Nucleic acid composition for detecting FGFR2 gene fusion mutation in bile duct cancer and dPCR detection method

Abstract

The invention discloses a nucleic acid composition for detecting FGFR2 (Fibroblast Growth Factor Receptor 2) gene fusion mutation in bile duct cancer and a dPCR (Derived Polymerase Chain Reaction) detection method. According to the invention, the characteristic that most breakpoints of FGFR2-driven fusion genes are positioned at the 3'end of an FGFR217 exon is utilized, and a single-ended anchoring amplification technology and a dPCR detection technology are combined; therefore, a known fusion gene and an unknown fusion gene which take the FGFR2 as a driving gene can be detected on a digital PCR platform, and the problem that digital PCR detection targets are limited is solved. The detection method is convenient to operate, has the characteristics of high sensitivity, high accuracy, low cost and the like, and can be used as a clinical medication reference.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to a nucleic acid composition and a dPCR detection method for detecting FGFR2 gene fusion mutation in cholangiocarcinoma. Background Art

[0002] Intrahepatic cholangiocarcinoma (ICC) is an important subtype of cholangiocarcinoma (CCA), accounting for about 10%-20% of all primary liver cancers. ICC is a fatal primary liver cancer, but the early symptoms of ICC are not obvious. Patients are usually diagnosed in the late unresectable stage, with limited treatment options and poor prognosis. Therefore, timely diagnosis and treatment are urgently needed.

[0003] With the development of sequencing technology, the generation of fusion genes has been found to be one of the important driving factors for the occurrence and progression of cancer. In ICC, fusion genes driven by Fibroblast Growth Factor Receptor 2 (FGFR2) are one of the main types of mutated genes. More than 15% of ICC patients have FGFR2 gene fusion mutations, and there are many fusion partner genes of FGFR2 in ICC, and more than 150 have been found so far.

[0004] Previously, a number of preclinical and clinical trials have shown that FGFR inhibitors can effectively enhance the therapeutic effect of FGFR2 fusion-positive ICC patients. Therefore, effective FGFR2 fusion mutation detection methods are urgently needed to assist in the diagnosis and treatment of ICC. The current methods for detecting fusion genes mainly include chromosome karyotype analysis, fluorescence in situ hybridization (FISH), real-time fluorescence PCR (RT-PCR), and next-generation sequencing (NGS). The first two technologies are commonly used clinical auxiliary diagnostic methods, but their sensitivity is very limited. RT-PCR and NGS have high sensitivities, both of which can reach 1%, but RT-PCR has limited fusion gene targets and cannot detect unknown fusions. NGS can detect unknown fusion genes, but the detection cost is high and the detection cycle is long.

[0005] Regarding the RT-PCR detection method, Chinese patent document CN 112143815 B (application number 202011332715.9) discloses a nucleic acid composition, a kit and a detection method for detecting human FGFR2 gene fusion mutations. It is a real-time fluorescence PCR (RT-PCR) detection method: first, the RNA of the test sample is extracted and reverse transcribed into cDNA, and then the cDNA is used as a template using the above-mentioned kit for real-time fluorescence PCR reaction. Finally, the positive and negative of the test sample is determined according to the Ct value. It can simultaneously detect 18 fusion genes driven by FGFR2.

[0006] Regarding the NGS detection method, Chinese patent document CN 112301115 B (application number 202011001862.8) discloses a detection method and probe sequence for FGFRs gene mutation based on high-throughput sequencing, including the following steps: 1) extracting sample genomic DNA and total RNA; 2) fragmenting genomic DNA and recovering fragmented DNA; 3) performing total RNA shearing and / or primer hybridization according to the total RNA quality control; 4) synthesizing the first chain of cDNA; 5) synthesizing the second chain of cDNA; 6) mixing the fragmented DNA with cDNA to construct a mixed library; 7) using capture probes for hybridization and capture; 8) amplifying and purifying the library after capture; 9) high-throughput sequencing and mutation analysis. It can detect single-base mutations, insertion-deletion mutations, fusion mutations and relative expression analysis of FGFR1, FGFR2, FGFR3, and FGFR4 genes.

[0007] Digital PCR (dPCR) is an emerging absolute quantitative technology that can determine the absolute number of target molecules to be detected as low as a single copy by processing samples into micro-units, greatly improving the accuracy and sensitivity of detection, and is an effective detection method for fusion gene detection. However, conventional dPCR detection has the same limitations as RT-PCR, that is, the detection targets are limited and unknown fusions cannot be detected. Summary of the invention

[0008] The technical problem to be solved by the present invention is that the conventional method of detecting fusion genes using digital PCR can only detect known fusions and has limited detection targets; a method is provided that can detect known fusion genes and unknown fusion genes with FGFR2 as a driver gene on a digital PCR platform, and primers and probe sequences used for detection are provided.

[0009] The present invention combines single-end anchor amplification technology and dPCR detection technology to overcome the problem of limited detection targets.

