Application of quantitative detection agent of circular RNA circDGCR8 in preparation of detection kit for predicting recurrence after atrial fibrillation radiofrequency ablation operation
By applying the quantitative detector of circular RNA circDGCR8 in the detection kit, the problems of high subjectivity and molecular instability of existing prediction methods are solved, and efficient and reliable prediction of recurrence after radiofrequency ablation of atrial fibrillation is achieved.
Patent Information
- Application Number
- CN202411619312.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-13
- Publication Date
- 2025-02-11
AI Technical Summary
The existing methods used to predict recurrence after radiofrequency ablation of atrial fibrillation have problems with high subjectivity and low predictive repeatability. At the same time, existing molecules are unstable in peripheral blood and are susceptible to factors such as collection and storage time.
The circular RNA circDGCR8 was used as a predictive marker, and the specificity and stability of circDGCR8 were used to predict recurrence after atrial fibrillation radiofrequency ablation was used.
The prediction of strong specificity and high sensitivity of recurrence after radiofrequency ablation of atrial fibrillation was achieved, and the circular RNA circDGCR8 was stable in peripheral blood and was less affected by intraday variable factors.
Smart Images
Figure CN119410768A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular biology, and in particular to an application of a quantitative detection agent of circular RNA circDGCR8 in preparing a detection kit for predicting recurrence of atrial fibrillation after radiofrequency ablation. Background Art
[0002] Atrial fibrillation is a common atrial arrhythmia disease. It can cause decreased activity tolerance, heart failure, stroke, and kidney damage in clinical practice, which seriously threatens human health. There are many clinical treatments for atrial fibrillation, including drug therapy, radiofrequency ablation (RFCA), and surgical treatment. With the continuous innovation of atrial mapping electrodes and ablation catheters in recent years, the success rate of radiofrequency ablation in curing atrial fibrillation has continued to increase, and it has become a new trend in the treatment of atrial fibrillation. However, after radiofrequency ablation, a certain proportion of patients will experience recurrence, especially those with atrial fibrillation. Therefore, it is very necessary to prevent and detect the recurrence of atrial fibrillation after radiofrequency ablation.
[0003] At present, the clinical methods for predicting the recurrence of atrial fibrillation after radiofrequency ablation are mainly based on the time when the patient develops atrial fibrillation and the assessment of the size of the left atrium by cardiac ultrasound. Such methods are highly subjective and the repeatability of predicting postoperative outcomes is not high. Although some molecular biological methods for predicting recurrence through peripheral blood proteins and microRNAs have emerged, the existing molecules used to predict postoperative recurrence are unstable in peripheral blood and are greatly affected by factors such as blood collection time and blood storage time, and are not very ideal.
[0004] Circular RNA (circRNA) is a type of non-coding RNA widely found in mammals in recent years. It is abundantly expressed and is formed by variable splicing of special reverse-complementary precursor mRNA. Unlike traditional linear RNA (linear RNA) with 5' and 3' ends, circRNA is connected end to end to form a closed circular structure. The closed circular structure of circRNA makes it more stable than linear RNA and can withstand degradation by nuclease exonucleases. At the same time, the expression of circRNA is tissue and cell type specific, and abundant circRNA can also be detected in blood, saliva, urine or exosomes. These characteristics of circRNA indicate that it has the potential to be used as a disease diagnostic marker.
[0005] Therefore, searching for these circular RNAs for the prediction of recurrence after radiofrequency ablation of atrial fibrillation has important research and clinical application value.
[0006] In view of this, the present invention is proposed. Summary of the invention
[0007] The purpose of the present invention is to provide an application of circular RNA circDGCR8 as a detection marker for predicting recurrence after radiofrequency ablation of atrial fibrillation, so as to alleviate the problems that the existing methods for predicting recurrence after radiofrequency ablation of atrial fibrillation are highly subjective, and the existing molecules for predicting postoperative recurrence are unstable in peripheral blood and are easily affected by factors such as blood collection time and blood storage time.
[0008] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:
[0009] According to one aspect of the present invention, the present invention provides a use of a quantitative detection agent of a circular RNA biomarker ARCR (atrial remodeling-associated circular RNA) in the preparation of a detection kit for predicting recurrence of atrial fibrillation after radiofrequency ablation;
[0010] Note: ARCR: Atrial-remodeling Related Circular RNA.
[0011] The circular RNA biomarker ARCR is circular RNA circDGCR8, which is included in circbase and named hsa_circ_0001204, and has a nucleotide sequence shown in SEQ ID NO.1.
