Method for constructing male sterile line of cotton bollworm and related transformation event

Abstract

The invention relates to a method for constructing a cotton bollworm male sterile line and a related transformation event. The invention discloses a method for constructing a cotton bollworm male sterile line. After cotton bollworms containing a Chr16-Vasa-Cas9 transformation event and cotton bollworms containing a Chr5-U6-S2sgRNA transformation event are hybridized to obtain hybrid F1-generation cotton bollworms co-expressing Cas9 and sgRNA, the cotton bollworms show male sterility phenotypes and have no other fitness cost, namely the mating success rate, the mating time and the egg laying amount of the cotton bollworms are not remarkably changed. On one hand, two preferable transformation events are provided for constructing a cotton bollworm male sterile line, and a solid foundation is laid for developing a green and environment-friendly cotton bollworm efficient control strategy without resistance risk; meanwhile, the invention provides a method for carrying out molecular identification on the two transformation events, and an important scientific basis is provided for carrying out identity identification on the transformation events and tracing and supervising the transgenic cotton bollworm.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to flanking sequences and molecular identification of two cotton bollworm transformation events Chr16-Vasa-Cas9 and Chr5-U6-S2sgRNA and a method for using the flanking sequences and the sgRNA to construct a cotton bollworm male sterile line. Technical Background

[0002] The cotton bollworm belongs to the family Noctuidae of the order Lepidoptera. It has a wide range of hosts, including economic and food crops such as cotton, corn, soybeans and peanuts. It also has the characteristics of strong reproductive capacity, long migration distance and facultative diapause, and is one of the important pests that endanger my country's agricultural production safety. At present, the control of cotton bollworm in the field mainly relies on the planting of Bt transgenic insect-resistant cotton and the use of chemical pesticides. However, the evolution of cotton bollworm's resistance to existing control measures has significantly weakened the effectiveness of these methods, posing an increasingly severe challenge to agricultural production safety. Therefore, it is urgent to propose new cotton bollworm control strategies and develop new control methods. These strategies and methods should not only be able to overcome its resistance problem, but also be able to achieve long-term and efficient control of pests to ensure the green, healthy and sustainable development of agricultural production.

[0003] The insect sterile technology has shown great potential in the field of pest control due to its advantages such as no pollution, no resistance risk, long-lasting control effect and strong specificity, and provides a new solution for the control of cotton bollworm in the field. The use of transgenic technology to construct insect sterile lines is one of the most promising methods in the current research of insect sterile technology. This strategy integrates the exogenous gene Cas9 gene and the sgRNA sequence targeting the key gene for male reproductive regulation into the insect genome. After the transgenic insects express Cas9 and sgRNA in vivo, the two will combine to form a ribonucleoprotein complex, in which sgRNA guides the Cas9 protein to the target site of the key gene for male reproductive regulation through a specific sequence matching mechanism, and knocks out these genes to make them lose their function, thereby producing insects with male sterility traits.

[0004] In the process of constructing insect sterile lines using transgenic technology, different transformation events are involved, that is, events in which foreign genes are inserted and integrated into specific sites on the insect genome. The core of these transformation events is to obtain the unique identity of the transformation event by identifying the genomic sequence of the insect itself at the specific insertion site, that is, the flanking sequence. Different transformation events may have different effects on insects, causing them to show unexpected phenotypes. On the one hand, the expression of foreign genes may differ due to the different insertion positions of foreign sequences, which is called "position effect"; on the other hand, the insertion of foreign genes may cause the endogenous gene structure of insects to be destroyed, thereby causing insects to show fitness costs (Huang Y, Liu Z, Rong YS. Genome Editing: From Drosophila to Non-Model Insects and Beyond. J Genet Genomics. 2016; 43 (5): 263-272), causing other physiological functions of transgenic insects to change. Therefore, a successful transgenic transformation event must overcome the above two effects and ultimately obtain the expected trait expression. Constructing insect male sterile lines by utilizing transformation events with obvious male sterility traits and low fitness costs is an effective means of genetic control of agricultural pests. However, no related transformation events have been reported for cotton bollworm, a major agricultural pest. Summary of the invention

[0005] The purpose of the present invention is to use transgenic technology to obtain a specific transformation event for constructing a male sterile line of cotton bollworm, clarify the flanking sequences of the relevant transformation events, and provide a method for molecular identification of these flanking sequences. The cotton bollworm transformation event contains Chr16-Vasa-Cas9 and Chr5-U6-S2sgRNA. The Chr16-Vasa-Cas9 transformation event expresses the Cas9 protein gene, and uses the EGFP gene as a screening marker for transgenic positive individuals; the Chr5-U6-S2sgRNA transformation event expresses an sgRNA sequence, which targets the key gene HaSer2 for male reproductive regulation of cotton bollworm, and uses mCherry as a screening marker for transgenic positive individuals. By detecting the flanking sequences of the two cotton bollworm transformation events and designing specific primers based on these flanking sequences, the present invention can quickly and accurately identify whether the cotton bollworm individual contains Chr16-Vasa-Cas9 and Chr5-U6-S2sgRNA transformation events. By hybridizing a cotton bollworm containing a Chr16-Vasa-Cas9 transformation event with a cotton bollworm containing a Chr5-U6-S2sgRNA transformation event, the HaSer2 gene in the hybrid F1 generation cotton bollworm can be mutated, thereby causing the cotton bollworm to exhibit male sterility traits, thereby obtaining a cotton bollworm male sterile line. The present invention can provide two preferred transformation events, Chr16-Vasa-Cas9 and Chr5-U6-S2sgRNA, for constructing a male sterile line in cotton bollworm and developing an efficient cotton bollworm control strategy, and provides a method for molecular identification of the two transformation events, which can provide an important scientific basis for identification, tracing and supervision thereof.

[0006] In order to achieve the above object, the present invention mainly includes the following aspects:

[0007] In the first aspect, the present invention provides an exogenous gene and flanking sequence (attached) of Chr16-Vasa-Cas9, a transformation event of cotton bollworm Figure 1 ). The flanking sequence is shown in SEQ ID NO.1; the exogenous gene sequence is shown in SEQ ID NO.2.

[0008] In a second aspect, the present invention provides a primer pair for detecting the above-mentioned cotton bollworm transformation event Chr16-Vasa-Cas9, wherein the primer pair consists of a first primer that specifically matches the above-mentioned flanking sequence and a second primer that matches the exogenous gene.

