SNP (Single Nucleotide Polymorphism) molecular marker for identifying or assisting in identifying height of goat body type and application of SNP molecular marker

Abstract

The invention relates to the technical field of goat molecular marker breeding, in particular to an SNP (Single Nucleotide Polymorphism) molecular marker for identifying or assisting in identifying the height of a goat body type and application of the SNP molecular marker. The SNP molecular marker provided by the invention is located at the 937th basic group of an SHBG gene coding region and has A / G polymorphism, and the login number of the SHBG gene is NC030826.1. According to the invention, a Leizhou goat is taken as an experimental material, sequencing analysis is carried out on an SHBG gene, A-G mutation exists at the 937th basic group in an SHBG gene coding region and is non-synonymous mutation, the mutation leads to mutation of amino acid from arginine to glycine, and the genotype of the site is related to the high and short foot character of the goat (when the genotype is GG or AG, the goat is a tall goat; and when the genotype is AA, the goat is a short type goat), the method can be used for identifying or assisting in identifying the height of the goat body type, and has important significance on breeding of goat varieties.

Description

Technical Field

[0001] The invention relates to the technical field of goat molecular marker breeding, and in particular to a SNP molecular marker for identifying or assisting in identifying the height of a goat and an application thereof. Background Art

[0002] Among goat groups, there are high-legged groups and short-legged groups. The high-legged groups are larger in size, good at walking and jumping, and produce single lambs. They like to eat shrub branches and leaves, and are suitable for grazing. The short-legged groups are short in size, produce twin lambs, and are suitable for shed breeding. Therefore, among goats, the short-legged group has more advantages than the high-legged group. It is suitable for shed breeding, and with the increase of breeding intensity, the twin lamb rate has an increasing trend, and the twin lamb survival rate can reach more than 90%. It is very popular among breeders and the masses. Breeders also consciously choose short-legged Leizhou goats to meet production needs. It can be seen that the height of goats is one of the important traits that affect their economic value. Raising short-legged goats has greater economic benefits. Breeding technology with molecular marker-assisted selection as the core can directly select the genotype of leg length traits at the molecular level, thereby overcoming the shortcomings of conventional breeding that is time-consuming and ineffective, and can quickly improve breeding efficiency. Therefore, the use of molecular marker-assisted selection technology can be used to select leg length traits at an early stage, thereby shortening the generation interval and accelerating breeding progress. Therefore, it is of great significance to use molecular marker-assisted selection technology to explore genes and SNP sites related to goat height and short legs and apply them to molecular breeding technology for goat breed selection. However, there is a lack of genes and SNP sites related to goat height and short legs. Summary of the invention

[0003] In order to solve the above problems, the present invention provides a SNP molecular marker for identifying or assisting in identifying the height of goats and its application. The SNP molecular marker provided by the present invention is a molecular marker related to the height and shortness of goats, which can be used to identify or assist in identifying the height of goats, and is of great significance to goat breed selection.

[0004] In order to achieve the above object, the present invention provides the following technical solutions:

[0005] The present invention provides a SNP molecular marker for identifying or assisting in identifying the height of a goat, wherein the SNP molecular marker is located at the 937th base in the coding region of the SHBG gene and has an A / G polymorphism;

[0006] The accession number of the SHBG gene in the NCBI database is NC_030826.1.

[0007] Preferably, the nucleotide sequence of the SNP molecular marker is as shown in SEQ ID NO.1, wherein R is A / G.

[0008] Preferably, when the genotype of the SNP molecular marker is GG or AG, the goat is a tall goat; and when the genotype of the SNP molecular marker is AA, the goat is a dwarf goat.

[0009] The present invention provides a product for detecting the SNP molecular markers described in the above technical solution, the product comprising: one or more of an amplification primer, a kit and a sequencing primer;

[0010] The amplification primers include primers shown in SEQ ID NO.2 and SEQ ID NO.3;

[0011] The kit is a kit containing the amplification primers;

[0012] The sequencing primers include primers shown in SEQ ID NO.2 and SEQ ID NO.4.

[0013] Preferably, the kit further comprises restriction endonuclease Sty I.

[0014] The present invention provides the use of the SNP molecular marker described in the above technical solution or a product for detecting the SNP molecular marker described in the above technical solution in identifying or assisting in identifying the height of goats.

