CsDRM2 gene for regulating and controlling color of cucumber peel, encoded protein and application

Abstract

The invention provides a CsDRM2 gene for regulating and controlling the color of cucumber peel, an encoded protein and application, and belongs to the technical field of bioengineering breeding. The CsDRM2 gene participating in cucumber peel color regulation and control is identified and verified, then a cucumber CsDRM2 overexpression material is constructed by utilizing a transgenic technology, and function research is carried out on the CsDRM2 gene. Experiments prove that the overexpression of the CsDRM2 gene delays the time that the cucumber tender fruit turns green from yellow, so that the cucumber can keep the color of the tender fruit for a long time in the early stage of fruit development, and the commodity and ornamental value of the cucumber are increased.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering breeding, and in particular to a CsDRM2 gene for regulating cucumber peel color, a coded protein and an application thereof. Background Art

[0002] Cucumber (Cucumis sativus L., 2n=2x=14), also known as cucumber and prickly melon, is an annual herbaceous plant of the genus Cucurbitaceae. It originates from the southern foothills of the Himalayas and is now widely planted in temperate and tropical regions. It is an important economic crop in the world. It likes warmth, has poor cold resistance and heat resistance; likes moisture, and cannot tolerate waterlogging; likes fertilizer, but cannot tolerate fertilizer; likes light, and the fruit grows poorly due to insufficient light; has a shallow root system and weak absorption capacity; and has poor stress resistance.

[0003] Peel color is an important criterion for cucumber quality traits. It can greatly influence consumers' choices and has important commodity value. The commodity value of cucumber peel color has strong regional characteristics. Consumers in different regions have different preferences for peel color, and it is impossible to use a unified standard to judge the quality of a certain peel color. At the same time, the genetic law of cucumber peel color is also relatively complex. Its inheritance may follow the law of free combination of genes and be controlled by multiple pairs of alleles. Therefore, improving the appearance characteristics of fruits, especially peel color, in combination with market demand in different regions is an important breeding goal to increase the economic value of cucumbers. At present, the peel color of Chinese cucumber germplasm is mainly divided into dark green, dark green, green, light green, yellow-green, white-green, yellow-white and milky white. At present, there is little research on the molecular regulation mechanism of cucumber peel color, and the function of genes in regulating peel color has not been reported. Summary of the invention

[0004] The purpose of the present invention is to provide a CsDRM2 gene, an encoded protein and an application for regulating the color of cucumber peel. The CsDRM2 gene can be used to regulate the process of changing the color of cucumber peel from yellow to green.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a CsDRM2 gene for regulating cucumber peel color. The nucleotide sequence of the cucumber CsDRM2 gene is shown as SEQ ID NO.1.

[0007] The present invention also provides a protein encoded by the CsDRM2 gene for regulating the color of cucumber peel. The amino acid sequence of the protein encoded by the CsDRM2 gene is shown in SEQ ID NO.2.

[0008] The present invention also provides a primer set for amplifying the CsDRM2 gene encoding the cucumber peel color regulating gene, which consists of the following sequence:

[0009] CsDRM2-F (SEQ ID NO. 3):

[0010] 5'-ATGGGGATATTTGTAGCTGGTGA-3';

[0011] CsDRM2-R (SEQ ID NO.4):

[0012] 5'-TTCAGTTTTGGTGGCTATACACTTG-3'.

[0013] The present invention also provides an application of a CsDRM2 gene for regulating cucumber peel color or a protein encoded by the CsDRM2 gene for regulating cucumber peel color in regulating cucumber peel color.

[0014] Furthermore, the CsDRM2 gene or its encoded protein that regulates the color of cucumber peel can regulate the process of changing the color of cucumber peel from yellow to green.

[0015] The present invention also provides an application of a CsDRM2 gene for regulating cucumber peel color or a protein encoded by the CsDRM2 gene for regulating cucumber peel color in cucumber peel mutant breeding.

[0016] The present invention also provides an application of a CsDRM2 gene regulating cucumber peel color or a protein encoded by the CsDRM2 gene regulating cucumber peel color in early identification of cucumber peel color.

[0017] The beneficial effects of the present invention compared with the prior art are:

[0018] The invention identifies and verifies a CsDRM2 gene involved in regulating the color of cucumber peel, then uses transgenic technology to construct cucumber CsDRM2 overexpression materials, and conducts functional research on the CsDRM2 gene. Experiments show that overexpression of the CsDRM2 gene delays the time for cucumber tender fruits to change from yellow to green, allowing cucumbers to maintain tender fruit color for a longer period of time in the early stage of fruit development, thereby increasing the commercial and ornamental value of cucumbers. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative labor.