[0009] Furthermore, the first primer sequence is shown as SEQ ID NO.3, and the second primer sequence is shown as SEQ ID NO.4.

[0010] In a third aspect, the present invention provides a method for identifying whether an individual cotton bollworm has the above-mentioned transformation event, comprising: (1) extracting genomic DNA of cotton bollworm; (2) using the genomic DNA as a template and using the above-mentioned primer pair (SEQ ID NO.3 and SEQ ID NO.4) to perform PCR amplification; (3) detecting the PCR amplification product by agarose gel electrophoresis, and if the size of the detected electrophoresis band is consistent with the size of the nucleic acid sequence between the primer pair, it indicates that the cotton bollworm individual has the Chr16-Vasa-Cas9 transformation event.

[0011] In a fourth aspect, the present invention provides flanking sequences and exogenous genes (attached) of Chr5-U6-S2sgRNA of cotton bollworm transformation event Figure 2 ). The flanking region sequence is shown in SEQ ID NO.5; the exogenous gene sequence is shown in SEQ ID NO.6.

[0012] In a fifth aspect, the present invention provides a primer pair for detecting the above-mentioned cotton bollworm transformation event Chr5-U6-S2sgRNA, wherein the primer pair consists of a first primer that specifically matches the above-mentioned flanking sequence and a second primer that matches the exogenous gene.

[0013] Furthermore, the first primer sequence is shown as SEQ ID NO.7, and the second primer sequence is shown as SEQ ID NO.8.

[0014] In a sixth aspect, the present invention provides a method for identifying whether an individual cotton bollworm has the above-mentioned transformation event, comprising: (1) extracting genomic DNA of cotton bollworm; (2) using the genomic DNA as a template and using the above-mentioned primer pair (SEQ ID NO.7 and SEQ ID NO.8) to perform PCR amplification; (3) detecting the PCR amplification product by agarose gel electrophoresis, and if the size of the detected electrophoresis band is consistent with the size of the nucleic acid sequence between the primer pair, it indicates that the cotton bollworm individual has the Chr5-U6-S2sgRNA transformation event.

[0015] In a seventh aspect, the present invention provides a method for constructing a male sterile line of cotton bollworm using a Chr16-Vasa-Cas9 transformation event and a Chr5-U6-S2sgRNA transformation event, wherein the cotton bollworm containing the Chr16-Vasa-Cas9 transformation event is hybridized with the cotton bollworm containing the Chr5-U6-S2sgRNA transformation event, and the HaSer2 gene in the hybridized cotton bollworm F1 generation individual is knocked out by a ribonucleoprotein complex formed by the Cas9 gene and the sgRNA (see Appendix). Figure 3 ), causing the cotton bollworm to show male sterility, that is, all eggs cannot develop normally (attached Figure 4), while the mating success rate, mating time and egg-laying amount did not change significantly (Table 1), indicating that the Chr16-Vasa-Cas9 transformation event and the Chr5-U6-S2sgRNA transformation event were the preferred transformation events for constructing the male sterile line of cotton bollworm.

[0016] In an eighth aspect, the present invention provides a piggyBac transgenic plasmid that uses the cotton bollworm Vasa promoter to drive Cas9 expression, which is obtained by recombining the Vasa-Cas9 fusion fragment into a linearized piggyBac plasmid.

[0017] In a ninth aspect, the present invention provides a piggyBac transgenic plasmid targeting HaSer2 gene sgRNA, which is obtained by homologously recombining the Hr5IE1-mCherry fragment, the first sgRNA expression cassette fragment and the second sgRNA expression cassette fragment into a linearized piggyBac plasmid without an EGFP expression cassette and a Cas9 expression cassette, wherein the first sgRNA expression cassette fragment is a HaU6 promoter-sgRNA1 fusion fragment, and the sgRNA1 of the HaSer2 gene is shown in SEQ ID NO.9; the second sgRNA expression cassette fragment is a HaU6 promoter-sgRNA2 fusion fragment, and the sgRNA2 of the HaSer2 gene is shown in SEQ ID NO.10.

[0018] Beneficial Effects

[0019] The present invention provides two preferred cotton bollworm transformation events, Chr16-Vasa-Cas9 and Chr5-U6-S2sgRNA. By hybridizing cotton bollworms containing these two transgenic transformation events, cotton bollworms with male sterility traits can be obtained. Therefore, these two transformation events can be used to construct a cotton bollworm male sterile line.

[0020] Compared with the existing methods of controlling cotton bollworm by planting transgenic Bt insect-resistant cotton and using chemical pesticides, the advantages of using the cotton bollworm male sterile line constructed by the present invention to control cotton bollworm are: (1) The control effect is more significant and green and pollution-free: by continuously releasing dominant male sterile transgenic cotton bollworms, the present invention can effectively control the population of cotton bollworms in the field without relying on pesticides, thereby achieving efficient control of cotton bollworms; (2) No resistance risk: cotton bollworms with male sterile traits are constructed indoors by biotechnology means, which does not form selection pressure on cotton bollworms in the field, thereby avoiding the evolution of resistance of cotton bollworms.

[0021] By clarifying the flanking sequences of two cotton bollworm transformation events, Chr16-Vasa-Cas9 and Chr5-U6-S2sgRNA, and designing specific detection primers, the present invention has the following positive effects: (1) It provides a molecular identification method for accurately identifying these two cotton bollworm transformation events, providing a reliable technical means for the detection and identification of related transgenic cotton bollworms; (2) It helps to trace and supervise these two transgenic cotton bollworm events, and provides a scientific basis for promoting their application in the development of cotton bollworm control strategies and the formulation and implementation of relevant policies. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Schematic diagram of the Chr16-Vasa-Cas9 transformation event in cotton bollworm, including the flanking sequences and exogenous genes of the transformation event, as well as primers for molecular identification of the transformation event.

[0023] Figure 2 Schematic diagram of the Chr16-Vasa-Cas9 flanking sequence identification of the cotton bollworm transformation event. The use of specific detection primers can amplify the target band of approximately 800 bp of the transformation event.

[0024] Figure 3 Schematic diagram of the Chr5-U6-S2sgRNA transformation event of cotton bollworm, including the flanking sequences and exogenous genes of the transformation event and primers for molecular identification of the transformation event.