[0012] The specific SEQ ID NO:1 sequence is as follows: GGTTTTGTCCACCTTGTGTCTGTAG CATCTAGGATGGTGTGTGTGTGTGTGATGAATGGAGAAAGCTTATAGA GGGGAGGAAGGAACTTGCCCAGGACTGCCCACCACTGAGGTCTGGGGCTGGGCAG.
[0013] The present invention uses circRNA high-throughput chip technology and bioinformatics analysis, as well as expanding the sample size of patients with recurrence after radiofrequency ablation of atrial fibrillation to verify that circular RNA circDGCR8 is correlated with the persistence of atrial fibrillation. Further in vitro experiments, after characterizing the atrial fibroblast model of atrial remodeling, knockdown overexpression experiments, and cell function experiments, it was found that ARCR was also significantly correlated with atrial remodeling at the functional and molecular mechanism levels. Therefore, the present invention studies it as a biomarker for predicting recurrence after radiofrequency ablation of atrial fibrillation. It has been found through research that the use of the circular RNA circDGCR8 of the present invention to predict recurrence after radiofrequency ablation of atrial fibrillation has a good predictive effect. At the same time, circular RNA is not easily degraded and is relatively stable in peripheral blood. Peripheral plasma stored at room temperature can achieve stable preservation of the molecule. In addition, it is also less affected by intraday variable factors such as day and night conclusions and diet.
[0014] In a preferred embodiment of the present invention, the quantitative detection agent of circular RNA circDGCR8 comprises a reagent suitable for at least one of the following methods:
[0015] Fluorescent dye method, digital PCR, resonance light scattering, real-time fluorescence quantitative PCR or sequencing.
[0016] In a preferred embodiment of the present invention, the quantitative detection agent of circular RNA circDGCR8 comprises:
[0017] A probe or primer that can specifically bind to circular RNA circDGCR8 or cDNA corresponding to circular RNA circDGCR8.
[0018] In the above preferred embodiment, the quantitative detection agent of circular RNA circDGCR8 comprises:
[0019] The qRT-PCR primers of circular RNA circDGCR8, the upstream primer is shown as SEQ ID NO.2, and the downstream primer is shown as SEQ ID NO.3.
[0020] The specific sequence of SEQ ID NO: 2 is as follows: 5'-GCTGGGCAGGGTTTTGTC-3'.
[0021] The specific sequence of SEQ ID NO: 3 is as follows: 5'-CACACACCATCCTAGATGCTAC A-3'.
[0022] In a preferred embodiment of the present invention, the quantitative detection agent of circular RNA circDGCR8 further includes an internal reference primer.
[0023] Preferably, the internal reference primer is a primer of the internal reference housekeeping gene GAPDH, and its upstream primer is shown as SEQ ID NO.4; and its downstream primer is shown as SEQ ID NO.5.
[0024] The specific sequence of SEQ ID NO: 4 is as follows: 5'-CATGAGAAGTATGACAACAGCC T-3'.
[0025] The specific sequence of SEQ ID NO:5 is as follows: 5'-AGTCCTTCCACGATACCAAAGT-3'.
[0026] According to one aspect of the present invention, the present invention provides a detection kit for predicting recurrence of atrial fibrillation after radiofrequency ablation, wherein the detection kit comprises a quantitative detection agent for the circular RNA circDGCR8.
[0027] In a preferred embodiment of the present invention, the detection kit further comprises at least one of an RNA extraction reagent, a reverse transcription reagent, a qPCR reagent, a PCR reaction buffer, dNTPs and a DNA polymerase.
[0028] In a preferred embodiment of the present invention, the test sample of the detection kit includes at least one of peripheral blood, coronary sinus blood, and blood derivatives.
[0029] According to one aspect of the present invention, a method for using the above-mentioned detection kit for predicting recurrence of atrial fibrillation after radiofrequency ablation comprises:
[0030] S1: Provide the sample to be tested and then extract the sample RNA;
[0031] It should be noted that the present application does not limit the method for extracting RNA. For example, the RNA can be extracted using the Trizol method or a commercial kit.
[0032] S2: Reverse transcription of the extracted RNA to obtain cDNA;
[0033] Likewise, it should be noted that the present application does not limit the method and conditions of reverse transcription, and reverse transcription can be performed using the conditions and procedures specified in commercially available conventional kits and their instructions.
[0034] S3: The cDNA is amplified using the quantitative detection agent of circular RNA circDGCR8 to obtain an amplification product, and the relative expression amount of circular RNA circDGCR8 in exosomes is determined based on the analysis of the amplification product.
