Method for improving crucian carp herpesvirus resistance of crucian carp

Abstract

The invention relates to the technical field of fish genetic breeding, in particular to a method for improving carassius auratus gibelio resistance to carassius auratus gibelio herpesvirus. A CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 (CRISPR associated protein 9) gene editing technology is utilized to specifically knock out the carassius auratus gibelio irf10-B gene to obtain a mutant genotype individual of which three irf10-B alleles are terminated in advance, namely the required carassius auratus gibelio with high resistance The invention also discloses two specific knockout targets of the irf10-B gene and an allele sequence corresponding to a mutant genotype individual in which three alleles of the irf10-B are terminated in advance. According to the invention, the function of the irf10-B in the prussian carp is verified for the first time, a new germplasm of which the capability of resisting the herpesvirus of the prussian carp is improved by 30% is rapidly obtained by knocking out the single gene of the irf10-B, and the new germplasm has important industrial value.

Description

Technical Field

[0001] The invention relates to the technical field of fish genetic breeding, and in particular to a method for improving the ability of silver carp to resist crucian carp herpes virus. Technical Background

[0002] Silver crucian carp (Carassius gibelio) is one of the main commercialized aquaculture species of freshwater fish in my country. Silver crucian carp has rich germplasm resources. Due to different geographical distributions, many local strains with obvious differences have been produced, such as Pengze crucian carp, Gaobei crucian carp, Fangzheng silver crucian carp, etc. In addition, researchers have cultivated a number of new aquatic species such as the hybrid silver crucian carp "Zhongke No. 3", Changfeng crucian carp, hybrid silver crucian carp "Zhongke No. 5", and Xiangyun crucian carp. These varieties have significantly promoted the rapid development of my country's crucian carp farming industry in different breeding periods. In particular, hybrid silver crucian carp "Zhongke No. 3" and hybrid silver crucian carp "Zhongke No. 5" have become important bulk freshwater economic aquaculture varieties in my country due to their fast growth rate, strong resistance to adversity and adaptability.

[0003] With the increase in crucian carp farming area and output, disease problems have become increasingly serious. Viral diseases have caused huge economic losses to the crucian carp farming industry due to their rapid spread, high mortality rate, difficulty in pathogen diagnosis and immature prevention methods.

[0004] Acute gill hemorrhage of crucian carp is an infectious disease that causes the most serious losses in the breeding process of silver carp. The pathogen is Carassius auratus herpesvirus (CaHV). "Zhongke No. 3" is very susceptible to CaHV infection. The survival rate of "Zhongke No. 5" after infection with CaHV is 12.59% higher than that of "Zhongke No. 3" on average. The applicant's previous patent CN116267799A discloses a method for creating a silver carp resistant to herpesvirus. Through gene editing technology, ptpn6-A and ptpn6-B are knocked out in silver carp, and the disease resistance of mutant individuals is increased by about 10% compared with the wild type. However, these methods have limited effect on the improvement of the disease resistance of silver carp, and still cannot effectively prevent or control the "gill hemorrhage disease" of silver carp caused by herpesvirus.

[0005] Breeding new varieties of silver crucian carp with higher disease resistance is of great significance to the development of the current crucian carp industry. Summary of the invention

[0006] In order to solve the problems existing in the prior art, the present invention provides a method for improving the ability of silver crucian carp to resist crucian carp herpes virus.

[0007] The present invention adopts the following technical solutions:

[0008] A method for improving the ability of silver carp to resist herpesvirus, using CRISPR / Cas9 gene editing technology to specifically knock out the irf10-B gene of silver carp, and obtaining a mutant genotype individual in which three alleles of irf10-B are terminated prematurely, which is the desired silver carp with high resistance to herpesvirus; the irf10-B gene has two specific knockout target sites, the sequences of which are shown in SEQ ID NO:1 and SEQ ID NO:2, and the allele sequences corresponding to the mutant genotype individual in which three alleles B1, B2 and B3 of irf10-B are terminated prematurely are shown in SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, respectively.

[0009] Furthermore, the specific method of the knockout is to inject a mixture of sgRNA and Cas9 protein containing the irf10-B specific knockout target site into the fertilized eggs of silver crucian carp to obtain F0 generation chimeras, and after the F0 generation silver crucian carp is raised to sexual maturity, the F1 generation is obtained through gynogenesis, and the mutant genotype individuals in which the three alleles of irf10-B are terminated prematurely in the F1 generation are screened, which are the required silver crucian carp with high resistance to crucian herpes virus.