[0015] The present invention provides the use of the SNP molecular marker described in the above technical solution or the product described in the above technical solution in goat breeding, and the breeding includes breeding tall-legged goats or breeding short-legged goats.

[0016] Preferably, the goat is a Leizhou goat.

[0017] The present invention provides a method for identifying or assisting in identifying the height of a goat, comprising the following steps:

[0018] Using the genomic DNA of the goat to be tested as a template, PCR amplification is performed using the amplification primers in the product described in the above technical solution to obtain an amplified product;

[0019] The amplified product is sequenced or digested with restriction endonuclease Sty I, and the genotype of the amplified product is determined according to the sequencing result or the size of the digested product; the genotype of the amplified product is the genotype of the SNP molecular marker according to any one of claims 1 to 3 in the amplified product;

[0020] If the sizes of the enzyme digestion products are 440 bp, 419 bp, and 21 bp, the genotype of the amplified product is AG;

[0021] If the size of the enzyme digestion product is only 440 bp, the genotype of the amplified product is GG;

[0022] If the sizes of the enzyme digestion products are 419 bp and 21 bp, the genotype of the amplified product is AA;

[0023] Determining the height of the goat to be tested according to the genotype of the amplified product;

[0024] If the genotype of the amplified product is GG or AG, the goat to be tested is a tall goat;

[0025] If the genotype of the amplified product is AA, the goat to be tested is a dwarf goat.

[0026] Preferably, the primers used for sequencing are the sequencing primers in the product described in the above technical solution.

[0027] Beneficial effects:

[0028] The present invention provides a SNP molecular marker for identifying or assisting in identifying the height of goats. The SNP molecular marker is located at the 937th base in the coding region of the SHBG gene, and there is an A / G polymorphism; the accession number of the SHBG gene in the NCBI database is NC_030826.1. The present invention uses Leizhou goats as experimental materials, performs sequencing analysis on the SHBG gene, and finds that there is an A→G mutation at the 937th base in the coding region of the SHBG gene, which is a non-synonymous mutation. The mutation causes the amino acid to mutate from arginine to glycine. The genotype of this site is related to the height and shortness of goats (when the genotype is GG or AG, the goat is a tall goat; when the genotype is AA, the goat is a short goat), which can be used to identify or assist in identifying the height of goats, and is of great significance to goat breed selection.

[0029] Furthermore, the present invention designs detection primers according to the SNP molecular marker, artificially introduces mismatched bases, and forms a Sty I (C↓CWWGG) enzyme recognition site, so that Sty I endonuclease can be used for enzyme identification, and the genotype of the SNP molecular marker is determined according to the size of the enzyme cleavage product, thereby identifying or assisting in identifying the height of the goat. The method not only has strong specificity, but also is simple and the typing time is short, which is of great significance for optimizing goat breeding and improving breeding efficiency. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0031] Figure 1 This is the result of gel electrophoresis of Leizhou goat genome DNA;

[0032] Figure 2 This is the gel electrophoresis of the PCR amplification product of the SNP molecular marker A937G site;

[0033] Figure 3 This is the sequencing result of the heterozygous AG genotype of the Leizhou goat;

[0034] Figure 4 This is the sequencing result of the homozygous GG genotype of the Leizhou goat mutation;

[0035] Figure 5 This is the sequencing result of the wild homozygous AA genotype of Leizhou goat;

[0036] Figure 6 This is the PCR-RFLP gel electrophoresis diagram of the SNP molecular marker A937G site. DETAILED DESCRIPTION

[0037] The invention provides a SNP molecular marker for identifying or assisting in identifying the height of a goat. The SNP molecular marker is located at the 937th base in the SHBG gene coding region and has an A / G polymorphism. The accession number of the SHBG gene in the NCBI database is NC_030826.1.

[0038] As an embodiment, the nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein R is A / G, specifically as follows:

[0039] SEQ ID NO.1:

[0040] 5'-GAGAGGAAAGGGAATTCCAGAATGTCAACAGTATGAAGGCTTTGG GAGGTGGGGGGCAGTGCAGAGACACATATTAAAGCTGCCCACAGCAAGCAAATGACCTTTACTTAGATTATATATTTTTCTTGGGGGTGGATATGGTTTTATAGAAGGCCAAGACAAGAGAGCAGACGCAGGACTGAAGTGGTGGGAATGGCCAGAGATAGATAGACTGGATAGACATAGATAGTGTGG CTGAGAGGAAGAATCCAGGCAGCCAGGGATGGGGCTAGAAGGAGTGGGTGCCGTTCGTTCTTCCCTCCCCCACTTATGTCCCTTCCCACACACTCTGCAGAAAGTGGTGTTGTCTTCTGGGTCGGGGCCAGGGCTGGATCTGCCCCTCGTCTTGGGGCTCCCTCTTCAGCTGAAGTTGACTGTGTCCR T GGTGGTTTTGAGCCAGGG-3'.