[0025] Figure 4 Schematic diagram of the identification of the Chr5-U6-S2sgRNA flanking sequence of the cotton bollworm transformation event. The use of specific detection primers can amplify the target band of approximately 611bp of this transformation event.

[0026] Figure 5 The cotton bollworm containing the Chr16-Vasa-Cas9 transformation event was hybridized with the cotton bollworm containing the Chr5-U6-S2sgRNA transformation event to obtain the hybrid F1 generation of cotton bollworms co-expressing Cas9 and sgRNA, in which the HaSer2 gene was knocked out.

[0027] Figure 6 The developmental status of the eggs laid by sterile males of cotton bollworm after mating with wild-type females is compared with the developmental status of the eggs laid by wild-type male and female groups after mating. After mating between male and female individuals of the background strain SCD, a clear yellow equatorial line can be observed on the surface of most of the eggs obtained, indicating that most of the eggs developed normally; all eggs obtained after mating between HaSer2 mutant males and SCD females had no yellow equatorial line on the surface, indicating that all eggs could not develop normally. DETAILED DESCRIPTION

[0028] Example 1 Flanking sequences and molecular identification methods of Chr16-Vasa-Cas9 in cotton bollworm transformation events

[0029] In order to obtain a specific cotton bollworm transformation event expressing Cas9, this example first constructed a piggyBac transgenic plasmid in which the cotton bollworm Vasa gene promoter drives Cas9 expression, and then used the piggyBac transposition system to introduce the plasmid into the cotton bollworm genome to obtain transgenic cotton bollworm expressing Cas9. The insertion site of the transgene was identified by using the inverse PCR technique, and the cotton bollworm transformation event Chr16-Vasa-Cas9 with the exogenous gene located on chromosome 16 was obtained. Based on the sequence information of the transformation event, the corresponding specific primers were designed, and it was confirmed that these specific primers can be used to identify the molecular characteristics of the cotton bollworm transformation event Chr16-Vasa-Cas9. The specific steps are as follows:

[0030] 1. Amplification of the promoter sequence of the Vasa gene of cotton bollworm

[0031] Using the genomic DNA of cotton bollworm as a template, the promoter sequence of the HaVasa gene was amplified with primers containing homology arms, wherein the upstream primer F1 sequence was 5'-TATAGGGCGAATTGGGTACCGCGATCGCCAAGAGGACGCCAACAGAG-3', and the downstream primer R1 sequence was 5'-TCTTGTCCATGCTAGCTGTCTGAAACAGAAACACA-3', and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.; PCR was completed in a 0.2mL PCR tube with a total reaction volume of 50μL to amplify the target fragment:

[0032]

[0033] The PCR reaction procedure was as follows: first, pre-denaturation at 94°C for 3 min; then, 35 cycles of amplification: denaturation at 94°C for 15 s, annealing at 65°C for 15 s, extension at 72°C for 1 min; and finally, extension at 72°C for 10 min.

[0034] Electrophoresis detection of PCR products and gel excision recovery: Add 10 μL Loading Buffer to the enzyme digestion product, add all PCR products to 1% agarose gel for electrophoresis detection, if there is a single bright band of about 1890 bp, it means that the Vasa gene promoter sequence is successfully amplified, cut the band and perform gel recovery. The gel recovery step uses the FastPureGel DNA Extraction Mini Kit from Nanjing Novozymes.

[0035] 2. Construction of piggyBac transgenic plasmid driven by Vasa promoter for Cas9 expression:

[0036] 2.1 Amplification of Cas9 ORF sequence

[0037] Using piggyBac background plasmid pBac[IE1-EGFP-IE1-Cas9-SV40] DNA as a template (Liu Qun. Functional study of silkworm olfactory-related genes [D]. Supervisor: Hao Dejun; Huang Yongping. Nanjing Forestry University, 2019.), the ORF of the Cas9 gene was amplified using primers containing homology arms, where the upstream primer F2 sequence was 5'-GACAGCTAGCATGGACAAGAAGTACTCCATTGGG-3', and the downstream primer R2 sequence was 5'-TATGATCTAGAGTCGGGCCCCCGCGGTCACACCTTCCT-3', and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.; PCR was completed in a 0.2mL PCR tube with a total reaction volume of 50μL to amplify the target fragment:

[0038]

[0039] The PCR reaction procedure was as follows: first, pre-denaturation at 94°C for 3 min; then, 35 cycles of amplification: denaturation at 94°C for 15 s, annealing at 65°C for 15 s, extension at 72°C for 2 min; and finally, extension at 72°C for 10 min.

[0040] Electrophoresis detection of PCR products and gel excision recovery: Add 10 μL Loading Buffer to the enzyme digestion product, add all PCR products to 1% agarose gel for electrophoresis detection, and detect a single bright 4140 bp band, indicating that the ORF sequence of the Cas9 gene has been successfully amplified. Cut the band and perform gel recovery. The gel recovery step uses the FastPure Gel DNA Extraction Mini Kit from Nanjing Novozymes.

[0041] 2.2 Amplification of Vasa-Cas9 fusion fragment

[0042] Using the Vasa gene promoter sequence and the Cas9 ORF sequence as templates, the above-mentioned F1 and R2 primers were used for fusion PCR reaction. The PCR was completed in a 0.2 mL PCR tube with a total reaction volume of 50 μL to amplify the target fragment:

[0043]

[0044]

[0045] The PCR reaction procedure was as follows: first, pre-denaturation at 94°C for 3 min; then, 35 cycles of amplification: denaturation at 94°C for 15 s, annealing at 65°C for 15 s, extension at 72°C for 3 min; and finally, extension at 72°C for 10 min.

[0046] Electrophoresis detection of PCR products and gel excision recovery: Add 10 μL Loading Buffer to the PCR products, add all PCR products to 1% agarose gel for electrophoresis detection. If there is a single bright band of about 6000 bp, it means that the Vasa-Cas9 fusion fragment sequence is successfully amplified. Cut the band and perform gel recovery. The gel recovery step uses the FastPure Gel DNA Extraction Mini Kit from Nanjing Novozymes.