[0010] Further, the following steps are included:

[0011] S1. Obtain sgRNAs for the irf10-B specific knockout target site at a concentration of 1000-1500 ng / μL, namely irf10-B-sgRNA1 and irf10-B-sgRNA2, for use;

[0012] S2. Take 2 μL of irf10-B-sgRNA1, 2 μL of irf10-B-sgRNA2 and 0.5 μL of Cas9 protein and mix them to obtain a mixed solution with a working concentration of 250-300 ng / μL, which is used for injection into fertilized eggs. The injection volume for each fertilized egg is 2 nL.

[0013] S3. After the injection is completed, the fertilized eggs are hatched to obtain F0 generation chimeras, and the F0 generation is raised to sexual maturity and then subjected to gynogenesis to obtain F1 generation;

[0014] S4. Select the silver crucian carp in which all three alleles of irf10-B in the F1 generation have premature termination mutations, which is the desired silver crucian carp resistant to crucian herpes virus.

[0015] Furthermore, it also includes a breeding step, in which the silver crucian carp with premature termination mutation of the three alleles of irf10-B in the F1 generation is reproduced by gynogenetic method to obtain the F2 generation, and the F2 generation are all the desired silver crucian carp resistant to crucian herpes virus.

[0016] Furthermore, the fertilized eggs are obtained by mixing mature eggs of silver crucian carp and sperm of male Xingguo red carp.

[0017] Furthermore, the specific operation of female reproduction of F1 and F2 generations is to mix the mature eggs of silver crucian carp with the sperm of male Xingguo red carp for fertilization and hatching to produce all-female offspring of silver crucian carp.

[0018] Furthermore, the preparation method of the sgRNA for specifically knocking out the target site of irf10-B is as follows: using irf10-B-sgRNA1-F and sgRNA-R and irf10-B-sgRNA2-F and sgRNA-R primer pairs, using pUC19-gRNA plasmid as a template for PCR amplification to obtain irf10-B-sgRNA1 and irf10-B-sgRNA2 fragments, and then performing in vitro sgRNA transcription on the irf10-B-sgRNA1 and irf10-B-sgRNA2 fragments, and purifying and recovering the transcription products to obtain the desired sgRNA; the sequence of the irf10-B-sgRNA1-F is shown in SEQ ID NO: 6, the sequence of the irf10-B-sgRNA2-F is shown in SEQ ID NO: 7, and the sequence of the sgRNA-R is shown in SEQ ID NO: 8.

[0019] Furthermore, the method for selecting silver crucian carp in which the three alleles of irf10-B in the F1 generation have premature termination mutations is as follows: separately extract the genomic DNA of the fin rays of the F1 generation adult fish, use detection primers to perform PCR amplification, transform the amplified products into competent Escherichia coli, select positive single clones for sequencing, analyze the sequencing results, and select mutant silver crucian carp whose sequences of the three alleles of irf10-B are shown in SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

[0020] Furthermore, the upstream primer sequence of the detection primer is shown as SEQ ID NO:9, and the downstream primer sequence is shown as SEQ ID NO:10.

[0021] The beneficial effects of the present invention are:

[0022] Crucian carp and silver carp belong to the Carp complex. Genomic analysis revealed that Crucian carp originated from an early round of allopolyploidization event to form an amphidiploid (AABB), and on the basis of Crucian carp, it experienced another autopolyploidization event to form an alloautologous double triploid silver carp (AAABBB). After polyploidization, each gene in the silver carp contains gene copies from two ancestors, which are called partial homeologous genes (A or B), and each partial homeologous gene has three alleles. Two partial homeologous genes will have different evolutionary fates during the evolution process, such as pseudogenesis, neofunctionalization, subfunctionalization or loss.

[0023] Irf10 is a gene unique to birds and teleosts, and is commonly found in diploid fish. Studies have reported that irf10 has a negative regulatory effect on interferon in vitro by intracellular overexpression in the model species diploid zebrafish. However, the in vivo functional studies of this gene are still unclear. In addition, due to the polyploidization event, the gene functions of silver carp are more complex than those of diploid fish. For example, foxl2 regulates the development and maintenance of the zebrafish ovary in zebrafish; while in silver carp, some homologous genes of foxl2 not only coordinately regulate the follicle formation and ovarian development of silver carp, but also play a role in the process of oogenesis. Therefore, the function of irf10 in polyploid silver carp is still unknown.