[0010] The technical principle of the present invention is to introduce a fixed sequence (Uni) at the 5' end of cDNA in the reverse transcription (RT) stage as the upstream primer (Universal primer-F) binding site, and after reverse transcription into cDNA, select a sequence before the 3' end of FGFR217 exon as the downstream primer (GSPprimer-R) binding site, so that all sequences after FGFR217 exon can be fully amplified during dPCR. At the same time, a sequence is selected between the downstream primer binding site and the 3' end of FGFR217 exon as the binding site of the mutation probe (Fusion probe, 5' end fluorescent group labeled), and a sequence is selected on FGFR218 exon as the binding site of the wild-type probe (WT probe, 5' end fluorescent group labeled), and the 5' end labeled fluorescent groups of the Fusion probe and the WT probe are different. When the wild-type FGFR2 transcript is amplified, dual fluorescence labeled by Fusionprobe and WT probe is generated simultaneously. When the FGFR2 fusion transcript is amplified, only single fluorescence labeled by Fusion probe is generated, so that the FGFR2 fusion transcript and the FGFR2 wild-type transcript can be distinguished.

[0011] The technical solution to achieve the first object of the present invention is a nucleic acid composition for detecting FGFR2 gene fusion mutation in cholangiocarcinoma, comprising the following primers and probe sequences:

[0012] Reverse transcription primer Uni-N6, wherein the Uni sequence is any artificially synthesized fixed sequence, and N represents a random primer.

[0013] Universal primer F primer, Universal primer F primer is a sequence that is identical or partially identical to the Uni sequence of reverse transcription primer Uni-N6.

[0014] GSPprimer-R primer, GSPprimer-R primer is a sequence on exons 1-17 of the FGFR2 transcript.

[0015] Fusion probe probe, the Fusion probe probe is a sequence on exons 1-17 of the FGFR2 transcript, and the sequences of the GSPprimer-R primer and the Fusion probe probe are different.

[0016] WT probe: WT probe is any sequence on exon 18 of FGFR2 transcript.

[0017] The 5' end of the Fusion probe sequence is modified with a fluorescent group, and the 5' end of the WT probe sequence is modified with a fluorescent group, and the 5' end fluorescent groups of the Fusion probe and WT probe sequences are different.

[0018] The 3' end of the Fusion probe sequence is modified with a quenching group, and the 3' end of the WT probe sequence is modified with a quenching group.

[0019] Furthermore, the GSP primer-R and the Fusion probe are two sequences on exons 1-17 of the FGFR2 transcript NM_022970.3, and the Fusion probe is located in the downstream region of the GSPprimer-R primer position without overlapping; on the cDNA template, the Fusion probe is located in the upstream region of the GSPprimer-R primer position without overlapping.

[0020] The fluorescent group at the 5' end of the Fusion probe sequence is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5 fluorescent groups; the fluorescent group at the 5' end of the WT probe sequence is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5 fluorescent groups.

[0021] The quenching group at the 3' end of the Fusion probe sequence is one of BHQ1, BHQ2, BHQ3, Dabcyl and Eclipse quenching groups; the quenching group at the 3' end of the WT probe sequence is one of BHQ1, BHQ2, BHQ3, Dabcyl and Eclipse quenching groups; the 3' end of the Fusion probe and WT probe can also be modified with MGB, and the MGB is modified with a minor groove binder plus a NFQ quenching group.

[0022] Furthermore, the length of each primer or probe sequence is greater than or equal to 8 bases.

[0023] As an option, the gene sequence of the reverse transcription primer Uni-N6 is SEQ ID NO.1, SEQ ID NO.6 or SEQ ID NO.11, wherein N represents a random primer.

[0024] The gene sequence of Universal primer F is SEQ ID NO.2, SEQ ID NO.7 or SEQ ID NO.12.

[0025] The gene sequence of the GSPprimer-R primer is SEQ ID NO.3, SEQ ID NO.8 or SEQ ID NO.13.

[0026] The gene sequence of the Fusion probe is SEQ ID NO.4, SEQ ID NO.9 or SEQ ID NO.14.

[0027] The gene sequence of the WT probe is SEQ ID NO.5, SEQ ID NO.10 or SEQ ID NO.15.

[0028] In the Fusion probe and WT probe, "+" indicates locked nucleic acid LNA modification, 5'VIC and 5'FAM are modified with fluorescent groups, 3'BHQ1 is modified with a quenching group, and 3'MGB is modified with a 3' end-linked minor groove binding (MGB) plus a NFQ quenching group.

[0029] The technical solution for achieving the second purpose of the present invention is a dPCR detection method for FGFR2 gene fusion mutation in cholangiocarcinoma: after the RNA of the sample to be tested is extracted, a fixed sequence Uni is introduced at the 5' end of the cDNA in the reverse transcription stage, the upstream primer Universal primer-F in the digital PCR stage is bound to the Uni sequence, the downstream primer GSPprimer-R is bound to a sequence before the 3' end of FGFR2 exon 17, the mutation probe Fusion probe is bound to a sequence between the downstream primer binding site and the 3' end of FGFR2 exon 17, and the wild-type probe WT probe is bound to a sequence of FGFR2 exon 18.