[0047] 2.3 PCR amplification of piggyBac background plasmid

[0048] Using piggyBac background plasmid pBac[IE1-EGFP-IE1-Cas9-SV40] (Liu Qun. Functional study of silkworm olfactory-related genes [D]. Supervisor: Hao Dejun; Huang Yongping. Nanjing Forestry University, 2019.) DNA as a template, a linearized piggyBac plasmid without IE1-Cas9 sequence was amplified with primers containing homology arms, wherein the upstream primer F3 sequence was 5'-GGGCCCGACTCTAGATCATAATC-3', and the downstream primer R3 sequence was 5'-GGTACCCAATTCGCCCTATAGTG-3', and the primers were synthesized by Beijing Qingke Biotechnology Co., Ltd.; PCR was completed in a 0.2mL PCR tube with a total reaction volume of 50μL to amplify the target fragment:

[0049]

[0050] The PCR reaction procedure was as follows: first, pre-denaturation at 94°C for 3 min; then, 35 cycles of amplification: denaturation at 94°C for 15 s, annealing at 65°C for 15 s, extension at 72°C for 4 min; and finally, extension at 72°C for 10 min.

[0051] Electrophoresis detection of PCR products and gel excision recovery: Add 10 μL Loading Buffer to the enzyme digestion product, add all PCR products to 1% agarose gel for electrophoresis detection. If there is a single bright band of about 6500 bp, it means that the linearized piggyBac plasmid without IE1-Cas9 sequence is amplified successfully. Cut the band and perform gel recovery. The gel recovery step uses the FastPure Gel DNA Extraction Mini Kit from Nanjing Novozymes.

[0052] 2.4 The Vasa-Cas9 fusion fragment was recombined into the linearized piggyBac plasmid to construct a piggyBac transgenic plasmid in which the Vasa gene promoter drives the expression of Cas9. The homologous recombination reaction system was as follows (using the OneStep Cloning Kit of Nanjing Novogene):

[0053]

[0054] The reaction temperature was 37°C and the reaction time was 30 min. Then, the recombinant product was transformed into 100 μL TranS1-T1 E. coli competent cells, gently mixed, and placed on ice for 30 min. After the ice bath, the EP tube was placed in a 42°C heat shock for 45 s, and then quickly placed on ice for 2 min. In the clean bench, 950 μL of LB liquid culture medium was added to the EP tube and placed in a 37°C shaker at 150 rpm for 2 h. After shaking the bacteria, 100 μL of the bacterial solution was aspirated and applied to the LBAmp + Solid plate, after evenly coating, place the plate in a 37°C incubator for overnight culture. Pick a single plaque of suitable size on the plate and add 950 μL LB Amp + The culture medium was shaken at 250 rpm at 37°C for 12 h, and then expanded to 100 mL at a ratio of 1:100.

[0055] 2.5 Extraction of piggyBac transgenic plasmid using Thermo Fisher PureLink TM HiPure Plasmid Midi Kit.

[0056] 3. Obtaining the transformation event Chr16-Vasa-Cas9 in cotton bollworm

[0057] First, collect fresh eggs of cotton bollworm within 1 hour, clean and disinfect them with 0.1% 84 disinfectant, collect the eggs on filter paper through a Buchner funnel, and then arrange them neatly and fix them on a glass slide with double-sided tape. Mix the piggyBac transposase mRNA and the piggyBac transgenic plasmid driven by the Vasa promoter to express Cas9 and dilute them to 400ng / μL. Use Eppendorf's FemtoJet and InjectMan NI 2microinjection system to inject the above mixed solution into the fresh eggs of cotton bollworm. After hatching, transfer them to artificial feed to obtain G0 generation transgenic cotton bollworm. The preparation method of the piggyBac transposase mRNA can be found in the patent "A system for verifying the biological function of a target gene in cotton bollworm and its application" (patent application number CN202311563451, Wu Yidong et al., 2023)

[0058] The G1 generation was obtained by mating the G0 generation transgenic cotton bollworm adult group, and all the newly hatched larvae of the G1 generation were concentrated in a culture dish, and EGFP-positive fluorescent individuals were screened using a Nikon SMZ25 fluorescence microscope. The obtained positive fluorescent individuals were raised to adults and then mated with the cotton bollworm background strain SCD to expand the population. According to the identification method of the exogenous gene insertion site reported by Li et al. (Li L, Zuo Y, Shi Y, Yang Y, Wu Y. Overexpression of the F116V allele of CYP9A 186 in transgenic Helicoverpa armigera confers high-level resistance to emamectinbenzoate. Insect Biochem Mol Biol. 2023; 163: 104042.), it was detected that the exogenous gene in the transgenic cotton bollworm was located between the 4,267,442 and 4,267,443 bases of chromosome 16 of the genome, thereby obtaining the cotton bollworm transformation event Chr16-Vasa-Cas9.

[0059] 4. Design of flanking sequences and specific primers for Chr16-Vasa-Cas9 in cotton bollworm transformation event

[0060] The flanking sequence of the cotton bollworm transformation event Chr16-Vasa-Cas9 is located downstream of base 4,267,443 of chromosome 16 of the cotton bollworm genome, and the sequence of 500 bp downstream is shown in SEQ ID NO. 1. Based on the flanking sequence and the sequence of the exogenous gene, specific primers were designed to identify the molecular characteristics of the cotton bollworm transformation event Chr16-Vasa-Cas9, wherein the first primer matches the flanking sequence, and the sequence information is shown in SEQ ID NO. 3, and the second primer matches the exogenous gene, and the sequence information is shown in SEQ ID NO. 4. This primer pair can be expected to amplify a target band of about 800 bp.

[0061] 5. Identification of molecular characteristics of Chr16-Vasa-Cas9 transformation event in cotton bollworm

[0062] The FastPure Cell / Tissue DNA Isolation Mini Kit (Nanjing Novozyme) was used to extract the genomic DNA of the background strain SCD and the cotton bollworm containing the Chr16-Vasa-Cas9 transformation event.

[0063] The genomic DNA of cotton bollworm containing Chr16-Vasa-Cas9 transformation event was used as template, SEQ ID NO.3 was used as upstream primer, SEQ ID NO.4 was used as downstream primer, and 2x Taq Master Mix (Nanjing Novozyme) was used for PCR amplification. The system was as follows:

[0064]

[0065] PCR reaction conditions: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 20 s, annealing at 60°C for 20 s, extension at 72°C for 30 s, 32 cycles; extension at 72°C for 5 min.