[0024] This study found for the first time that after the silver crucian carp experienced two additional rounds of polyploidization events, the two partially homologous genes of irf10 had different evolutionary fates, among which irf10-A was lost during evolution. At the same time, the function of irf10-B in silver crucian carp was verified.

[0025] The present invention discovered through bioinformatics analysis that irf10-A was lost in silver crucian carp, and obtained the CDS sequences of the three alleles of irf10-B by cloning. Subsequently, irf10-B was knocked out in the "Zhongke No. 3" strain by designing efficient gene editing targets, and F2 homozygous offspring with one, two and three alleles knocked out were obtained. Artificial infection with CaHV experiments showed that there was a dose-dependent effect between the antiviral ability of the three mutants and the number of alleles knocked out, indicating that the three alleles of irf10-B in silver crucian carp have functional complementarity, and knocking out irf10-B can significantly improve the body's antiviral ability. The experiment found that the survival rate of the new germplasm of the mutant with three alleles knocked out increased by about 30%, which was significantly higher than the disease-resistant varieties reported in the prior art.

[0026] The present invention rapidly obtains new germplasm with 30% enhanced resistance to crucian carp herpes virus by knocking out a single gene, and the method does not require the introduction of exogenous genes, thus avoiding the risk of gene contamination. It is a qualitative leap in fish antiviral breeding and has very important industrial value. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The CDS sequences and SNP sites of the three alleles of irf10-B of Carassius auratus gibelio;

[0028] Figure 2 Schematic diagram of the target site design of irf10-B in crucian carp. Exons and introns are represented by pink rectangles and blue thick lines, respectively, and the white rectangle is the UTR region.

[0029] Figure 3The diagram shows the mutant sequences and protein structures of the wild type and three alleles of irf10-B in silver crucian carp. The red color in the figure indicates the PAM sequence. The SNPs of the three alleles are distinguished by different colors.

[0030] Figure 4 The survival curves of wild-type and three mutants of irf10-B silver carp after infection with CaHV.

[0031] Figure 5 Wild-type and irf10-B cells were infected with CaHV for 72 h. - / - / - HE observation of fish spleen and head kidney tissues.

[0032] Figure 6 Wild-type and irf10-B cells were infected with CaHV for 72 h. - / - / - qPCR analysis of CaHV-encoded genes orf72, orf80, orf92 mRNA in liver, spleen and head kidney of fish (n=3 per group). DETAILED DESCRIPTION

[0033] For ease of understanding, the technical solution of the present invention is described in more detail below in conjunction with experiments:

[0034] 1 Screening and target site design of irf10 gene in Carassius auratus gibelio

[0035] 1.1 Identification of the irf10 gene in Carassius auratus gibelio

[0036] The zebrafish irf10 gene sequence was downloaded from the Ensemble website and compared with the silver crucian carp genome to obtain the irf10-B reference sequence (XM_052593522.1). The partial homologous gene irf10-A located on chromosome A was not matched in the entire genome. At the same time, irf10-A was not found in the genome comparison of evolutionarily close species such as crucian carp, goldfish and carp. Therefore, it can be determined that irf10-A was lost after the allopolyploidization event.

[0037] Full-length cloning primers were designed for PCR cloning of the full-length irf10-B CDS. The upstream cloning primer of irf10-B was designed on the 5'UTR, which was irf10-BF: CACATGTCTGAATGTATGCAAT; the downstream primer was irf10-BR: TTATTCATTGGTTTTCCTGTG.

[0038] The RNA in the head kidney of the immune tissue of silver carp was extracted by Trizol method and reverse transcribed into cDNA. The cDNA was used as template to amplify the longest transcript of the three alleles of irf10-B. The sequence is as follows Figure 1 As shown, Figure 1The differences in single nucleotide polymorphisms (SNPs) between the three alleles can also be seen.

[0039] 1.2 Design of target site for knockout of irf10-B in Carassius auratus gibelio

[0040] By copying the amino acid sequence of the irf10-B gene of silver carp to the NCBI Conserved Domain Database (CDD) website, the positions of two important domains of the irf10-B protein were predicted, corresponding to the protein sequences at 9-113 amino acids and 190-368 amino acids, and the corresponding CDS sequence positions at 27-339 bp and 570-1104 bp.

