection method used, as follows:

[0060] (1) DNA of Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, Haemophilus parasuis, Streptococcus suis, Staphylococcus suis, erysipelas, enterotoxigenic Escherichia coli, Salmonella enteritidis, classical swine fever virus, porcine blue ear virus, Bordetella bronchiseptica and Pasteurella multocida were used as templates, and primers and probes of SEQ ID NOs. 1 to 6 were used for dual fluorescence quantitative PCR amplification.

[0061] (2) The dual fluorescence quantitative PCR amplification reaction system was: 2×Ex TaqMix 10μL; 10μM Bb-F 0.3μL; 10μM Bb-R 0.3μL; 10μM Bb-Proble 0.15uL; 10μM Pm-F 0.3μL; 10μM Pm-R 0.3μL; 10μM Pm-Proble0.15uL; ROX: 0.1uL; DNA template / negative control / positive control 5μL; ddH2O 3.4μL; total volume 20μL.

[0062] (3) The amplification conditions of dual fluorescence quantitative PCR were: 50°C for 2 min, 95°C for 1 min, 95°C for 15 s, 60°C for 30 s, and 45 cycles.

[0063] At the same time, a negative control group and a positive control group were set up, wherein the negative control was a physiological saline solution without the genome of porcine bronchiseptica Bordetella and porcine toxin-producing Pasteurella multocida. The positive control group was a solution of a positive standard containing both the genome of porcine bronchiseptica Bordetella and porcine toxin-producing Pasteurella multocida.

[0064] (4) Analysis of the result judgment criteria: The positive and negative results are judged by the size of the Ct value of the fluorescence amplification curve to determine whether the sample contains Bordetella bronchiseptica and Pasteurella multocida. When the Ct value of the amplification curve is ≤40 and there is a specific amplification curve (i.e., it shows obvious exponential growth), the result is positive; when the Ct value of the amplification curve is >40 or there is no Ct value, the result is negative. Therefore, in order to have a reference when judging the positive and negative, it is necessary to set up negative and positive controls for the dual fluorescence quantitative PCR detection kit for Bordetella bronchiseptica and Pasteurella multocida when testing samples.

[0065] Test results such as Figures 4 to 6 Shown: Among them Figure 4 This is the result of positive control amplification; Figure 5 This is the amplification result of the negative control group. Figure 6This is a graph of the specific detection results of dual fluorescence quantitative PCR, among which the samples of Mycoplasma hyopneumoniae, Actinobacillus pleuropneumoniae, Haemophilus parasuis, Streptococcus suis, Staphylococcus suis, swine erysipelas, porcine enterotoxigenic Escherichia coli, Salmonella enteritidis, classical swine fever virus, and porcine blue ear virus were all negative; Bordetella bronchiseptica and Pasteurella multocida were positive. The test results were in line with expectations, with an accuracy rate of 100%.

[0066] Embodiment 4:

[0067] The present embodiment provides a kit for the simultaneous detection of multiple pathogens of porcine atrophic rhinitis, the kit comprising: primer probes of SEQ ID NO.1 to 6, 2×Ex Taq Mix, a negative control substance, and a positive control substance, wherein the negative control substance is ddH2O, and the positive control substance is genomic DNA of Bordetella bronchiseptica of porcine and genomic DNA of Pasteurella multocida of porcine toxigenic.

[0068] The kit is used to perform single clinical sample testing using a dual fluorescence quantitative PCR detection method, as follows:

[0069] The genomes of 90 valid porcine throat swab clinical samples were tested by dual fluorescence quantitative PCR and compared with the results of dual conventional PCR (Table 1). The results of double fluorescence quantitative PCR showed that the positive rate of porcine bronchiseptica Bordetella was 32.2%, the positive rate of porcine toxin-producing Pasteurella multocida was 41.1%, and the mixed infection rate was 26.7%; the results of double ordinary PCR (reference Register KB, DeJong KD. Analytical verification of a multiplex PCR for identification of Bordetella bronchiseptica and Pasteurella multocida from swine. Vet Microbiol. 2006; 117 (2-4): 201-210. doi: 10.1016 / j.vetmic.2006.05.003) showed that the positive rate of porcine bronchiseptica Bordetella was 23.3%, the positive rate of porcine toxin-producing Pasteurella multocida was 34.4%, and the mixed infection rate was 17.8%; this method can be applied to the detection of clinical samples, and the positive detection rate is greatly improved compared with the double ordinary PCR method.