[0030] The Uni sequence is any artificially synthesized fixed sequence, and the length of the fixed sequence is greater than or equal to 8 bases.

[0031] Universal primer F is a sequence that is identical or partially identical to the Uni sequence, and the primer length is greater than or equal to 8 bases.

[0032] The GSPprimer-R primer and the Fusion probe are two different sequences on exons 1-17 of the FGFR2 transcript, and the Fusion probe is located in the downstream region of the GSPprimer-R primer position. On the cDNA template, the Fusion probe is located in the upstream region of the GSPprimer-R primer position without overlap. The GSPprimer-R primer is greater than or equal to 8 bases in length, and the Fusion probe is greater than or equal to 8 bases in length.

[0033] The WT probe is any sequence on exon 18 of the FGFR2 transcript, and the length of the WT probe is greater than or equal to 8 bases.

[0034] The 5' end of the Fusion probe sequence is modified with a fluorescent group, and the 5' end of the WT probe sequence is modified with a fluorescent group, and the 5' end fluorescent groups of the Fusion probe and WT probe sequences are different.

[0035] The 3' end of the Fusion probe sequence is modified with a quenching group, and the 3' end of the WT probe sequence is modified with a quenching group.

[0036] After the PCR amplification reaction, the amplified droplets were tested for fluorescence signals, and the copy numbers of the FGFR2 wild-type transcript and fusion transcript were calculated using the insertion-deletion analysis method. According to the droplet fluorescence distribution, the insertion-deletion analysis method was used to make a judgment: when the FGFR2 wild-type transcript was amplified, dual fluorescence marked by the Fusion probe and the WT probe was generated, and when the FGFR2 fusion transcript was amplified, only single fluorescence marked by the Fusion probe was generated, which distinguished the FGFR2 wild-type transcript and the FGFR2 fusion transcript. If the total copy number of the mutant gene calculated by the insertion-deletion analysis was ≥1, it was judged to be positive, and if the total copy number of the mutant gene was <1, it was judged to be no positive.

[0037] Among them, the extracted RNA contains mRNA.

[0038] When RNA is reverse transcribed into cDNA, a reverse transcription reaction mixture is first prepared on ice, and the reverse transcription reaction mixture includes a reverse transcription buffer, a reverse transcriptase, a Uni-N6 primer, an RNA template, and enzyme-free water; in the Uni-N6 primer, the Uni sequence is any artificially synthesized fixed sequence, the fixed sequence length is greater than or equal to 8 bases, and N represents a random primer.

[0039] Optionally, the digital PCR stage includes the following steps:

[0040] S3-1. Prepare PCR system, including primers, probes, reaction buffer PCR buffer, DNA polymerase, cDNA and enzyme-free water. Primers and probes include Universal primer-F, GSPprimer-R, Fusion probe and WT probe.

[0041] S3-2. Use a droplet generation instrument to prepare the obtained PCR reaction system into droplets of uniform size.

[0042] S3-3. The droplets are subjected to an amplification reaction on a digital PCR instrument. After the reaction is completed, the fluorescence signal of the amplified droplets is detected, and the copy number of the FGFR2 wild-type transcript and the fusion transcript is calculated using the insertion and deletion analysis method.

[0043] The fluorescent group at the 5' end of the above-mentioned Fusion probe sequence is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5 fluorescent groups; the fluorescent group at the 5' end of the WT probe sequence is one of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5 fluorescent groups.

[0044] The quenching group at the 3' end of the above-mentioned Fusion probe sequence is one of BHQ1, BHQ2, BHQ3, Dabcyl and Eclipse quenching groups; the quenching group at the 3' end of the WT probe sequence is one of BHQ1, BHQ2, BHQ3, Dabcyl and Eclipse quenching groups; the 3' end of the Fusion probe and WT probe can also be modified with MGB, and the MGB is modified with a minor groove binder plus a NFQ quenching group.

[0045] The invention has positive effects:

[0046] (1) The present invention utilizes the characteristic that the breakpoints of most FGFR2-driven fusion genes are located at the 3' end of FGFR2 exon 17 (most FGFR2-driven fusion genes have a fixed structural pattern: at the N-terminus, the fusion genes share an almost identical FGFR2 portion, including a complete kinase domain (FGFR2 exon 1-17); at the C-terminus, there is a dimerization / oligomerization domain provided by different fusion partner genes, including Bicaudal family RNA binding protein 1 (BICC1), adenosine homocysteinease 1 (AHCYL1) and Periphilin 1 (PPHLN1), etc. This pattern shows that the breakpoints of most FGFR2-driven fusion genes in cholangiocarcinoma are located at the 3' end of FGFR2 exon 17), combined with single-end anchor amplification technology and dPCR detection technology, so that known fusion genes and unknown fusion genes with FGFR2 as the driving gene can be detected on a digital PCR platform, solving the problem of limited detection targets of digital PCR. The present invention is also applicable to the detection of other fusion gene types having the same characteristics as the FGFR2 fusion gene, namely, a unique fusion breakpoint position on the driver gene.