[0035] In a preferred embodiment of the present invention, the detection method is: first, the extracted RNA is reverse transcribed to obtain cDNA, and then the cDNA is amplified using detection primers to obtain an amplification product; then, the relative expression level of the biomarker ARCR:circDGCR8 in the sample is determined based on the amplification product analysis, so as to determine the recurrence of atrial fibrillation after radiofrequency ablation.
[0036] In the above preferred embodiment, the analysis method is: using GAPDH as the reference genome to standardize the Ct value of each sample, and using the established efficiency-based ΔCt method to compare each sample with the control group, converting the normalized Ct value into a normalized expression value, calculating the relative expression of each gene 2^-(ΔCt), and using GraphPad for graphical analysis to determine whether atrial fibrillation recurs after radiofrequency ablation.
[0037] It should be noted that, in addition to qPCR, other methods such as high-throughput analysis, microarray analysis, Northern hybridization, etc. can also achieve the same purpose for the detection of sample RNA in the present application.
[0038] Compared with the prior art, the present invention has the following beneficial effects:
[0039] The present invention provides an application of a quantitative detection agent of circular RNA circDGCR8 in the preparation of a detection kit for predicting recurrence after radiofrequency ablation of atrial fibrillation. It has been verified that the detection kit for predicting recurrence after radiofrequency ablation of atrial fibrillation in this application relies on a specifically expressed primer set to quantitatively detect circular RNA circDGCR8, and then judge whether atrial fibrillation recurs after radiofrequency ablation. It has the advantages of strong specificity, high sensitivity, and stable and reliable results, which effectively alleviates the existing subjectivity of the method for predicting recurrence after radiofrequency ablation of atrial fibrillation, and the problem that the existing molecules for predicting postoperative recurrence are unstable in peripheral blood and easily affected by factors such as blood collection time and blood storage time. BRIEF DESCRIPTION OF THE DRAWINGS
[0040] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.
[0041] Figure 1 A correlation diagram between circDGCR8 and the degree of atrial remodeling provided in Example 1 of the present invention;
[0042] Figure 2The Kaplan-Meier survival curve analysis result diagram provided in Example 1 of the present invention;
[0043] Figure 3 A graph showing the stability of circDGCR8 expression provided in Example 4 of the present invention. DETAILED DESCRIPTION
[0044] The technical solution of the present invention will be clearly and completely described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0045] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention.
[0046] In the present invention, the "quantitative detection agent of circular RNA circDGCR8" should not be understood as a detection agent for circular RNA circDGCR8 only, but should include other detection agents known to those skilled in the art that can reflect the expression level of circular RNA circDGCR8. For example, the cDNA obtained by reverse transcription of circular RNA circDGCR8 can be quantitatively detected, or the expression amount of circular RNA circDGCR8 can be indirectly detected.
[0047] In the present invention, "circular RNA circDGCR8" may be replaced by "marker", "marker gene" or "biochemical marker" unless otherwise stated. It specifically refers to a molecule to be used as a target for analyzing a patient's experimental sample.
[0048] The circular RNA circDGCR8 used as a marker in the present invention is expected to include its full-length ribonucleotide sequence, or naturally occurring variants, or fragments of the full-length sequence and variants, especially fragments that can be detected and determined for a specific sequence. Preferably, it contains at least 7, 8, 9, 10, 11, 12, 15 or 20 consecutive ribonucleotides of the full-length ribonucleotide sequence.
[0049] The quantitative detection agent for RNA can be selected from reagents known to those skilled in the art, such as nucleic acids that can hybridize with the RNA and are labeled with fluorescent markers; in general, the detection agent for RNA can be selected from RT-PCR primers and primers for amplifying the product of RT-PCR - cDNA.
[0050] The technical solution of the present invention will be further described below in conjunction with embodiments and drawings.
[0051] Example 1 Correlation between ARCR circDGCR8 expression and atrial remodeling
[0052] (I) circDGCR8 is significantly correlated with the degree of atrial remodeling.
[0053] The ratio of the left atrial low voltage area to the left atrial area is one of the gold standards for considering the degree of atrial remodeling. The present invention performed electrocardiographic mapping on patients undergoing radiofrequency ablation to calculate the ratio of the left atrial low voltage area to the atrial area, thereby characterizing the degree of left atrial remodeling. It was found that the relative expression level of circDGCR8 in the patient's peripheral blood was significantly correlated with the ratio of the left atrial low voltage area to the total left atrial area in patients with atrial fibrillation. (r = 0.610, p < 0.001, n = 53). For specific results, see Figure 1 .