[0020] Figure 1 The bar graph of the transcriptome data of wild-type CsDRM2 after 0, 6, 12, 18, 24, and 30 days of pollination in Example 1 of the present invention;

[0021] Figure 2 This is the cucumber CsDRM2 gene overexpression vector map in Experimental Example 1 of the present invention;

[0022] Figure 3 Fluorescence quantitative verification that the expression of CsDRM2 overexpression gene is significantly increased compared with wild type;

[0023] Figure 4 The phenotypes of the peel color of wild-type and transgenic cucumbers on days 4, 7, 10, and 14 after field pollination in Test Example 1 of the present invention;

[0024] Figure 5 The length and diameter of the wild-type and transgenic cucumbers on the 10th, 12th, 14th, 16th, 18th and 22nd day after field pollination in Test Example 1 of the present invention;

[0025] Figure 6 These are the early L, C, and H values ​​of the wild-type and transgenic cucumbers after field pollination in Test Example 2 of the present invention. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to the skilled artisan. The present invention description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] The cucumber inbred line "9930" of the present invention has been published in the article "The genome of the cucumber, Cucumis sativus L." in the journal Nature Genetics (Sanwen Huang et al., 2009) in 2009. The above germplasm resources are stored in the laboratory germplasm bank of Yangzhou University, and technicians in this field can obtain them through the laboratory germplasm bank of Yangzhou University.

[0032] Example 1

[0033] The embodiment of the present invention provides a method for preparing a CsDRM2 gene overexpression material DRM2-OE-1, and the specific steps are as follows:

[0034] (1) Acquisition of cucumber CsDRM2 gene

[0035] Using the root cDNA of cucumber inbred line '9930' as template, cloning primers CsDRM2-F and CsDRM2-R were designed and PCR amplification was performed using high-fidelity DNA polymerase.

[0036] Primer CsDRM2-F (SEQ ID NO.3):

[0037] 5'-ATGGGGATATTTGTAGCTGGTGA-3';

[0038] CsDRM2-R (SEQ ID NO.4):

[0039] 5'-TTCAGTTTTGGTGGCTATACACTTG-3'.

[0040] The PCR system was 50 μL in total: 2×Phanta Flash MasterMix 25 μL, template 2 μL, upstream and downstream primers 2 μL each, and ddH2O 19 μL.

[0041] The PCR reaction program was as follows: pre-denaturation at 98°C for 30 seconds; denaturation at 98°C for 10 seconds, annealing at 60°C for 5 seconds, and extension at 72°C for 2 minutes, for a total of 35 cycles; and finally extension at 72°C for another minute.

[0042] The obtained PCR reaction product was identified by 1% agarose gel electrophoresis, and then the target band was purified by Takara's gel recovery kit, and the product was connected to the PMD19-T vector (Takara). The above recombinant plasmid was sent for testing to obtain the full-length sequence of the cucumber CsDRM2 gene.

[0043]

[0044] CsDRM2 protein amino acid sequence (SEQ ID NO.2):

[0045] .

[0046] (2) Cucumber CsDRM2 gene overexpression vector ( Figure 2 )

[0047] Homologous recombination primers were designed based on the overexpression vector pCAMBIA1305.4 (Weimi Biotechnology (Jiangsu) Co., Ltd.) and the sequence shown in SEQ ID No. 1. The primer sequences are as follows:

[0048] pCAMBIA1305.4-CsDRM2-F (SEQ ID NO.5):

[0049] GAGAACACGGGGGACTCTAGAATGGGGATATTTGTAGCTGGTGA;

[0050] pCAMBIA1305.4-CsDRM2-R (SEQ ID NO.6):

[0051] GGGAAATTCGAGCTCACTAGTTTCAGTTTTGGGTGGCTATACACTTG.

[0052] The CsDRM2 gene was amplified by PCR using the homologous recombination primers, and then subjected to agarose gel electrophoresis and gel cutting for recovery.

[0053] The pCAMBIA1305.4 vector was digested with BamH I using the NEB R3136 (NEB (Beijing) Co., Ltd. New England Biolabs (Beijing) LTD.) kit and recovered from the gel using the DC301 kit (gel recovery kit);

[0054] Homologous recombination kit Novozyme C112 ( IIOne Step Cloning Kit was used to insert the CsDRM2 gene sequence shown in the gel recovery product SEQ ID No.1 into the BamHI restriction site of the pCAMBIA1305.4 vector to obtain the pCAMBIA1305.4-CsDRM2 recombinant overexpression vector ( Figure 2 ), the specific operation is to prepare a 20μL system: CsDRM2 gel recovery fragment 2μL, vector pCAMBIA1305.44μL, homologous recombinase 2μL, buffer 2μL, ddH2O to 20μL; PCR reaction program 37℃30min, then store on ice or 4℃.