[0047] (2) The detection method of the present invention is easy to operate and has the characteristics of high sensitivity, high accuracy and low cost, and can be used as a reference for clinical drug use. BRIEF DESCRIPTION OF THE DRAWINGS

[0048] Figure 1 This is the schematic diagram of the present application.

[0049] Figure 2 This is the test result of RNA disruption sample of FGFR2-Casp7 fusion cell line.

[0050] Figure 3 This is the test result of RNA disruption sample of FGFR2-BICC1 fusion cell line.

[0051] Figure 4 This is the positive sample detection result of the primer-probe system of Example 2 in Experimental Example 2.

[0052] Figure 5 This is the positive sample detection result of the primer-probe system of Example 3 in Experimental Example 2.

[0053] Figure 6 The results are the repeatability of the test under different RNA input amounts.

[0054] Figure 7 This is a graph showing the test results of clinically positive samples. DETAILED DESCRIPTION

[0055] Introduced below are some of the multiple possible embodiments of the present invention, which are intended to provide a basic understanding of the present invention, and are not intended to confirm the key or decisive elements of the present invention or to limit the scope of protection. It is easy to understand that according to the technical solution of the present invention, without changing the essential spirit of the present invention, a person of ordinary skill in the art can propose other mutually replaceable implementations. Therefore, the following specific embodiments are only exemplary descriptions of the technical solution of the present invention, and should not be regarded as the whole of the present invention or as a limitation or restriction to the technical solution of the present invention.

[0056] (Example 1)

[0057] The primer probe sequence information used in this example is as follows: the Universal primer-F sequence is a sequence that is partially identical to the Uni sequence of the RT primer (Uni-N6); the GSPprimer-R sequence is the base sequence of positions 2886-2905 in the Exon1-17 region of the FGFR2 transcript (NM_022970.3); the Fusion probe sequence is the base sequence of positions 2920-2941 in the Exon1-17 region of the FGFR2 transcript (NM_022970.3); and the WT probe sequence is the base sequence of positions 11-28 on Exon18 of the FGFR2 transcript (NM_022970.3).

[0058]

[0059]

[0060] See Figure 1 The dPCR detection method for RNA fusion mutation of FGFR2 in cholangiocarcinoma of this embodiment comprises the following steps:

[0061] S1. Extraction of genomic RNA from samples to be tested.

[0062] The wax blocks of the samples to be tested were cut into 10 μm tissue sections and, after dewaxing, were sliced ​​using Qiagen DSP FFPEKit RNA Extraction Kit (Cat. No. 73604) extracts genomic RNA from the sample to be tested to obtain 20 μL of total RNA with a concentration of 100-300 ng / μL.

[0063] Any extraction method that extracts RNA including mRNA can be used.

[0064] Specifically, the RNA extraction method can be any one of the extraction methods such as phenol-chloroform method, silica gel column method, magnetic bead method, Trizol method and RNeasy method, or a commercial RNA extraction kit can be directly used.

[0065] S2. RNA is reverse transcribed into cDNA. During the reverse transcription (RT) stage, a fixed sequence Uni-N6 is introduced into the 5' end of the cDNA as the upstream primer (Universal primer-F) binding site.

[0066] First, prepare the following reverse transcription reaction mixture on ice: 2 μL of 5X PrimeScript Buffer, 0.5 μL of PrimeScript RT Enzyme Mix I, 2 μL of Uni-N6 primer (10 μM), and 20 ng of RNA template, and add enzyme-free water to 10 μL.

[0067] In Uni-N6, the Uni sequence is any artificially synthesized fixed sequence, and N represents a random primer.

[0068] In this embodiment, the sequence number of Uni-N6 is SEQ ID NO.1, and the gene sequence is: 5'

[0069] TTCCCTACACGACGCTCTTCCGATCTNNNNNN 3', where N represents a random primer.

[0070] Reverse transcription buffer (5X PrimeScript Buffer) and reverse transcriptase (PrimeScript RT Enzyme) were ordered from Bio-Rad Biotechnology (Beijing) Co., Ltd. (Cat. No.: RR037A). The amount of RNA template input can be adjusted according to the sample type and experimental purpose, and in this example, it is 20 ng.

[0071] Then perform the reverse transcription reaction according to the following conditions:

[0072] temperature time 37℃ 15min 85℃ 5s 4℃ Incubate until reverse transcription is complete

[0073] S3, digital PCR reaction, the present invention adopts digital PCR based on chip plate.