[0066] The PCR products were then separated by 1.2% agarose gel electrophoresis, and a 2000 bp DNA marker was used as a control. Figure 2 As shown, the genomic DNA of cotton bollworm containing the Chr16-Vasa-Cas9 transformation event can amplify the expected target band of about 800 bp, indicating that this pair of specific primers can be used to accurately identify the molecular characteristics of the flanking sequences of the Chr16-Vasa-Cas9 transformation event.

[0067] Example 2 Flanking sequences and molecular identification methods of Chr5-U6-S2sgRNA in cotton bollworm transformation events

[0068] In lepidopteran insects such as silkworms, the serine protease 2 gene is a key gene for male sperm development, and mutations in this gene can lead to male sterility. In order to obtain a specific cotton bollworm transformation event expressing sgRNA targeting the cotton bollworm serine protease 2 gene (HaSer2), this example first constructed a piggyBac transgenic plasmid driven by the cotton bollworm U6 promoter to express sgRNA, and then used the piggyBac transposition system to introduce the plasmid into the cotton bollworm genome to obtain transgenic cotton bollworm expressing sgRNA targeting the HaSer2 gene. By using the inverse PCR technology to identify the insertion site of the transgene, the cotton bollworm transformation event Chr5-U6-S2sgRNA with the exogenous gene located on chromosome 31 was obtained, and the corresponding specific primers were designed based on the sequence information of the transformation event, and it was confirmed that these specific primers can be used to identify the molecular characteristics of the cotton bollworm transformation event Chr5-U6-S2sgRNA. The specific steps are as follows:

[0069] 1. Amplify Hr5IE1-mCherry fusion fragment

[0070] First, F4 / R4 (F4 sequence is 5'-TTGGGTCGGTACCTCACTTGTACAGTTCGTCCATGCCACC-3', downstream primer R4 sequence is 5'-CAAGAGACGTCATGGTGTCCAAGGGAGAGG-3') and F5 / R5 (F5 sequence is 5'-GGACACCATGACGTCTCTTGTCGCCGCCAGTGTCAACTTG-3', downstream primer R5 sequence is 5'-CATAATTTGC GGCCGCCATTGCTTGTCATTTATTAATTTGGATG-3') were used as templates to amplify mCherry and Hr5IE1 fragments using synthetic mCherry DNA (GenBank: MZ027319.1) and piggyBac background plasmid pBac[IE1-EGFP-IE1-Cas9-SV40] (Liu Qun. Functional study of olfactory-related genes in silkworms [D]. Supervisor: Hao Dejun; Huang Yongping. Nanjing Forestry University, 2019.) DNA. Both PCR reactions were completed in 0.2mL PCR tubes, with a total reaction volume of 50μL:

[0071]

[0072] The PCR reaction procedure was as follows: first, pre-denaturation at 94°C for 3 min; then, 35 cycles of amplification: denaturation at 94°C for 15 s, annealing at 65°C for 15 s, extension at 72°C for 1 min; and finally, extension at 72°C for 10 min.

[0073] Electrophoresis detection of PCR products and gel excision recovery: Add 10 μL Loading Buffer to the enzyme digestion product, add all PCR products to 1% agarose gel for electrophoresis detection, and detect the mCherry fragment band of about 720 bp and the Hr5-IE1 band of about 1258 bp, indicating that both fragments were successfully amplified, and gel excision and gel recovery were performed. The gel recovery step uses the FastPure Gel DNA Extraction Mini Kit from Nanjing Novozymes.

[0074] Then, the DNA fragments of mCherry and Hr5-IE1 were used as templates and the above-mentioned F5 / R4 primers were used for PCR to amplify the Hr5IE1-mCherry fusion fragment. The PCR reaction was completed in a 0.2 mL PCR tube, and the total reaction volume was 50 μL:

[0075]

[0076]

[0077] The PCR reaction procedure was as follows: first, pre-denaturation at 94°C for 3 min; then, 35 cycles of amplification: denaturation at 94°C for 15 s, annealing at 65°C for 15 s, extension at 72°C for 2 min; and finally, extension at 72°C for 10 min.

[0078] Electrophoresis detection of PCR products and gel excision recovery: Add 10 μL Loading Buffer to the enzyme digestion product, add all PCR products to 1% agarose gel for electrophoresis detection, and detect the Hr5IE1-mCherry fragment band of about 1975 bp, indicating that the fusion fragment was successfully amplified, and the gel was excised and recovered. The gel recovery step uses the FastPureGel DNA Extraction Mini Kit from Nanjing Novozymes.

[0079] 2. Fusion PCR amplification of the first sgRNA expression cassette

[0080] First, according to the GGN18NGG rule, the first target of the HaSer2 gene was screened, GGACCCAAGTTGCACTGCGG AGG (SEQ ID NO.9, the underline is the PAM sequence), followed by the use of F6 / R6 (upstream primer F6 sequence is 5'-CAAGCAATGGCGGCCGCAAATTATGTATTTAAAACAAAGGTTTATTTTATTCGTG-3', downstream primer R6 sequence is 5'-CCGCAGTGCAACTTGGGTCCACTTGCAGGGAACGAAA-3') and F7 / R7 (F7 sequence is 5'-GGACCCAAGTTGCACTGCGGGTTTTAGAGCTAGAAATAGCAAG-3', downstream primer R7 sequence is 5'-GGCCCCTCATCAATGTATCTTAACGCGAG-3') using the genomic DNA of the SCD strain of cotton bollworm and the DNA template of gRNA as templates (the DNA template of gRNA is derived from the published article Jiang D, Yu Z, He Y, et al. Key role of theryanodine receptor I4790K mutation in mediating diamide resistance in Plutella xylostella.2024.Insect Biochem Mol Biol.), PCR was used to obtain the HaU6 promoter fragment and sgRNA scaffold sequence. Both PCR reactions were completed in 0.2 mL PCR tubes, with a total reaction volume of 50 μL:

[0081]

[0082]

[0083] The PCR reaction procedure was as follows: first, pre-denaturation at 94°C for 3 min; then, 35 cycles of amplification: denaturation at 94°C for 15 s, annealing at 65°C for 15 s, extension at 72°C for 1 min; and finally, extension at 72°C for 10 min.

[0084] Electrophoresis detection of PCR products and gel excision recovery: Add 10 μL Loading Buffer to the enzyme digestion product, add all PCR products to 1% agarose gel for electrophoresis detection, and detect the HaU6 band of about 620 bp and the sgRNAscaffold band of about 80 bp, indicating that both fragments were successfully amplified, and gel excision and gel recovery were performed separately. The gel recovery step uses the FastPure Gel DNA Extraction Mini Kit from Nanjing Novozymes.