[0055] The recombinant vector was transformed into Escherichia coli DH5α, and the positive single colony was sequenced using the sequencing primer 1305-Seq-F (SEQ ID NO. 7): GTCACTTTATTGTGAAGATAGTGGA;

[0056] The recombinant plasmid pCAMBIA1305.4-CsDRM2 was extracted from the correctly sequenced bacterial liquid and transformed into Agrobacterium EHA105. After picking the bacteria, CsDRM2-F and CsDRM2-R primers were used for PCR positive detection. The positive colonies with consistent bands were propagated in bacterial liquid and stored at -80℃ for later use.

[0057] (3) Construction of CsDRM2 overexpression strain

[0058] 1) Infection

[0059] The cucumber germplasm "9930" seeds were sown on SGM sowing medium and cultured in the dark at 28°C for 36 hours; the seeds were infected with the above-mentioned sequencing consistent positive Agrobacterium solution, and the solution OD was 0.2-0.3; the seeds cultured in the dark were added to the Agrobacterium solution and cultured in the dark at 25°C on IM co-culture medium for 3-4 days;

[0060] 2) Screening of the transgenic culture medium and the overexpression strains for self-pollination generation T1

[0061] The germinated plants in the above steps were subjected to fluorescence screening and detection, and the fluorescent buds were transferred to 1M SRM differentiation medium and RM rooting medium, with a temperature of 24.5°C, a humidity of 62%, a light intensity of 6500Lux, and cultured for 16 hours of light and 8 hours of darkness. When the number of roots was about 12-15, they were transplanted to the soil and grown into cucumber plants, and PCR identification was performed after the growth of tender leaves.

[0062] The primers for identification were the vector antibiotic gene AADA, and the primers for PCR amplification were:

[0063] AADA_F(SEQ ID NO.8):TCCGACATCGATCTCCTGGT;

[0064] AADA_R (SEQ ID NO. 9): CAGGGTGAGGACCACATTCC.

[0065] The stripes are the resistant transgenic plants T0. The transgenic cucumbers were grown and self-pollinated until harvesting and seed preservation, and the T1 generation was obtained, and finally the CsDRM2 gene overexpression materials DRM2-OE-1 and DRM2-OE-2 were obtained.

[0066] Example 2

[0067] In Example 2 of the present invention, the Agrobacterium constructed in Example 1 was used to infect the cotyledonary nodes of the cucumber inbred line '9930', and regeneration shoots and rooting culture were induced by conventional methods to obtain tissue culture seedlings.

[0068] The primers shown in SEQ ID NO.8 and SEQ ID NO.9 were used for identification to obtain the CsDRM2 gene overexpression material DRM2-OE.

[0069] Test Example 1

[0070] In Test Example 1 of the present invention, wild-type cucumber (WT) was used as a control to detect the CsDRM2 expression levels of the CsDRM2 gene overexpression materials DRM2-OE-1 and DRM2-OE-2 prepared in Example 1. The specific steps are as follows:

[0071] (1) The expression level of the CsDRM2 gene after overexpression was explored by fluorescence quantitative PCR technology, and fluorescence quantitative PCR primers were designed based on the exon region of the CsDRM2 gene:

[0072] Forward primer—SEQ ID NO. 10: 5′-CTGGTGACGATTTTGGTGTTG-3′;

[0073] Reverse Primer—SEQ ID NO. 11: 5′-GATGAGCTTGCCATATTTGCC-3′.

[0074] Design of internal reference primers based on Actin gene:

[0075] Forward primer—SEQ ID NO. 12: 5′-GCTGGATTCTGGTGATGGTG-3′;

[0076] Reverse primer—SEQ ID NO. 13: 5'-AGCAAGGTCCAAACGGAGAA-3'.

[0077] Using SYBR Premix Ex Taq (Takara) and fluorescent quantitative PCR instrument q225 (CoolBio), according to the manufacturer's instructions for PCR system and program, fluorescent quantitative PCR was performed to obtain the cycle number that reached the fluorescence threshold. The results are shown in Figure 3 shown.