[0074] After inversion to cDNA, the upstream primer (Universal primer-F) binds to a fixed sequence (Uni) introduced at the 5' end of cDNA, and the downstream primer (GSPprimer-R) binds to a sequence before the 3' end of FGFR2 exon 17, so that the entire sequence after FGFR2 exon 17 can be fully amplified during dPCR. At the same time, the mutation probe (Fusion probe, 5' end VIC label) binds to a sequence between the downstream primer binding site and the 3' end of exon 17, and the wild-type probe (WTprobe, 5' end FAM label) binds to a sequence on FGFR2 exon 18.

[0075] Wherein, Universal primer F is a sequence that is identical or partially identical to the Uni sequence of reverse transcription primer Uni-N6, and the primer length is greater than or equal to 8 bases.

[0076] In this embodiment, the GSPprimer-R primer and the Fusion probe are two sequences on exons 1-17 of the FGFR2 transcript NM_022970.3, and the Fusion probe is in the downstream region of the GSPprimer-R primer position and does not overlap. On the cDNA template, the Fusion probe is in the upstream region of the GSPprimer-R primer position and does not overlap. The GSPprimer-R primer length is greater than or equal to 8 bases, and the Fusion probe length is greater than or equal to 8 bases. Any two sets of sequences that meet the above position and length relationship in the exon region 1-17 can be the GSPprimer-R primer and the Fusion probe.

[0077] The WT probe is any sequence on exon 18 of the FGFR2 transcript NM_022970.3, and the length of the WT probe is greater than or equal to 8 bases.

[0078] The specific operations in this embodiment are as follows.

[0079] S3-1. After reverse transcription is completed, take 2.5 μL of the reaction product as an amplification template and prepare the following PCR system at room temperature:

[0080]

[0081]

[0082] In the system, the gene sequence of Universal primer-F is: 5'TTCCCTACACGACGCTCT 3'.

[0083] The gene sequence of GSPprimer-R is: 5'CAGAGACCAACGTTCAAGCA 3'.

[0084] The gene sequence of the Fusion probe is: 5'VIC TGGA+TCG+AATT+CTCAC+TCTCAC 3'BHQ1.

[0085] The gene sequence of WT probe is: 5'FAMACC+TCA+GCCA+ACCT+CTCG 3'BHQ1.

[0086] The “+” indicates locked nucleic acid (LNA) modification, 5’VIC and 5’FAM are fluorescent group modifications, and 3’BHQ1 is a quencher group modification.

[0087] The fluorescent group at the 5' end of the Fusion probe and the WT probe is one of the fluorescent groups of FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, and Cyc5.5, and the fluorescent groups at the 5' end of the Fusion probe and the WT probe are different.

[0088] In addition to the BHQ1 mentioned above, the quenching group at the 3' end of the Fusion probe and WT probe can also be one of BHQ2, BHQ3, Dabcyl and Eclipse quenching groups; the group at the 3' end of the Fusion probe and WT probe can also be modified with MGB, which is a minor groove binder modified with a NFQ quenching group.

[0089] In addition, the 5X DNA Master mix in this example was ordered from Roche (Cat. No.: 09393544001). The 5X DNA Master mix includes a reaction buffer (PCR buffer), a DNA polymerase, and the input amounts of the cDNA template and the primer probe can be adjusted according to the experimental requirements.

[0090] S3-2. The obtained PCR reaction system was prepared into droplets of uniform size using a Roche Digital LC sample splitter. The droplet size was about 1 nL.

[0091] S3-3, for droplets, the following conditions were used in Roche Digital Amplification reaction and fluorescence signal detection on digital PCR instrument:

[0092]

[0093] After the reaction was completed, the digital PCR analysis software (Roche The insertion and deletion analysis method of the Gene Development Software was used to calculate the copy number of the wild-type and fusion transcripts of FGFR2, and the droplet fluorescence distribution was combined to make a judgment: when the wild-type transcript of FGFR2 was amplified, both VIC fluorescence and FAM fluorescence were generated, and when the fusion transcript of FGFR2 was amplified, only VIC fluorescence was generated, thereby distinguishing the FGFR2 fusion transcript from the wild-type transcript of FGFR2. If the total copy number of the mutant gene calculated by the insertion and deletion analysis was ≥1, it was judged that there was a positive detection; if the total copy number of the mutant gene was <1, it was judged that there was no positive detection.

[0094] Because the wild-type probe (FAM) and the fusion probe (VIC) exist in the system at the same time, double positive droplets (droplets that produce both FAM fluorescence and VIC fluorescence), VIC single positive droplets (droplets that only produce VIC fluorescence) and negative droplets (droplets without excitation fluorescence) will appear in the theoretical detection results. Double positive droplets are wild-type transcripts or wild-type transcripts and fusion transcripts exist at the same time, VIC single positive droplets are fusion transcripts, and the copy number calculation method refers to Roche's insertion and deletion analysis algorithm. In theory, the number of VIC single positive droplets is greater than 1, which indicates the presence of FGFR2 fusion targets.