[0085] Then, using the HaU6 fragment and sgRNA fragment as templates, the HaU6-sgRNA1 fragment was amplified using primers F6 / R7. The PCR reaction was completed in a 0.2mL PCR tube, and the total reaction volume was 50μL:

[0086]

[0087] The PCR reaction procedure was as follows: first, pre-denaturation at 94°C for 3 min; then, 35 cycles of amplification: denaturation at 94°C for 15 s, annealing at 65°C for 15 s, extension at 72°C for 1 min; and finally, extension at 72°C for 10 min.

[0088] Electrophoresis detection of PCR products and gel excision recovery: Add 10 μL Loading Buffer to the enzyme digestion product, add all PCR products to 1% agarose gel for electrophoresis detection, and detect a band of about 720 bp, indicating that the HaU6-sgRNA1 fusion fragment was successfully amplified. Gel excision and gel recovery were performed to obtain the first sgRNA expression cassette sequence. The gel recovery step uses the FastPure Gel DNA Extraction Mini Kit from Nanjing Novozymes.

[0089] 3. Fusion PCR amplification of the second sgRNA expression cassette

[0090] First, according to the GGN18NGG rule, the second target site of the HaSer2 gene was screened: GGATGGGGCAAAACAAGACA AGG(SEQ ID NO.10, underlined is the PAM sequence), then F8 / R8 (F8 sequence is 5'-AGATACATTGATGAGGGGCCCAAATTATGTATTTAAAACAAAGGTTTATTTTATT-3', downstream primer R8 sequence is 5'-TGTCTTGTTTTGCCCCATCCACTTGCAGGGAACGAAAT-3') and F9 / R9 (F9 sequence is 5'-GGATGGGGCAAAACAAGACAGTTTTAGAGCTAGAAATAGCAAG-3', downstream primer R9 sequence is 5'-ATAGATATCAAGCTTGGGCCCAAAAAAAGCACCGACTCGGTG-3') were used as templates to obtain the HaU6 promoter fragment and sgRNA scaffold sequence. Both PCR reactions were completed in 0.2mL PCR tubes, and the total reaction volume was 50μL:

[0091]

[0092] The PCR reaction procedure was as follows: first, pre-denaturation at 94°C for 3 min; then, 35 cycles of amplification: denaturation at 94°C for 15 s, annealing at 65°C for 15 s, extension at 72°C for 1 min; and finally, extension at 72°C for 10 min.

[0093] Electrophoresis detection of PCR products and gel excision recovery: Add 10 μL Loading Buffer to the enzyme digestion product, add all PCR products to 1% agarose gel for electrophoresis detection, and detect the HaU6 band of about 600 bp and the sgRNAscaffold band of about 80 bp, indicating that both fragments were successfully amplified, and gel excision and gel recovery were performed separately. The gel recovery step uses the FastPure Gel DNA Extraction Mini Kit from Nanjing Novozymes.

[0094] Then, using the HaU6 fragment and sgRNA fragment as templates, the HaU6-sgRNA2 fragment was amplified using primers F8 / R9. The PCR reaction was completed in a 0.2 mL PCR tube, and the total reaction volume was 50 μL:

[0095]

[0096] The PCR reaction procedure was as follows: first, pre-denaturation at 94°C for 3 min; then, 35 cycles of amplification: denaturation at 94°C for 15 s, annealing at 65°C for 15 s, extension at 72°C for 1 min; and finally, extension at 72°C for 10 min.

[0097] Electrophoresis detection of PCR products and gel excision recovery: Add 10 μL Loading Buffer to the enzyme digestion product, add all PCR products to 1% agarose gel for electrophoresis detection, and detect a band of about 720 bp, indicating that the HaU6-sgRNA2 fusion fragment was successfully amplified. Gel excision and gel recovery were performed to obtain the second sgRNA expression cassette sequence. The gel recovery step uses the FastPure Gel DNA Extraction Mini Kit from Nanjing Novozymes.

[0098] 4. PCR amplification of piggyBac background plasmid

[0099] Using piggyBac background plasmid pBac[IE1-EGFP-IE1-Cas9-SV40] (Liu Qun. Functional study of silkworm olfactory-related genes [D]. Supervisor: Hao Dejun; Huang Yongping. Nanjing Forestry University, 2019.) DNA as a template, a linearized piggyBac plasmid without EGFP expression cassette and Cas9 expression cassette sequence was amplified with primers containing homology arms, wherein the upstream primer F10 sequence is 5'-AGGGGCCCAAGCTTGATATCTATAACAAGAAAATATATATATAATAAGTTATCACG-3', and the downstream primer R10 sequence is 5'-CAAGTGAGGTACCGACCCAAGAAAAAGCGG-3'. PCR was completed in a 0.2mL PCR tube with a total reaction volume of 50μL for the target fragment amplification:

[0100]

[0101] The PCR reaction procedure was as follows: first, pre-denaturation at 94°C for 3 min; then, 35 cycles of amplification: denaturation at 94°C for 15 s, annealing at 65°C for 15 s, extension at 72°C for 4 min; and finally, extension at 72°C for 10 min.

[0102] Electrophoresis detection of PCR products and gel excision recovery: Add 10 μL Loading Buffer to the enzyme digestion product, add all PCR products to 1% agarose gel for electrophoresis detection, if there is a single bright band of about 4265 bp, it means that the linearized piggyBac plasmid without EGFP expression cassette and Cas9 expression cassette is amplified successfully, cut the band and perform gel recovery. The gel recovery step uses the FastPure Gel DNA Extraction Mini Kit from Nanjing Novozymes.