[0054] Figure 1 This is a correlation diagram between circDGCR8 and the degree of atrial remodeling provided in this example.
[0055] Depend on Figure 1 It can be seen that circDGCR8 is significantly correlated with the degree of atrial remodeling.
[0056] (II) Increased circDGCR8 can predict the recurrence of atrial fibrillation after radiofrequency ablation.
[0057] Figure 2 This is a graph of the Kaplan-Meier survival curve analysis results provided in this embodiment.
[0058] See also Figure 2 According to the relative expression of circDGCR8 in peripheral blood of all research subjects, the median (0.55) was selected as the threshold for determining high and low expression of circDGCR8. According to the Kaplan-Meier survival curve statistical analysis,
[0059] Figure 2 The dashed and solid lines in the middle represent patients with atrial fibrillation whose relative expression of circDGCR8 is ≥0.55 and <0.55, respectively. The results showed that the proportion of patients with atrial fibrillation <0.55 who did not experience atrial fibrillation recurrence within 1 year after radiofrequency ablation and its changing trend, and the increase of circDGCR8 was significantly correlated with the increase of atrial fibrillation recurrence rate (log-rank test, p<0.001). Therefore, Figure 2 The results showed that increased circDGCR8 was significantly correlated with increased recurrence rate of atrial fibrillation, indicating that increased peripheral blood circDGCR8 can predict the recurrence of atrial fibrillation after radiofrequency ablation.
[0060] Example 2 Sample collection, RNA extraction
[0061] Collect 2-3 mL of peripheral blood from the test subjects, centrifuge at 3000 x g for 15 minutes, take 500 ul of plasma into a 2 ml EP tube, add 2 times the volume of Trizol reagent, let it stand on ice or at 4 °C for 10 minutes, then add 0.2 times the volume of chloroform reagent, vortex until the liquid is mixed, let it stand on ice for 10 minutes, the solution begins to separate, and centrifuge at 12000 rpm and 4 °C for 10 minutes.
[0062] After centrifugation, transfer the supernatant to a new RNase-free EP tube, add isopropanol in equal proportions and mix by inverting several times, let stand on ice or at 4°C for 10 minutes, and centrifuge at 12,000 rpm at 4°C for 10 minutes to precipitate RNA. After centrifugation, discard the supernatant, add 1 mL of 75% RNaseFree ethanol, mix by inverting several times, and centrifuge at 12,000 rpm at 4°C for 5 minutes. After centrifugation, discard the supernatant and repeat the wash once. After centrifugation, discard the supernatant as much as possible and let stand for a while to wait for the ethanol to evaporate completely. Add DEPC-treated water to dissolve RNA and dissolve at 56°C for 5 minutes. Use a UV spectrophotometer to measure the RNA concentration and purity for later use.
[0063] Example 3 Detection of biomarker ARCR:circDGCR8 in samples
[0064] (I) Reverse transcription to obtain cDNA:
[0065] The RNA extracted in Example 2 was taken, and the RNA concentration was detected using a full-wavelength microplate reader, and the concentration was quantified to 20-50 ug / mL. The cDNA was derived in the mixed solution shown in Table 1 according to the instructions of the Takara (RR036A) reverse transcription reagent, and the mixture was gently mixed and centrifuged for 3-5 seconds.
[0066] Reverse transcription procedure: incubate at 37°C for 15 minutes, heat at 85°C for 5 seconds, and store cDNA at 4°C.
[0067] Table 1 RT reaction solution:
[0068]
[0069] (ii) q-PCR:
[0070] A 20 μL reaction system (see Table 2) was prepared using SYBR dye, water, the cDNA in step (i) of this example, and primers. A two-step PCR reaction was performed using a PCR instrument. The program was set to pre-denaturation at 95°C for 30 seconds, denaturation at 95°C for 5 seconds, extension at 60°C for 30 seconds, and 40 cycles to obtain a cDNA amplification product.
[0071] The primers include: qRT-PCR primers for circular RNA circDGCR8, whose upstream primer is shown in SEQ ID NO.2, and whose downstream primer is shown in SEQ ID NO.3; primers for the internal reference housekeeping gene GAPDH, whose upstream primer is shown in SEQ ID NO.4; and whose downstream primer is shown in SEQ ID NO.5.
[0072] Table 2 PCR reaction solution:
[0073]
[0074] (3) Data analysis:
[0075] The 2^-□Ct method was used to perform relative quantitative analysis on the cDNA amplification products after fluorescence quantitative PCR.