[0041] See also Figure 2 , irf10-B specific knockout target sites were designed on the first and second exons according to the full-length CDS sequence of irf10-B. The corresponding CDS sequence positions are 16-36bp and 211-231bp, and the corresponding protein sequence amino acid positions are 6-12 and 71-77. The first target site is located 16bp after the start codon, and the sequence is: GGCACATGCGACTGAGAGAA (SEQ ID NO: 1); the second target site is located in the first 1 / 2 of the DBD domain, before the IAD domain, and the sequence is: GGGTAAGTTTCAAGAGGGCA (SEQ ID NO: 2).

[0042] 1.3 Target site primer synthesis and sgRNA preparation

[0043] The primer sequences for the specific target site of Carassius auratus irf10-B are as follows:

[0044] irf10-B-sgRNA1-F:

[0045] GTAATACGACTCACTATAGGCACATGCGACTGAGAGAAGTTTTAGAG CTAGAAATAGC (SEQ IDNO: 6);

[0046] irf10-B-sgRNA2-F:

[0047] GTAATACGACTCACTATAGGGTAAGTTTCAAGAGGGCAGTTTTAGAGC TAGAAATAGC (SEQ IDNO: 7);

[0048] sgRNA-R:

[0049] AAAAGCACCGACTCGGTGCC (SEQ ID NO:8).

[0050] Preparation of PCR in vitro transcription template for gRNA: Use irf10-B-sgRNA1-F and sgRNA-R and irf10-B-sgRNA2-F and sgRNA-R primer pairs, pUC19-gRNA plasmid as template, and high-fidelity enzyme for PCR amplification. The program is: 95℃ pre-denaturation for 3min, 95℃ denaturation for 30sec, 58℃ annealing for 30sec, 72℃ extension for 10sec, 72℃ final extension for 5min, 36 cycles. Use 1% agarose gel to electrophoresed the PCR product. After confirming that it is a single band (125bp), cut the gel to recover the PCR product. Finally, use 20μL RNase-free water to elute in a 1.5mL RNase-free tube.

[0051] Subsequently, the irf10-B-sgRNA1 and irf10-B-sgRNA2 fragments were transcribed in vitro using the TranscriptAid T7 High Yield Transcription Kit (Thermo Fish Scientific), and the in vitro transcription products of sgRNA were purified and recovered using the lithium chloride precipitation method. After determining the concentration, 100 to 200 ng of sgRNA solution was taken to detect the quality of RNA by agarose gel, and the remaining solution was divided and frozen in a -80°C refrigerator.

[0052] 2Gene editing and reproduction

[0053] 2.1 Microinjection of fertilized eggs

[0054] The fish eggs were spread flat in a 10 cm plastic culture dish, and an appropriate amount of ovarian fluid was added to prevent drying and improve the survival rate. The injection mixture of sgRNA and Cas9 protein (Invitrogen) was prepared on ice, and 2 μL irf10-B-sgRNA1 (1000-1500 ng / μL), 2 μL irf10-B-sgRNA2 (1000-1500 ng / μL) and 0.5 μL Cas9 protein were mixed evenly to make the final working concentration of each target sgRNA 250-300 ng / μL. The mixture was injected into the animal pole of silver crucian carp eggs using a nitrogen-pressurized PLI-100 quantitative microinjector (Harvard), with an injection volume of 2 nL per egg, and a total of 200-400 eggs were injected. After the microinjection was completed, the fertilized eggs were transferred to an incubation tank with a water temperature of 22-24 ° C for incubation to obtain the F0 generation.

[0055] 2.2 Target site mutation efficiency detection

[0056] Specific target site detection primers were designed for irf10-B, amplified on the silver carp genome, and the mutation efficiency of each target site was detected.

[0057] The upstream primer for irf10-B target site detection was irf10-B-FP: CGCAATCCGTCCAGTAGG (SEQ ID NO: 9);

[0058] The downstream primer was irf10-B-RP: GTAGTGCATGGGGACAGTTT (SEQ ID NO: 10).

