Application of rice ZOS2-02 gene in regulation and control of salt tolerance

Abstract

The invention aims to disclose a rice salt tolerance related gene ZOS2-02 as well as a coding protein and application thereof. The gene ZOS2-02 is a DNA molecule as shown in 1) or 2): 1) a DNA molecule with a genomic sequence as shown in SEQ ID NO.1; 2) a DNA molecule with a CDS sequence as shown in SEQ ID NO.2; and 3) a DNA molecule which is hybridized with the DNA sequence limited by 1) or 2) under strict conditions and is used for coding the protein. According to the gene engineering application of the gene ZOS2-02 in regulation and control of the salt tolerance of the rice, specifically, the gene ZOS2-02 is knocked out, and the salt tolerance of the rice is improved.

Description

Technical Field

[0001] The invention belongs to the field of genetic engineering, and in particular relates to a rice salt tolerance related gene ZOS2-02 and its encoded protein and application. Background Art

[0002] Rice is one of the three major food crops in the world, and more than half of the world's population relies on rice as their staple food. Salt damage is one of the most important abiotic stresses affecting rice production. Rice is a moderately salt-sensitive crop. When the soluble salt concentration in the soil reaches 0.3%, it will show symptoms of damage, which will eventually lead to a decrease in yield. In the current situation where arable land resources are becoming increasingly scarce, cultivating and promoting new varieties of excellent salt-tolerant rice and making full use of large areas of inland saline-alkali land and coastal tidal flats to produce rice are of great significance to ensuring food security.

[0003] Salt stress can cause osmotic stress, ion toxicity, oxidative stress and other damage to rice. Rice responds to salt stress through osmotic regulation, ion balance regulation, antioxidant system regulation and other methods. Under high salt conditions, the water potential of the environment around the rice roots is lower than the water potential in the rice root cells, causing difficulty in root water absorption and causing osmotic stress. Rice plants will synthesize a large amount of osmotic regulating substances such as proline, betaine, and soluble sugars to reduce cell water potential and promote root water absorption. When there is excessive external Na + Entering the rice plant will destroy the root system's ability to resist K + , Ca 2+ The absorption of some ions such as ions affects the cell ion homeostasis and causes ion toxicity. + Transporter, non-selective cation channel, Na + / K + Antiporters and other proteins regulate Na + The absorption, transport, compartmentalization and efflux of Na in cells + concentration, reducing ion toxicity. When excessive Na accumulates in rice plants, + , and will also lead to excessive accumulation of reactive oxygen species, causing oxidative stress. Rice plants remove excess reactive oxygen molecules and maintain normal cell growth by regulating the biosynthesis and activity of antioxidant enzymes such as peroxidase, superoxide dismutase, and catalase.

[0004] Rice salt tolerance is regulated by a complex molecular network. The traditional breeding method is long and difficult to breed salt-tolerant varieties. Molecular design breeding technology can accelerate the breeding of new salt-tolerant varieties, which depends on the mining of salt-tolerant genes with important application value. At present, a large number of rice salt-tolerant genes have been cloned, but there are few genes with important application value. Therefore, it is necessary to further explore new key salt-tolerant genes in rice to lay the foundation for breeding excellent salt-tolerant rice varieties. Summary of the invention

[0005] In order to overcome the above technical problems existing in the prior art, the present invention provides the genetic engineering application of rice ZOS2-02 gene in regulating rice salt tolerance.

[0006] The technical solution of this patent is as follows

[0007] Genetic engineering application of salt tolerance related gene ZOS2-02, or protein encoded by gene ZOS2-02, or knockout vector of gene ZOS2-02, or primers for amplifying gene ZOS2-02 in regulating salt tolerance of rice;

[0008] The gene ZOS2-02 is a DNA molecule as described in 1) or 2) below:

[0009] 1) A DNA molecule having a genome sequence as shown in SEQ ID NO.1;

[0010] 2) A DNA molecule whose CDS sequence is shown in SEQ ID NO.2.

[0011] Furthermore, knocking out the aforementioned gene ZOS2-02, or reducing the expression level of the protein encoded by the gene ZOS2-02, or transferring the knockout vector of the gene ZOS2-02 into rice can improve the salt tolerance of rice.

[0012] Furthermore, the amino acid sequence of the protein encoded by the gene ZOS2-02 is shown in SEQ ID NO.3.

[0013] Furthermore, the knockout vector of the gene ZOS2-02 uses CRISPR-Cas9 technology to edit the gene in rice, knocking out the aforementioned gene ZOS2-02 in the rice plant, rendering the gene inoperable;

[0014] Furthermore, the knockout vector of the gene ZOS2-02 is a CRISPR-Cas9 vector targeting one or more of target 1 shown in SEQ ID NO.6, target 2 shown in SEQ ID NO.7, and target 3 shown in SEQ ID NO.8.

[0015] Furthermore, the primers for amplifying gene ZOS2-02 are selected from Primer1 shown in SEQ ID NO.4 and Primer2 shown in SEQ ID NO.5, or Primer5 shown in SEQ ID NO.11 and Primer6 shown in SEQ ID NO.12.