[0076] The Ct values were normalized using GAPDH as the reference genome (ΔCt), and the sample normalized Ct values ΔCt were converted to normalized expression values using the established efficiency-based ΔCt method to calculate 2^-ΔCt.
[0077] The specific data analysis is as follows:
[0078] 1. Repeat the sample three times and average the Ct values of the sample technical repeats (n = 3): Ct = average (Ct1, Ct2, Ct3);
[0079] 2. Calculate the ΔCt value of the sample: ΔCt = Ct(circDGCR8)-Ct(GAPDH);
[0080] 3. Calculate the expression level of the sample circDGCR8 gene 2^-(ΔCt) and use GraphPad for graphical analysis.
[0081] The specific results showed that when the 2^-ΔCt value was greater than or equal to 0.55, it was considered positive; when the 2^-ΔCt value was less than 0.55, it was considered negative;
[0082] Example 4 Marker Stability
[0083] Peripheral blood was collected from 13 healthy volunteers in the morning, at night and 3 weeks later, and the expression level of circDGCR8 in their peripheral blood was detected by real-time quantitative PCR.
[0084] The results showed that the relative expression of circDGCR8 did not change significantly with the circadian rhythm, and its expression level remained stable after a 3-week interval (one-way AVONA method p = 0.158, n = 13).
[0085] Figure 3This is a graph showing the stability of circDGCR8 expression provided in this example. Figure 3 It showed that the relative expression level of circDGCR8 did not change significantly with the circadian rhythm, and the expression level remained stable after 3 weeks.
[0086] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.
Claims
1. Use of a quantitative detection agent of circular RNA circDGCR8 in the preparation of a detection kit for predicting recurrence of atrial fibrillation after radiofrequency ablation, characterized in that: The circular RNA circDGCR8 has a nucleotide sequence as shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that: The quantitative detection agent of circular RNA circDGCR8 includes reagents suitable for at least one of the following methods: Fluorescent dye method, digital PCR, resonance light scattering, real-time fluorescence quantitative PCR or sequencing.
3. The use according to claim 1, characterized in that: The quantitative detection agent of circular RNA circDGCR8 comprises: A probe or primer that can specifically bind to circular RNA circDGCR8 or cDNA corresponding to circular RNA circDGCR8.
4. The use according to claim 3, characterized in that: The quantitative detection agent of circular RNA circDGCR8 comprises: The qRT-PCR primers of circular RNA circDGCR8, the upstream primer is shown as SEQ ID NO.2, and the downstream primer is shown as SEQ ID NO.
3.
5. The use according to claim 1, characterized in that: The quantitative detection agent of circular RNA circDGCR8 also includes an internal reference primer; Preferably, the internal reference primer is a primer of the internal reference housekeeping gene GAPDH, and its upstream primer is shown as SEQ ID NO.4; and its downstream primer is shown as SEQ ID NO.
5.
6. A detection kit for predicting recurrence of atrial fibrillation after radiofrequency ablation, characterized in that: The detection kit comprises the quantitative detection agent for circular RNA circDGCR8 according to any one of claims 1 to 5.
7. The detection kit according to claim 6, characterized in that The detection kit also includes at least one of an RNA extraction reagent, a reverse transcription reagent, a qPCR reagent, a PCR reaction buffer, dNTPs and a DNA polymerase.
8. The detection kit according to claim 6, characterized in that The test sample of the test kit includes at least one of peripheral blood, coronary sinus blood, and blood derivatives.
9. A method for using the detection kit for predicting recurrence of atrial fibrillation after radiofrequency ablation according to any one of claims 6 to 8, characterized in that: The method comprises: S1: Provide the sample to be tested and then extract the sample RNA; S2: Reverse transcription of the extracted RNA to obtain cDNA; S3: Amplify the cDNA using the quantitative detection agent for circular RNA circDGCR8 according to any one of claims 1 to 5 to obtain an amplification product, and determine the relative expression level of circular RNA circDGCR8 in exosomes based on the analysis of the amplification product.
10. The method for using the detection kit according to claim 9, characterized in that: The amplification method of the cDNA in step S3 is fluorescent quantitative PCR; And / or, the method for analyzing the amplification product in step S3 is: using the 2^-ΔCt method to perform relative quantitative analysis on fluorescent quantitative PCR to obtain the relative expression level of circular RNA circDGCR8, and performing mapping analysis to determine whether atrial fibrillation recurs after radiofrequency ablation.