[0059] After the fertilized eggs hatched, 10 small fish fry were randomly selected to extract DNA, and PCR amplification was performed using the above-mentioned detection primers. After sequencing of the PCR products, it was found that the sequencing peak graph of the wild type was single-peaked in the upstream and downstream regions of the target site; if the sequencing peak graph of the CRISPR / cas9-edited experimental fish showed overlapping peaks in the area near the target site, it was preliminarily determined that a knockout occurred at the target site, and then the purified PCR product was connected to the pMD-18T vector and transformed into Escherichia coli. Ten positive single clones were selected for sequencing to obtain the mutant sequence, and the mutant sequence was compared with the wild-type sequence, and it was finally determined that the mutation efficiency of the target site after injection was 100%.

[0060] 2.3 Mutant screening and breeding

[0061] The F0 generation in step 4 is raised to adulthood and produces the F1 generation through gynogenesis.

[0062] After the F1 generation fry were raised to adulthood, they were brought back to the indoor constant temperature aquarium for temporary breeding. The F1 individuals were distinguished by cutting different fin ray combinations. DNA from the fin ray tissue of one wild type and F1 generation was extracted, and then PCR amplification was performed using the above detection primers. After gel recovery of the PCR product, it was connected to the pMD-18T vector and transformed into Escherichia coli. Fifteen positive single clones were randomly selected from each sample for sequencing. The sequencing results were analyzed, and the sequences of the three alleles were confirmed based on the differences in the SNPs within the amplification length in the wild type. The sequence of each allele appeared at least 3 times in the selected positive clones before it was confirmed as a reliable sequence. Subsequently, the sequencing results of each individual of the F1 generation were compared with the wild type sequence, and the specific sequences of the three alleles of each F1 individual were analyzed to confirm which allele the knockout occurred in and its knockout genotype. Similarly, the final confirmation of the knockout genotype must have the same sequence appear more than 3 times in its positive clones.

[0063] There are three alleles of irf10-B, which are respectively denoted as B1 (SEQ ID NO: 11), B2 (SEQ ID NO: 12) and B3 (SEQ ID NO: 13). In the knockout of alleles compared in the present invention, see Figure 3 : In the silver crucian carp with one allele knocked out, one base was added after base 18 at the first target site of the first allele B1, and the sequence of the second target site remained unchanged; B2 B3 remained unchanged; in the silver crucian carp with two alleles knocked out, the first allele B1 remained unchanged; 88 bases were reduced after base 17 at the first target site of the second allele B2, and one base was reduced and three bases were added after base 17 at the second target site; 2 bases were reduced after base 4 at the first target site of the third allele B3, and 5 bases were reduced after base 1 at the second target site; in the sequence of all three alleles knocked out, 7 bases were added after base 11 at the first target site of the first allele B1, and 8 bases were added after base 17 at the second target site. The sequence is shown in SEQ ID NO:3; the second allele B2 has 88 bases less after base 17 at the first target site, 1 base less after base 17 at the second target site, and 3 bases more, and the sequence is shown in SEQ ID NO:4; the third allele B3 has 2 bases less after base 17 at the first target site, and 5 bases less after base 15 at the second target site, and the sequence is shown in SEQ ID NO:5.

[0064] According to the above method, 16 individuals with the mutant genotype of premature termination of all three alleles of irf10-B, 4 individuals with the mutant genotype of premature termination of both irf10-B alleles, and 1 individual with the mutant genotype of premature termination of one allele of irf10-B were finally screened out from the F1 generation individuals.

[0065] Subsequently, according to the development of the three allele knockout fish, one individual with mature gonads, large egg-bearing capacity and strong individual was selected for gynogenesis from each fish, and one allele irf10-B was edited. +1 / WT / WT (irf10-B - / + / + ), two alleles irf10-B WT / -88；-1,+3 / -2；-5 (irf10-B + / - / - ) and three alleles irf10-B +7；+8 / -88；-1,+3 / -2；-5 (irf10-B - / - / - ) of the bulk F2 population.

[0066] 3 Artificial infection experiment of crucian carp herpes virus and evaluation of antiviral ability

[0067] Prepare fresh CaHV virus suspension by pressing 10 0 , 10 1 , 10 2 , 10 3 , 10 4 The dilution multiples were graded on ice. 60 healthy wild-type silver crucian carps were randomly divided into 6 groups (10 in each group) and injected with graded diluted virus filtrate. Each carp was injected with 50 μL of virus filtrate dilution through the base of the pectoral fin, and the control group was injected with an equal amount of PBS buffer. Observe daily, count the mortality rate, and calculate the median lethal dose of 10 2 dilution.