[0095] (Example 2)

[0096] The rest of the dPCR detection method for RNA fusion mutation of FGFR2 in cholangiocarcinoma in this embodiment is the same as that in the embodiment, except that in the corresponding steps, the primer probe sequence information used is as follows: the Universal primer-F sequence is a sequence that is exactly the same as the fixed sequence of the RT primer (Uni-N6); the GSP primer-R sequence is the base sequence of positions 2876-2892 in the Exon1-17 region of the FGFR2 transcript (NM_022970.3); the Fusion probe sequence is the base sequence of positions 2905-2923 in the Exon1-17 region of the FGFR2 transcript (NM_022970.3); the WT probe sequence is the base sequence of positions 97-113 on Exon18 of the FGFR2 transcript (NM_022970.3).

[0097]

[0098] (Example 3)

[0099] The rest of the dPCR detection method for RNA fusion mutation of FGFR2 in cholangiocarcinoma in this embodiment is the same as that in the embodiment, except that in the corresponding steps, the primer probe sequence information used is as follows: the Universal primer-F sequence is a sequence that is identical to the fixed sequence portion of the RT primer (Uni-N6); the GSP primer-R sequence is the base sequence of positions 2850-2870 in the Exon1-17 region of the FGFR2 transcript (NM_022970.3); the Fusion probe sequence is the base sequence of positions 2883-2906 in the Exon1-17 region of the FGFR2 transcript (NM_022970.3); the WT probe sequence is the base sequence of positions 135-162 on Exon18 of the FGFR2 transcript (NM_022970.3).

[0100]

[0101] (Experimental Example 1, Effectiveness Experiment 1)

[0102] 20 ng of the interrupted FGFR2-Casp7 fusion cell line RNA and FGFR2-BICC1 fusion cell line RNA were used as positive templates (the length of the interrupted RNA was 200-2000 nt), and 20 ng of the normal liver cell line LO2 RNA was used as a negative control. Reverse transcription and PCR amplification were performed according to the RT system of Example 1. After the program was completed, the Roche digital PCR analysis software (Digital Development Software) for data analysis. Based on the droplet fluorescence distribution, combined with the insertion and deletion analysis method, it is determined whether there is a positive detection. The experimental results are shown in Figure 2 and Figure 3 .

[0103] The results were interpreted mainly based on the fluorescence intensity reading results, and cluster analysis was performed using 2D scatter plots. First, the fluorescence intensity of each negative experimental group was used as a reference, and the two fluorescence channels (FAM+VIC) were thresholded. After the threshold was divided, the result map can be divided into four quadrants. The first quadrant is the double positive droplet area that excites FAM and VIC fluorescence at the same time, the second quadrant is the single positive droplet area that only excites FAM fluorescence, the third quadrant is the droplet area without any excitation fluorescence, that is, the negative droplet area, and the fourth quadrant is the single positive droplet area that only excites VIC fluorescence.

[0104] According to the principle of this technology, the amplification of the FGFR2 wild-type template will simultaneously excite FAM and VIC fluorescence, and the droplets will gather in the first quadrant. When the FGFR2 fusion template is amplified, only VIC will be excited, and the droplets will gather in the fourth quadrant. Negative droplets without any excited fluorescence should gather in the third quadrant.

[0105] from Figure 2 and Figure 3 It can be seen that no positive droplets appeared in the negative experimental group, indicating that there was no non-specific amplification in this system, while the first and fourth quadrants of the fusion positive template experimental group (left one) showed obvious droplet aggregation, that is, there were double positive droplets and VIC single positive droplets, corresponding to FGFR2 wild-type detection and FGFR2 fusion detection, respectively, and the fusion copy number calculated by the insertion and deletion method was greater than 1. This result was in line with expectations and was valid.

[0106] The above experimental results show that this protocol can simultaneously detect and distinguish FGFR2 wild-type targets and FGFR2 fusion targets. In addition to the two groups of FGFR2-driven fusion genes verified in the above experiments, this protocol is also suitable for the detection of other FGFR2-driven fusion targets.

[0107] (Experimental Example 2, Effectiveness Experiment 2)

[0108] 20 ng of the interrupted FGFR2-Casp7 fusion cell line RNA was used as a positive template, and 20 ng of the normal liver cell line LO2 RNA was used as a negative control. Reverse transcription was performed according to the RT system of Example 1, and 2.5 μL of the RT product was taken for PCR amplification according to the primer and probe systems of Examples 2 and 3. After the program was completed, the Roche digital PCR analysis software (Digital Development Software) for data analysis. Based on the droplet fluorescence distribution, combined with the insertion and deletion analysis method, it is determined whether there is a positive detection. The experimental results are shown in Figure 4 (Example 2) and Figure 5 (Example 3).

[0109] from Figure 4 and Figure 5 It can be seen that both positive experimental groups produced double positive droplets and VIC single positive droplets, and the negative experimental group produced almost no positive droplets, and the fusion copy number calculated by the insertion and deletion analysis method was greater than 1. This shows that the above two sets of primer probe systems can also effectively detect and distinguish FGFR2 wild type and FGFR2 fusion targets.