[0016] Beneficial effects:

[0017] The present invention first discovered a new plant salt tolerance-related protein gene ZOS2-02. The plant salt tolerance-related protein of the present invention affects the salt tolerance of plants. Inhibiting the expression of the protein encoding gene can lead to improved plant salt tolerance, thereby cultivating salt-tolerant transgenic plants. The protein and its encoding gene can be used for plant genetic improvement. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 It is the mutation site of the ZOS2-02 gene in the wild-type Nipponbare and the ZOS2-02 gene mutants (ZOS2-02-1, ZOS2-02-2 and ZOS2-02-3).

[0019] Figure 2 The phenotypes of wild-type Nipponbare and mutants ZOS2-02-1, ZOS2-02-2, and ZOS2-02-3 under salt stress.

[0020] Figure 3 The survival rate of seedlings of wild-type Nipponbare and mutants ZOS2-02-1, ZOS2-02-2 and ZOS2-02-3 under salt stress. DETAILED DESCRIPTION

[0021] The following examples are provided to facilitate a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The reagents and kits used in the following examples are purchased from conventional biological reagent companies unless otherwise specified.

[0022] Example 1: Cloning of the coding region sequence (CDS) of rice ZOS2-02 gene

[0023] The CDS fragment of ZOS2-02 gene was amplified by PCR using the cDNA of rice variety Nipponbare seedling leaves as template and the primer pair consisting of Primer1 and Primer2.

[0024] Primer1:5'-ATGTGCTCTGGAGATGATATT-3' (SEQ ID NO.4);

[0025] Primer2: 5'-CTAATGAGTTTGGCTCGAATC-3' (SEQ ID NO. 5).

[0026] The PCR reaction system (50 μl) was: template cDNA (50 ng / μl) 2 μl, Primer1 (10 uM) 1.5 μl, Primer2 (10 uM) 1.5 μl, dNTP Mix (10 mM) 1 μl, 2×Phanta Max Buffer 25 μl, Phanta Max Super-Fidelity DNA Polymerase 1 μl, and ddH2O 18 μl.

[0027] PCR amplification was carried out in a Bio-Rad T100 PCR amplifier with the following procedure: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, and extension at 72°C for 90 s, for 35 cycles; extension at 72°C for 5 min; and storage at 4°C.

[0028] The PCR product was purified using a DNA purification kit (Nanjing Novogene Biotech Co., Ltd.), ligated to the pEASY-Blunt expression vector (Beijing Quanshijin Biotechnology Co., Ltd.), transformed into Escherichia coli DH5α competent cells (Beijing Tiangen Company), and the positive clones were selected and sent to Beijing Qingke Biotech Co., Ltd. for sequencing.

[0029] The sequencing results showed that the CDS fragment of the ZOS2-02 gene obtained by PCR amplification had the nucleotide sequence shown in SEQ ID NO.2, encoding a protein consisting of 379 amino acid residues (SEQ ID NO.3).

[0030] Example 2: Construction of transgenic rice ZOS2-02 gene mutant plants

[0031] The genome sequence (SEQ ID NO.1) and CDS sequence (SEQ ID NO.2) of ZOS2-02 were provided to Wuhan Boyuan Biotechnology Co., Ltd., which designed the target. The specific method is as follows: the genome sequence (SEQ ID NO.1) of ZOS2-02 was input into the CRISPR-P V2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), the CRISPR-Cas9sgRNA target was designed by the website, and one or more of target 1, target 2 and target 3 were selected for gene editing vector construction.

[0032] The sequence of target 1 is: ACCACAACCATCCATAGAGCAGG (SEQ ID NO.6),

[0033] The sequence of target 2 is: CAAGGAGGAGGGCTGTAACAAGG (SEQ ID NO.7)

[0034] The sequence of target 3 is: CCGGCAGTTTGTTTGCAAGGAGG (SEQ ID NO.8),

[0035] The above three sgRNA units were synthesized into the intermediate vector PUC57 by full gene synthesis. Then, Primer3 and Primer4 primers were synthesized, and PCR amplification was performed using the PUC57 plasmid with three sgRNAs inserted as a template to obtain a double-stranded DNA molecule with sticky ends.

[0036] Primer3:5'-CAGTGGTCTCATGCAACCACAACCATCCATAGAGCGTTTTAGAG-3' (SEQ IDNO.9);

[0037] Primer4:5'-CAGTGGTCTCAAAACCCTTGCAAACAAACTGCCGGTGC-3'(SEQ ID NO.10)

[0038] The double-stranded DNA molecule was connected to the pHK1-Cas9-U3 linearized vector cut by Bsa I using T4 DNA ligase (the vector is contained in the "Monocotyledon Gene Editing Vector Kit (Hyg)" of Wuhan Boyuan Biotechnology Co., Ltd.), and the ligation product was transformed into Escherichia coli DH5α, and the positive clones were identified by colony PCR, and the plasmid was extracted for sequencing. The sequencing results showed that a recombinant vector containing the sequences shown in SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8 was obtained. Then, the Nipponbare callus was transformed by Agrobacterium-mediated genetic transformation to obtain T0 transgenic plants.