[0068] The virus copy number was calculated by fluorescence quantitative PCR, and the CaHV 637bp helicase gene fragment was used as the quantitative standard to construct a standard curve. Specifically:

[0069] 1) Amplify the CaHV 637 bp helicase fragment and purify and recover it using a gel recovery kit.

[0070] 2) Insertion of purified recovered helicase fragment From the 18-T plasmid, pMD-CaHV plasmid (3,329 bp) was obtained.

[0071] 3) The copy number of the plasmid was calculated based on the relationship between the molar number, relative molecular mass and concentration. The pMD-CaHV plasmid with a known copy number was diluted 10 times as a standard, and quantitative analysis was performed using fluorescent quantitative PCR, and a standard curve was constructed using SPSS software.

[0072] 4) The total DNA of the sample was extracted using a DNA extraction kit and used as a template to perform quantitative PCR analysis under the same conditions, and the viral copy number of each sample was calculated based on the standard curve.

[0073] The calculated median lethal dose of 50 μL CaHV diluted filtrate contained 3.214×10 7 , and this concentration was used as the injection concentration in subsequent experiments.

[0074] The wild type of "Zhongke 3" (irf10-B + / + / + ) and three knockout mutant lines of irf10-B in silver carp (irf10-B - / + / + 、irf10-B + / - / - 、irf10-B - / - / -) were temporarily raised in a 32cm×24cm×36cm aquarium in the laboratory. The water temperature was gradually changed to 23℃ (±1℃). The fish were raised for two weeks to observe that there was no abnormality and PCR was used to detect the absence of CaHV virus in the fish. During the temporary raising period, the fish were fed with normal feed every day, and feeding was stopped for 24h before and after virus injection. 50μL CaHV filtered virus suspension (the number of virus particles was 3.214×10 7 ), wild-type individuals were used as the control group, and each fish was injected with an equal amount of PBS buffer. Three parallel groups were set up for each infection group, and each parallel group had 30 fish. The culture water was kept at 23°C (±1°C), filtered continuously, and changed once a day. When no dead individuals appeared, 1 / 3 of the water was changed every day; after the fish became sick and died, 1 / 2 of the water was changed every day and the dead individuals were removed in time to keep the water clean.

[0075] The mortality of silver carp was recorded every day after infection until 14 dpi (days post infection), and the survival rate of fish was analyzed. Figure 4 As shown, the results showed that the wild-type group irf10-B + / + / + Deaths began to occur on the 6th day and stabilized on the 12th day, with a final survival rate of 14.81%; irf10-B - / + / + The final survival rate of the group was 13.79%; + / - / - The final survival rate of the group was 21.42%; while - / - / - Deaths began to occur on the 7th day and stabilized on the 11th day, with a final survival rate of 53.85%. The results showed that there was a dose-dependent effect between the antiviral ability of the mutant and the number of knockouts of the irf10-B allele. - / - / - The survival rate of the group under virus infection was increased by about 30% compared with the wild type.

[0076] Furthermore, there were significant differences in antiviral ability between the wild-type group and irf10-B - / - / - The spleen and head kidney of the group's immune tissue were analyzed by pathological section analysis, see Figure 5 , and found that irf10-B - / - / - The pathological damage of spleen and head kidney tissues in the group was significantly lower than that in the wild-type gibel carp.

[0077] Finally, qPCR was used to detect the expression of irf10-B in the wild-type group. - / - / - The expression of CaHV virus-encoded genes in liver, spleen, and head kidney tissues of the group was analyzed. - / - / -The expression levels of viral genes orf72, orf80, and orf92 in the three tissues were significantly lower than those in wild-type crucian carp, indicating that knocking out irf10-B can significantly inhibit the replication of viral genes.

[0078] The above implementation modes are only used to illustrate the technical solutions of the present invention, but not to limit the present invention. Although the present invention has been described in detail with reference to the above implementation modes, those skilled in the art should understand that any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A method for improving the ability of silver crucian carp to resist crucian carp herpes virus, characterized in that: Using CRISPR / Cas9 gene editing technology, the irf10-B gene of silver crucian carp is specifically knocked out, and the mutant genotype individual in which the three alleles of irf10-B are terminated prematurely is the desired silver crucian carp with high resistance to crucian herpes virus; the irf10-B gene has two specific knockout target sites, and the sequences are shown in SEQ ID NO:1 and SEQ ID NO:2, and the allele sequences corresponding to the mutant genotype individual in which the three alleles B1, B2 and B3 of irf10-B are terminated prematurely are shown in SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, respectively.