[0103] 5. Obtaining piggyBac transgenic plasmid expressing sgRNA

[0104] The Hr5IE1-mCherry fragment, the first sgRNA expression cassette fragment and the second sgRNA expression cassette fragment were homologously recombined into a linearized piggyBac plasmid without an EGFP expression cassette and a Cas9 expression cassette to construct a piggyBac transgenic plasmid expressing sgRNA targeting the HaSer2 gene. The homologous recombination system (using the OneStepCloningKit kit) is as follows:

[0105]

[0106]

[0107] The reaction temperature was 37°C and the reaction time was 30 min. Then, the recombinant product was transformed into 100 μL TranS1-T1 E. coli competent cells, gently mixed, and placed on ice for 30 min. After the ice bath, the EP tube was placed in a 42°C heat shock for 45 s, and then quickly placed on ice for 2 min. In the clean bench, 950 μL of LB liquid culture medium was added to the EP tube, and placed in a 37°C shaker at 150 rpm for 2 h. After shaking the bacteria, 100 μL of the bacterial solution was aspirated and applied to the LBAmp + Solid plate, after evenly coating, place the plate in a 37°C incubator for overnight culture. Pick a single plaque of suitable size on the plate and add 950 μL LB Amp + The culture medium was shaken at 37°C at 250 rpm for 12 h, and then expanded to 100 mL at a ratio of 1:100. The piggyBac transgenic plasmid was extracted using PureLink TM HiPure Plasmid Midi Kit.

[0108] 6. Obtaining Chr5-U6-S2sgRNA for Transformation Event of Cotton Bollworm

[0109] First, collect fresh eggs of cotton bollworm within 1 hour, wash and disinfect with 0.1% 84 disinfectant, collect the eggs on filter paper through a Buchner funnel, and then arrange them neatly and fix them on a glass slide with double-sided tape. Mix the piggyBac transposase mRNA and the piggyBac transgenic plasmid expressing the sgRNA targeting the HaSer2 gene and dilute them to 400ng / μL. Use Eppendorf's FemtoJet and InjectMan NI 2microinjection system to inject the above mixed solution into fresh eggs of cotton bollworm, and after hatching, transfer them to artificial feed to obtain G0 generation transgenic cotton bollworm.

[0110] After mating the G0 generation transgenic cotton bollworm adult group, the G1 generation was obtained, and all the newly hatched larvae of the G1 generation were concentrated in a culture dish, and the mCherry positive fluorescent individuals were screened using a Nikon SMZ25 fluorescence microscope. After the obtained positive fluorescent individuals were raised to adults and mated with the cotton bollworm background strain to expand the population, according to the identification method of the exogenous gene insertion site reported by Li et al. (Li L, Zuo Y, Shi Y, Yang Y, Wu Y. Overexpression of the F116V allele of CYP9A186 in transgenic Helicoverpa armigera confers high-level resistance to emamectinbenzoate. Insect Biochem Mol Biol. 2023; 163: 104042.), the exogenous gene in the transgenic cotton bollworm was detected to be located between the 4,681,215 and 4,681,216 bases of chromosome 5 of the genome, and then the cotton bollworm transformation event Chr5-U6-S2sgRNA was obtained.

[0111] 7. Design of flanking sequences and specific primers for Chr5-U6-S2sgRNA in cotton bollworm transformation event

[0112] The flanking sequence of the Chr5-U6-S2sgRNA of the cotton bollworm transformation event is located upstream of base 4,681,215 of chromosome 5 of the cotton bollworm genome, and the upstream 500bp sequence is shown in SEQ ID NO. 5. Based on the flanking sequence and the exogenous gene sequence, specific primers were designed to identify the molecular characteristics of the cotton bollworm transformation event Chr5-U6-S2sgRNA, wherein the first primer matches the flanking sequence, and the sequence information is shown in SEQ ID NO. 7, and the second primer matches the left sequence of the exogenous gene, and the sequence information is shown in SEQ ID NO. 8. This primer pair is expected to amplify a target band of about 611bp.

[0113] 8. Identification of molecular characteristics of Chr5-U6-S2sgRNA in transformation of cotton bollworm

[0114] The FastPure Cell / Tissue DNA Isolation Mini Kit (Nanjing Novozyme) was used to extract the genomic DNA of cotton bollworm containing the Chr5-U6-S2sgRNA transformation event. The specific process was consistent with the method of "5. Identification of molecular characteristics of Chr16-Vasa-Cas9 in cotton bollworm transformation events" in Example 1. Subsequently, the genomic DNA of cotton bollworm containing the Chr5-U6-S2sgRNA transformation event was used as a template, SEQ ID NO.7 was used as an upstream primer, SEQ ID NO.8 was used as a downstream primer, and 2xTaqMasterMix (Nanjing Novozyme) was used for PCR amplification. The system was as follows:

[0115]

[0116] PCR reaction conditions: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 20 s, annealing at 60°C for 20 s, extension at 72°C for 30 s, 32 cycles; extension at 72°C for 5 min.

[0117] The PCR products were then separated by 1.2% agarose gel electrophoresis, and a 2000 bp DNA marker was used as a control. Figure 4 As shown, the genomic DNA of cotton bollworm containing the Chr5-U6-S2sgRNA transformation event can amplify the expected target band of 611bp, indicating that this pair of specific primers can be used to accurately identify the molecular characteristics of the flanking sequences of the Chr5-U6-S2sgRNA transformation event.

[0118] Example 3 Construction of male sterile line of cotton bollworm using Chr16-Vasa-Cas9 and Chr5-U6-S2sgRNA transformation events

[0119] By hybridizing the cotton bollworm containing the Chr16-Vasa-Cas9 transformation event in Example 1 with the cotton bollworm containing the Chr5-U6-S2sgRNA transformation event in Example 2, a hybrid F1 generation of cotton bollworms co-expressing Cas9 and sgRNA was obtained, in which the HaSer2 gene was knocked out, and the cotton bollworms showed male sterility traits, and at the same time, their mating success rate, mating time and egg laying amount did not change significantly, indicating that the Chr16-Vasa-Cas9 transformation event and the Chr5-U6-S2sgRNA transformation event are preferred transformation events for constructing a male sterile line of cotton bollworms. The specific steps are as follows:

[0120] 1. Construction method of male sterile line of cotton bollworm

[0121] The cotton bollworm adults containing the Chr16-Vasa-Cas9 transformation event obtained in Example 1 were mated with the cotton bollworm adults containing the Chr5-U6-S2sgRNA transformation event obtained in Example 2, and the resulting F1 generation was a cotton bollworm containing both transformation events. The genomic DNA was extracted using the FastPure Cell / Tissue DNA Isolation Mini Kit, and the steps were the same as in "5. Identification of molecular characteristics of the cotton bollworm transformation event Chr16-Vasa-Cas9" in Example 1.