[0039] Example 3: Molecular identification of rice ZOS2-02 gene mutant transgenic plants

[0040] The aboveground part of the seedlings of the T0 generation transgenic plants of the ZOS2-02 gene constructed in Example 2 was sampled, and genomic DNA was extracted as a template. The primer pair consisting of Primer5 and Primer6 was used to PCR amplify the editing target sites shown in SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8 and the DNA fragments on both sides thereof.

[0041] Primer5:5'-GTGAGAGGATCCAACATCAA-3' (SEQ ID NO.11);

[0042] Primer6: 5'-AACACCTTTTTCACACCCGT-3' (SEQ ID NO. 12).

[0043] The PCR products were detected by 1% agarose gel electrophoresis and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. According to the sequencing results, three strains with specific mutations in the ZOS2-02 gene were identified, namely: ZOS2-02-1, ZOS2-02-2 and ZOS2-02-3. The DNA sequences of the editing target sites and their flanking sites in these three strains are as follows Figure 1 shown.

[0044] In strain ZOS2-02-1, there were three deletions of a total of 9 nucleotides in the third exon of the ZOS2-02 gene;

[0045] In the ZOS2-02-2 strain, there were 2 deletions of 9 nucleotides and 1 nucleotide insertion in the third exon of the ZOS2-02 gene;

[0046] In the ZOS2-02-3 strain, there were 2 deletions totaling 7 nucleotides, 2 insertions totaling 3 nucleotides, and 1 nucleotide mutation in the third exon of the ZOS2-02 gene.

[0047] In these three mutant strains, mutations in the CDS sequence of the ZOS2-02 gene all resulted in frameshift mutations in the proteins they encoded.

[0048] Example 4: Identification of salt tolerance of ZOS2-02 gene mutant strains

[0049] The three ZOS2-02 gene mutants identified in Example 3 were self-pollinated for two generations to obtain homozygous mutant lines ZOS2-02-1, ZOS2-02-2 and ZOS2-02-3. These three homozygous mutant lines were used together with the Nipponbare wild type (WT) to conduct the following salt tolerance identification experiment at the seedling stage:

[0050] (1) Select full rice seeds and soak them in tap water in a 33°C incubator for about 3 days until the seeds turn white. Select seeds with consistent germination and sow them on a 96-well PCR plate with the bottom removed. Place them in a black plexiglass culture box and culture them in an artificial climate chamber. The culture conditions are: 14 h light (28°C) / 10 h dark (24°C), light intensity 1000 μmol·m -2 ·s -1 , relative humidity 70%.

[0051] (2) After culturing rice seedlings in pure water for one week, they were cultured in Kimura B nutrient solution. When the seedlings grew to the two-leaf and one-heart stage, the nutrient solution was replaced with Kimura B nutrient solution containing 120 mM NaCl for salt stress treatment.

[0052] (3) After 15 days of treatment with 120 mM NaCl, the seedlings were rehydrated with Kimura B nutrient solution without NaCl, and the survival rate of the seedlings was calculated after 5 days. Survival rate = number of surviving seedlings / total number of treated seedlings × 100%.

[0053] The results of salt tolerance identification of ZOS2-02 gene mutant strains are shown in Figure 2 and Figure 3 The results showed that compared with the wild type (WT) of Nipponbare, the three ZOS2-02 gene mutant strains had milder salt damage symptoms such as leaf wilting and drying, and their growth status such as plant height was also better than that of the wild type ( Figure 2 ), and the survival rate of seedlings of the three ZOS2-02 gene mutant strains after rehydration was significantly increased.

[0054] The above experimental results show that the ZOS2-02 gene has the function of negatively regulating the salt tolerance of rice seedlings, and knocking out this gene can significantly improve the salt tolerance of rice.

[0055] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Salt tolerance related gene ZOS2-02, or protein encoded by gene ZOS2-02, or knockout vector of gene ZOS2-02, or the application of primers for amplifying gene ZOS2-02 in genetic engineering in regulating salt tolerance of rice; The gene ZOS2-02 is a DNA molecule as described in 1) or 2) below: 1) A DNA molecule having a genome sequence as shown in SEQ ID NO.1; 2) A DNA molecule whose CDS sequence is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: Knocking out the gene ZOS2-02 described in claim 1, or reducing the expression level of the protein encoded by the gene ZOS2-02, or transferring the knockout vector of the gene ZOS2-02 into rice can improve the salt tolerance of rice.

3. The use according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the gene ZOS2-02 is shown in SEQ ID NO.

3.

4. The use according to claim 1, characterized in that: The knockout vector of the gene ZOS2-02 is a CRISPR-Cas9 vector targeting one or more of target 1 shown in SEQ ID NO.6, target 2 shown in SEQ ID NO.7, and target 3 shown in SEQ ID NO.

8.

5. The use according to claim 1, characterized in that: The primers for amplifying gene ZOS2-02 are selected from Primer1 shown in SEQ ID NO.4 and Primer2 shown in SEQ ID NO.5, or Primer5 shown in SEQ ID NO.11 and Primer6 shown in SEQ ID NO.12.

Images