[0110] (Test Example 3, Repeatability Experiment)

[0111] To determine the detection stability of the FGFR2 fusion detection method, the interrupted FGFR2-Casp7 fusion cell line RNA was used as the positive template, and three gradient RNA input experimental groups of 20ng, 10ng and 5ng were set up. At the same time, 20ng of normal liver cell line LO2 RNA was used as the negative control, and each group was repeated 5 times. The RT system was prepared and reverse transcribed according to Example 1, and then 2μL of RT product was taken for PCR amplification. After the program was completed, the Roche digital PCR analysis software (Digital Development Software) was used for data analysis, and the number of wild-type and fusion copies of FGFR2 in each experimental group was counted by insertion and deletion analysis. The experimental results are shown in Figure 6 and Table 1.

[0112] Table 1: Repeated detection copy number at different RNA input amounts

[0113]

[0114] from Figure 6 It can be seen that this scheme can achieve specific detection of FGFR2 wild-type and fusion targets for 5-20ng positive samples.

[0115] Table 1 shows that the wild-type detection difference of the replicate group at 5 ng input is as high as 20%, which may be due to the low input of wild-type target RNA. However, at 10 ng and 20 ng input, the difference in fusion and copy number detection of the five replicate experimental groups is basically less than 10%, indicating that the detection repeatability of this scheme is good within the detection limit.

[0116] (Test Example 4, Clinical Positive Sample Detection)

[0117] 20 ng of each of three clinical RNA samples (clinical samples 1-3) that have been verified to be positive for both FGFR2-BICC1 and FGFR2-Casp7 fusions were taken, and 20 ng of normal liver cell line LO2 RNA was used as a negative control. Reverse transcription and PCR amplification were performed according to the RT system of Example 1. The Roche digital PCR analysis software (Digital Data analysis was performed using the software Development Software. The insertion and deletion analysis method was used to count the FGFR2 wild-type and fusion copy numbers in each experimental group. Figure 7 and Table 2.

[0118] Table 2: FGFR2 fusion and wild-type transcript copy numbers in clinical positive samples

[0119] sample Fusion (copies / μL) Wild type (copies / μL) Fusion (copies / ng) Wild type (copies / ng) Clinical Sample 1 2.9564 0.0364 17.7384 0.2184 Clinical Sample 2 0.4313 0.0719 2.5878 0.4314 Clinical Sample 3 2.3193 1.5912 13.9158 9.5472

[0120] from Figure 7 It can be seen that there is a more obvious VIC single-positive droplet aggregation in the fourth quadrant of the result graph of the three clinical samples, indicating that FGFR2 fusion targets exist in all three samples, which is consistent with the clinical test results.

[0121] The FGFR2 wild-type copy number and fusion copy number in each sample obtained after data analysis and conversion are shown in Table 2, where fusion / wild-type (copies / μL) is the output result of the analysis software, and fusion / wild-type (copies / ng) is the converted target concentration in the sample. The results show that in the 30μL system, the total copy number of the mutant gene calculated by the three groups of clinical samples is greater than 1 (total copy number = concentration (copies / μL) × volume (30μL)), indicating that FGFR2 fusion is positive. The above experimental results prove that the detection results of this protocol are consistent with the clinical detection results.

Claims

1. A nucleic acid composition for detecting FGFR2 gene fusion mutation in cholangiocarcinoma, comprising the following primer and probe sequences: Reverse transcription primer Uni-N6, where the Uni sequence is any artificially synthesized fixed sequence and N represents a random primer; Universal primer F primer, Universal primer F primer is a sequence identical or partially identical to the Uni sequence of reverse transcription primer Uni-N6; GSPprimer-R primer, GSPprimer-R primer is a sequence on exons 1-17 of the FGFR2 transcript; Fusion probe, which is a sequence on exons 1-17 of the FGFR2 transcript, and the sequences of the GSPprimer-R primer and the Fusion probe are different; WTprobe probe, WTprobe probe is any sequence on exon 18 of FGFR2 transcript; The 5' end of the Fusion probe sequence is modified with a fluorescent group, and the 5' end of the WT probe sequence is modified with a fluorescent group, and the 5' end fluorescent groups of the Fusionprobe and WTprobe sequences are different; The 3' end of the Fusion probe sequence is modified with a quenching group, and the 3' end of the WTprobe sequence is modified with a quenching group.

2. The nucleic acid composition for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: The GSPprimer-R primer and Fusionprobe probe are two different sequences on exons 1-17 of the FGFR2 transcript NM_022970.

3.

3. The nucleic acid composition for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: The fluorescent group at the 5' end of the Fusion probe sequence is one of the following: FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, or Cyc5.5; the fluorescent group at the 5' end of the WTprobe sequence is one of the following: FAM, HEX, VIC, TET, ROX, TAMRA, JOE, Cy3, Cy5, or Cyc5.