[0078] Figure 3 The relative expression level after overexpression of the CsDRM2 gene was calculated to be 4 times that of the WT. The results showed that the CsDRM2 gene level in the overexpression strain was significantly higher than that in the WT plant.

[0079] (4) Wild-type cucumber fruits were picked at different times after pollination to detect the transcription data of CsDRM2. The results are as follows Figure 1 As shown, P0, P6, P12, P18, P24, and P30 represent 0, 6, 12, 18, 24, and 30 days after pollination, respectively.

[0080] Test Example 2

[0081] In Experimental Example 2 of the present invention, wild-type cucumber (CK) was used as a control to detect the phenotype of cucumber fruit after field pollination. The specific steps are as follows:

[0082] (1) The DRM2-OE tissue culture seedlings obtained in Example 2 were planted together with the wild type in the same field, pollinated during the flowering period, and the fruit phenotypes of cucumbers after field pollination were observed. The results were as follows: Figure 4 shown.

[0083] Figure 4The results showed that the peel color changes of wild-type and transgenic cucumbers (DRM2-OE) at 4, 7, 10, and 14 days after field pollination showed that compared with the wild type, the peel color of the transgenic cucumber changed from yellow to green in the early stages of development.

[0084] Test Example 3

[0085] In Experimental Example 3 of the present invention, wild-type cucumber (WT) was used as a control to detect the cucumber phenotypes of the CsDRM2 gene overexpression materials DRM2-OE-1 and DRM2-OE-2 prepared in Example 1, and the specific steps were as follows:

[0086] (1) Phenotypic detection of cucumber after pollination

[0087] The phenotype of cucumber fruit after field pollination was tested. Figure 5 shown.

[0088] Depend on Figure 5 It can be seen that the difference in peel color between wild-type and transgenic cucumbers does not affect the changes in melon length and diameter in the later stage, and there is no significant difference between the two. This shows that the CsDRM2 gene regulates the peel color in the early stage of fruit development, but does not affect the length and diameter of the fruit.

[0089] (2) At the early stage of cucumber fruit development, the color changes of the fruit peel were detected, and the brightness (L), saturation (C), and hue (H) values ​​of the cucumber fruit skin were measured using a portable colorimeter. To ensure the accuracy of phenotypic collection, 40 independent repeated measurements were performed. The results are as follows: Figure 6 shown.

[0090] Figure 6 The results showed that compared with the wild type, there were no significant differences in L and H values ​​of transgenic cucumbers (DRM2-OE-1 and DRM2-OE-2) at the early stage of fruit development, but the C value showed significant differences, indicating that Figure 4 The transgenic cucumber fruit showed a yellow-green gradient compared with the wild type in the early stage of development, indicating that the CsDRM2 gene is involved in regulating the skin color in the early stage of fruit development.

[0091] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A CsDRM2 gene for regulating cucumber peel color, characterized in that: The nucleotide sequence of the cucumber CsDRM2 gene is shown in SEQ ID NO.

1.

2. A protein encoded by the CsDRM2 gene for regulating cucumber peel color according to claim 1, characterized in that: The amino acid sequence of the protein encoded by the CsDRM2 gene is shown in SEQ ID NO.

2.

3. A primer set for amplifying the CsDRM2 gene encoding the cucumber peel color regulator according to claim 1, characterized in that: By the following sequence composition: CsDRM2-F-SEQ ID NO.3: 5'-ATGGGGATATTTGTAGCTGGTGA-3'; CsDRM2-R-SEQ ID NO.4: 5'-TTCAGTTTTGGTGGCTATACACTTG-3'.

4. Use of the CsDRM2 gene for regulating cucumber peel color according to claim 1 or the protein encoded by the CsDRM2 gene for regulating cucumber peel color according to claim 2 in regulating cucumber peel color.

5. Use of the CsDRM2 gene for regulating cucumber peel color or the protein encoded by the CsDRM2 gene for regulating cucumber peel color according to claim 4 in regulating cucumber peel color, characterized in that: The CsDRM2 gene or its encoded protein for regulating the cucumber peel color can regulate the process in which the cucumber peel color changes from yellow to green.

6. Use of the CsDRM2 gene for regulating cucumber peel color according to claim 1 or the protein encoded by the CsDRM2 gene for regulating cucumber peel color according to claim 2 in cucumber peel mutant breeding.

7. Use of the CsDRM2 gene for regulating cucumber peel color according to claim 1 or the protein encoded by the CsDRM2 gene for regulating cucumber peel color according to claim 2 in early identification of cucumber peel color.

Images