[0070] Table 1 Clinical sample test results

[0071]

[0072] From the test results in Table 1, it can be seen that in the same sample, dual fluorescence quantitative PCR has higher accuracy than ordinary PCR, and the detection speed is increased by 42%, saving 50 minutes for a single test.

[0073] In summary, in order to better solve the problem that there is no dual fluorescence quantitative PCR method in the prior art that can simultaneously detect porcine atrophic rhinitis caused by co-infection of Bordetella bronchiseptica and porcine toxin-producing Pasteurella multocida. The present invention designs a primer probe combination for simultaneous detection of multiple pathogens of porcine atrophic rhinitis, which can simultaneously detect porcine atrophic rhinitis caused by co-infection or single infection of Bordetella bronchiseptica and porcine toxin-producing Pasteurella multocida, and realize rapid and accurate screening of Bordetella bronchiseptica and porcine toxin-producing Pasteurella multocida in samples, which is conducive to rapid clinical diagnosis and pathogen control.

[0074] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the patent of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention. Therefore, the protection scope of the patent of the present invention shall be subject to the attached claims.

Claims

1. A primer-probe combination for simultaneous detection of multiple pathogens of porcine atrophic rhinitis, wherein the multiple pathogens of porcine atrophic rhinitis are porcine bronchiseptica Bordetella and porcine toxigenic Pasteurella multocida; characterized in that: The primer sequences for detecting porcine Bordetella bronchiseptica are shown in SEQ ID NO.1 and SEQ ID NO.2, and the probe sequence is shown in SEQ ID NO.3; the primer sequences for detecting porcine toxin-producing Pasteurella multocida are shown in SEQ ID NO.4 and SEQ ID NO.5, and the probe sequence is shown in SEQ ID NO.

6.

2. The primer-probe combination according to claim 1, characterized in that: The 5' fluorescent group and 3' fluorescent group of the probe for detecting porcine Bordetella bronchiseptica are FAM and BHQ1 respectively; and / or, the 5' fluorescent group and 3' fluorescent group of the probe for detecting porcine toxigenic Pasteurella multocida are VIC and BHQ2 respectively.

3. A kit for simultaneous detection of multiple pathogens of porcine atrophic rhinitis, characterized in that: The method comprises the primer-probe combination according to claim 1 or 2 and other necessary reagents for realizing multiplex fluorescence quantitative PCR detection.

4. The kit according to claim 3, characterized in that In the primer-probe combination, the other necessary reagents include: 2×Ex Taq Mix, negative control substances, and positive control substances.

5. The kit according to claim 4, characterized in that The negative control substance is ddH2O, and the positive control substance is genomic DNA of Bordetella bronchiseptica and genomic DNA of Pasteurella multocida.

6. Use of the primer-probe combination according to claim 1 or 2 or the kit according to any one of claims 3 to 5 for detecting porcine bronchiseptica and / or porcine toxigenic Pasteurella multocida at a non-diagnostic destination, characterized in that: The application is to use double fluorescence quantitative PCR to detect whether the sample contains porcine bronchiseptica Bordetella and / or porcine toxigenic Pasteurella multocida.

7. The use according to claim 6, characterized in that: The reaction procedure of the dual fluorescence quantitative PCR detection is: 50°C for 2 min, 95°C for 1 min, 95°C for 15 s, 60°C for 30 s, and 45 cycles.

8. The use according to claim 6 or 7, characterized in that: The result determination method of the dual fluorescence quantitative PCR detection is: judging the positive and negative of the result by the size of the Ct value of the fluorescence amplification curve diagram to determine whether the sample contains porcine bronchiseptica Bordetella and / or porcine toxigenic Pasteurella multocida.

9. The use according to claim 8, characterized in that: When the Ct value is ≤38, there is a specific amplification curve and the result is positive; when the Ct value of the amplification curve is >38 or there is no Ct value, the result is negative.

Images