2. A method for improving the ability of silver carp to resist herpesvirus according to claim 1, characterized in that: The specific method of the knockout is to inject a mixture of sgRNA and Cas9 protein containing the irf10-B specific knockout target site into the fertilized eggs of silver crucian carp to obtain F0 generation chimeras, and then raise the F0 generation silver crucian carp to sexual maturity and obtain the F1 generation through gynogenesis, and screen the F1 generation for mutant genotype individuals in which all three alleles of irf10-B are terminated prematurely, which is the desired silver crucian carp with high resistance to crucian herpes virus.

3. A method for improving the ability of silver carp to resist herpesvirus according to claim 2, characterized in that: The following steps are involved: S1. Obtain sgRNAs for the irf10-B specific knockout target site at a concentration of 1000-1500 ng / μL, namely irf10-B-sgRNA1 and irf10-B-sgRNA2, for use; S2. Take 2 μL of irf10-B-sgRNA1, 2 μL of irf10-B-sgRNA2 and 0.5 μL of Cas9 protein and mix them to obtain a mixed solution with a working concentration of 250-300 ng / μL, which is used for injection into fertilized eggs. The injection volume for each fertilized egg is 2 nL. S3. After the injection is completed, the fertilized eggs are hatched to obtain F0 generation chimeras, and the F0 generation is raised to sexual maturity and then subjected to gynogenesis to obtain F1 generation; S4. Select the silver crucian carp in which all three alleles of irf10-B in the F1 generation have premature termination mutations, which is the desired silver crucian carp resistant to crucian herpes virus.

4. A method for improving the ability of silver carp to resist crucian carp herpes virus according to claim 3, characterized in that, The method also includes a breeding step, in which the three alleles of irf10-B in the F1 generation are prematurely terminated and mutated, and the F2 generation is obtained again through female nuclear reproduction. The F2 generation is all the desired silver crucian carp resistant to crucian herpes virus.

5. A method for improving the ability of silver carp to resist herpesvirus according to claim 3, characterized in that: The fertilized eggs are obtained by mixing and fertilizing mature eggs of silver crucian carp and sperm of male Xingguo red carp.

6. A method for improving the ability of silver carp to resist herpesvirus according to claim 3, characterized in that: The specific operation of female reproduction of F1 and F2 generations is to mix the mature eggs of silver crucian carp with the sperm of male Xingguo red carp for fertilization and hatching to produce all-female offspring of silver crucian carp.

7. A method for improving the ability of silver carp to resist crucian carp herpes virus as claimed in claim 3, characterized in that: The method for preparing the sgRNA for specifically knocking out the target site of irf10-B is as follows: using primer pairs of irf10-B-sgRNA1-F and sgRNA-R and irf10-B-sgRNA2-F and sgRNA-R, and using pUC19-gRNA plasmid as a template for PCR amplification to obtain irf10-B-sgRNA1 and irf10-B-sgRNA2 fragments, and then performing in vitro sgRNA transcription on the irf10-B-sgRNA1 and irf10-B-sgRNA2 fragments, and purifying and recovering the transcription products to obtain the desired sgRNA; the sequence of the irf10-B-sgRNA1-F is shown in SEQ ID NO:6, the sequence of the irf10-B-sgRNA2-F is shown in SEQ ID NO:7, and the sequence of the sgRNA-R is shown in SEQ ID NO:

8.

8. A method for improving the ability of silver carp to resist herpesvirus according to claim 3, characterized in that: The method for selecting silver crucian carp in which the three alleles of irf10-B in the F1 generation have premature termination mutations is as follows: separately extract the genomic DNA of the fin rays of the F1 adult fish, use detection primers to perform PCR amplification, transform the amplified products into competent Escherichia coli, select positive single clones for sequencing, analyze the sequencing results, and select the mutant silver crucian carp whose sequences of the three alleles of irf10-B are shown in SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, respectively.

9. A method for improving the ability of silver carp to resist herpesvirus according to claim 8, characterized in that: The upstream primer sequence of the detection primer is shown in SEQ ID NO:9, and the downstream primer sequence is shown in SEQ ID NO:10.

Images