5.

4. The nucleic acid composition for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: The quenching group at the 3' end of the Fusion probe sequence is one of BHQ1, BHQ2, BHQ3, Dabcyl, Eclipse quenching group and MGB; the quenching group at the 3' end of the WTprobe sequence is one of BHQ1, BHQ2, BHQ3, Dabcyl, Eclipse quenching group and MGB; among them, MGB is a minor groove binder modified with a NFQ quenching group.

5. The nucleic acid composition for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to any one of claims 1 to 4, characterized in that: The length of each primer or probe sequence is greater than or equal to 8 bases.

6. The nucleic acid composition for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 1, characterized in that: The gene sequence of the reverse transcription primer Uni-N6 is SEQ ID NO.1, SEQ ID NO.6 or SEQ ID NO.11, wherein N represents a random primer; The gene sequence of Universal primer F is SEQ ID NO.2, SEQ ID NO.7 or SEQ ID NO.12; The gene sequence of the GSPprimer-R primer is SEQ ID NO.3, SEQ ID NO.8 or SEQ ID NO.13; The gene sequence of the Fusion probe is SEQ ID NO.4, SEQ ID NO.9 or SEQ ID NO.14; The gene sequence of the WTprobe probe is SEQ ID NO.5, SEQ ID NO.10 or SEQ ID NO.15; In the Fusion probe and WTprobe probe, "+" indicates locked nucleic acid LNA modification, 5'VIC and 5'FAM are modified with fluorescent groups, 3'BHQ1 is modified with a quenching group, and 3'MGB is modified with a 3' end-linked minor groove binder plus a NFQ quenching group.

7. A dPCR detection method for FGFR2 gene fusion mutation in cholangiocarcinoma, characterized by: After RNA of the sample to be tested is extracted, a fixed sequence Uni is introduced at the 5' end of cDNA in the reverse transcription stage. In the digital PCR stage, the upstream primer Universal primer-F binds to the Uni sequence, the downstream primer GSPprimer-R binds to a sequence before the 3' end of exon 17 of FGFR2, the mutation probe Fusion probe binds to a sequence between the downstream primer binding site and the 3' end of exon 17 of FGFR2, and the wild-type probe WTprobe binds to a sequence of exon 18 of FGFR2; The Uni sequence is any artificially synthesized fixed sequence; Universal primer F is a sequence identical or partially identical to the Uni sequence; The GSPprimer-R primer and the Fusion probe are two different sequences on exons 1-17 of the FGFR2 transcript; The WTprobe probe is any sequence on exon 18 of the FGFR2 transcript; The 5' end of the Fusion probe sequence is modified with a fluorescent group, and the 5' end of the WT probe sequence is modified with a fluorescent group, and the 5' end fluorescent groups of the Fusionprobe and WTprobe sequences are different; The 3' end of the Fusionprobe sequence is modified with a quenching group, and the 3' end of the WTprobe sequence is modified with a quenching group; After the amplification reaction, the fluorescence signal of the amplified droplets was detected, and the copy number of the FGFR2 wild-type transcript and the fusion transcript was calculated using the insertion and deletion analysis method; according to the droplet fluorescence distribution, the insertion and deletion analysis method was used to determine that when the FGFR2 wild-type transcript was amplified, dual fluorescence marked by the Fusion probe and the WT probe was generated, and when the FGFR2 fusion transcript was amplified, only single fluorescence marked by the Fusion probe was generated, thereby distinguishing the FGFR2 wild-type transcript and the FGFR2 fusion transcript; the total copy number of the mutant gene was calculated by the insertion and deletion analysis.

8. The dPCR detection method for FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 7, characterized in that: The extracted RNA contains mRNA.

9. The dPCR detection method for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 7, characterized in that: When RNA is reverse transcribed into cDNA, a reverse transcription reaction mixture is first prepared on ice. The reverse transcription reaction mixture includes reverse transcription buffer, reverse transcriptase, Uni-N6 primer, RNA template and enzyme-free water. In Uni-N6 primer, the Uni sequence is any artificially synthesized fixed sequence with a length greater than or equal to 8 bases, and N represents a random primer.

10. The dPCR detection method for detecting FGFR2 gene fusion mutation in cholangiocarcinoma according to claim 7, characterized in that The digital PCR stage includes the following steps: S3-1. Prepare PCR system, including primers, probes, reaction buffer PCR buffer, DNA polymerase, cDNA and enzyme-free water. Primers and probes include Universal primer-F, GSPprimer-R, Fusionprobe and WTprobe; S3-2, using a droplet generation instrument to prepare the obtained PCR reaction system into droplets of uniform size; S3-3. The droplets are subjected to an amplification reaction on a digital PCR instrument. After the reaction is completed, the fluorescence signal of the amplified droplets is detected, and the copy number of the FGFR2 wild-type transcript and the fusion transcript is calculated using the insertion and deletion analysis method.

Images