[0122] The above-extracted cotton bollworm genomic DNA was used as a template, and the target fragment of the HaSer2 gene was amplified with primers F11 / R11, wherein the sequence of the upstream primer F11 was 5'-AATGCAGACAAAGTCAATGCATCTTGTGG-3', and the sequence of the downstream primer R11 was 5'-CCTGACAAGCATCTTTGCCAAGAC-3'; PCR was performed in a 0.2 mL PCR tube with a total reaction volume of 50 μL to amplify the target fragment:

[0123]

[0124] The PCR reaction procedure was as follows: first, pre-denaturation at 94°C for 3 min; then, 35 cycles of amplification: denaturation at 94°C for 15 s, annealing at 65°C for 15 s, extension at 72°C for 1 min; and finally, extension at 72°C for 10 min.

[0125] Electrophoresis detection of PCR products and gel excision recovery: Add 10 μL Loading Buffer to the enzyme digestion product, add all PCR products to 1.2% agarose gel for electrophoresis detection, and detect a band of about 280 bp, indicating that the HaSer2 gene has been successfully knocked out. The band is excised and recovered from the gel and sequenced.

[0126] 2. Analysis of the fitness cost of reproductive behavior of male sterile lines of cotton bollworm

[0127] 20 male individuals were randomly selected from cotton bollworms containing both Chr16-Vasa-Cas9 transformation events and Chr5-U6-S2sgRNA transformation events, and 20 female individuals of the background strain SCD were mated in single pairs. The mating success rate, average mating time, average egg laying amount and effective egg ratio were observed and counted. 20 females of the SCD strain and 20 male individuals were mated in single pairs as a control. The statistical results are shown in Table 1. It can be seen from Table 1 that after the male cotton bollworm with HaSer2 gene mutation mated with the female of the wild-type strain SCD, all the eggs obtained could not develop normally, and the effective egg ratio was 0, but the mating success rate, mating time and egg laying amount were not affected (P≤0.0001). Therefore, the present invention uses the cotton bollworm transformation events Chr16-Vasa-Cas9 and Chr5-U6-S2sgRNA to construct a cotton bollworm male sterile line with obvious male sterility phenotype and no other reproductive behavior fitness costs, indicating that the two cotton bollworm transformation events Chr16-Vasa-Cas9 transformation event and Chr5-U6-S2sgRNA are the preferred transformation events for constructing a cotton bollworm male sterile line.

[0128] Table 1 Analysis of male sterility phenotype of HaSer2 gene mutant in cotton bollworm

[0129]

Claims

1. A method for constructing a male sterile line of cotton bollworm, characterized in that: The cotton bollworm containing the Chr16-Vasa-Cas9 transformation event is hybridized with the cotton bollworm containing the Chr5-U6-S2sgRNA transformation event, the HaSer2 gene of the hybrid F1 generation cotton bollworm is knocked out, and its male individuals cannot obtain eggs that can develop normally when mating with other females, thereby obtaining a dominant male sterile line of cotton bollworm; an exogenous gene is inserted between the 4,267,442 and 4,267,443 bases of chromosome 16 of the cotton bollworm containing the Chr16-Vasa-Cas9 transformation event, and the sequence of the exogenous gene is shown in SEQ ID NO.2; an exogenous gene is inserted between the 4,681,215 and 4,681,216 bases of chromosome 5 of the cotton bollworm containing the Chr5-U6-S2sgRNA transformation event, and the sequence of the exogenous gene is shown in SEQ ID NO.

6.

2. A combination of cotton bollworm transformation events, characterized in that: It consists of the Chr16-Vasa-Cas9 transformation event and the Chr5-U6-S2sgRNA transformation event described in claim 1.

3. The combination of cotton bollworm transformation events according to claim 2, characterized in that The flanking sequence of the cotton bollworm transformation event Chr16-Vasa-Cas9 is shown in SEQ ID NO.1; the flanking sequence of the cotton bollworm transformation event Chr5-U6-S2sgRNA is shown in SEQ ID NO.

5.

4. A primer pair for detecting transgenic cotton bollworm events Chr16-Vasa-Cas9, characterized in that: The primer pair includes a first primer and a second primer; the first primer is shown as SEQ ID NO.3; the second primer is shown as SEQ ID NO.

4.

5. A method for detecting whether a cotton bollworm sample contains a transgenic cotton bollworm transformation event Chr16-Vasa-Cas9 using the primer pair of claim 4, characterized in that: The method comprises: (1) extracting genomic DNA of a cotton bollworm sample to be tested; (2) using the primer pair described in claim 3 to perform PCR amplification with the genomic DNA as a template; (3) detecting whether the PCR product has a target band by agarose gel electrophoresis. If the target band exists, it indicates that the transgenic cotton bollworm transformation event Chr16-Vasa-Cas9 is included; the target band has a size of 800 bp.

6. A primer pair for detecting transgenic cotton bollworm events Chr5-U6-S2sgRNA, characterized in that: The primer pair includes a first primer and a second primer; the first primer is shown as SEQ ID NO.7; the second primer is shown as SEQ ID NO.

8.

7. A method for detecting whether a cotton bollworm sample contains a transgenic cotton bollworm event Chr5-U6-S2sgRNA using the primer pair of claim 6, characterized in that: The method comprises: (1) extracting genomic DNA of a cotton bollworm sample to be tested; (2) using the primer pair described in claim 3 to perform PCR amplification with the genomic DNA as a template; (3) detecting whether the PCR product contains a target band by agarose gel electrophoresis. If the target band exists, it indicates that a transgenic cotton bollworm transformation event is contained; the target band has a size of 611 bp.

8. A piggyBac transgenic plasmid driven by the Vasa promoter of cotton bollworm to express Cas9, characterized in that: The Vasa-Cas9 fusion fragment was recombined into the linearized piggyBac plasmid.

9. A piggyBac transgenic plasmid targeting HaSer2 gene sgRNA, characterized in that: The Hr5IE1-mCherry fragment, the first sgRNA expression cassette fragment and the second sgRNA expression cassette fragment were homologously recombined into a linearized piggyBac plasmid without an EGFP expression cassette and a Cas9 expression cassette, wherein the first sgRNA expression cassette fragment was a HaU6 promoter-sgRNA1 fusion fragment, and the sgRNA1 of the HaSer2 gene was shown as SEQ ID NO.9; the second sgRNA expression cassette fragment was a HaU6 promoter-sgRNA2 fusion fragment, and the sgRNA2 of the HaSer2 gene was shown as SEQ ID NO.10.

Images