[0041] As an embodiment, when the genotype of the SNP molecular marker (the genotype of the R base in the sequence shown in SEQ ID NO.1) is GG or AG, the goat is a tall goat; when the genotype of the SNP molecular marker is AA, the goat is a dwarf goat.

[0042] The present invention uses Leizhou goats as experimental materials, performs sequencing analysis on the SHBG gene, and finds that there is an A→G mutation at the 937th base in the SHBG gene coding region, which is a non-synonymous mutation. The mutation causes the amino acid to mutate from arginine to glycine. The genotype of the site is related to the height and shortness traits of the goat (when the genotype is GG or AG, the goat is a tall goat; when the genotype is AA, the goat is a short goat). The site can be used to identify or assist in identifying the height of the goat, which is of great significance to the breeding of goat varieties.

[0043] Based on the above advantages, the present invention provides a product for detecting the SNP molecular markers described in the above technical solution, the product comprising: one or more of an amplification primer, a kit and a sequencing primer;

[0044] The amplification primers include primers shown in SEQ ID NO.2 and SEQ ID NO.3;

[0045] The kit is a kit containing the amplification primers;

[0046] The sequencing primers include primers shown in SEQ ID NO.2 and SEQ ID NO.4.

[0047] As an embodiment, the kit also includes restriction endonuclease Sty I.

[0048] The primer pair provided by the present invention is a detection primer designed according to the SNP molecular marker, and a mismatched base (the underlined base T in the sequence shown in SEQ ID NO.1) is artificially introduced to form a Sty I (C↓CWWGG) enzyme recognition site, so that Sty I endonuclease can be used for enzyme digestion identification, and the genotype of the SNP molecular marker is determined according to the size of the enzyme digestion product, thereby identifying or assisting in identifying the height of the goat.

[0049] Based on the above advantages, the present invention provides the use of the SNP molecular markers described in the above technical solution or the products for detecting the SNP molecular markers described in the above technical solution in identifying or assisting in identifying the height of goats.

[0050] Based on the above advantages, the present invention provides the use of the SNP molecular marker described in the above technical solution or the product described in the above technical solution in goat breeding, and the breeding includes breeding tall-legged goats or breeding short-legged goats.

[0051] As an embodiment, the goat is a Leizhou goat.

[0052] Based on the above advantages, the present invention provides a method for identifying or assisting in identifying the height of a goat, comprising the following steps:

[0053] Using the genomic DNA of the goat to be tested as a template, PCR amplification is performed using the amplification primers in the product described in the above technical solution to obtain an amplified product;

[0054] The amplified product is sequenced or digested with restriction endonuclease Sty I, and the genotype of the amplified product is determined according to the sequencing result or the size of the digested product; the genotype of the amplified product is the genotype of the SNP molecular marker in the amplified product according to the above technical solution;

[0055] If the sizes of the enzyme digestion products are 440 bp, 419 bp, and 21 bp, the genotype of the amplified product is AG;

[0056] If the size of the enzyme digestion product is only 440 bp, the genotype of the amplified product is GG;

[0057] If the sizes of the enzyme digestion products are 419 bp and 21 bp, the genotype of the amplified product is AA;

[0058] Determining the height of the goat to be tested according to the genotype of the amplified product;

[0059] If the genotype of the amplified product is GG or AG, the goat to be tested is a tall goat;

[0060] If the genotype of the amplified product is AA, the goat to be tested is a dwarf goat.

[0061] As an implementation mode, the primers used for sequencing are the sequencing primers in the product described in the above technical solution.

[0062] The method provided by the present invention not only has strong specificity when determining the genotype of the amplified product according to the size of the enzyme cleavage product, but also has a simple method and a short typing time, which is of great significance for optimizing goat breeding and improving breeding efficiency.

[0063] To further illustrate the present invention, a SNP molecular marker for identifying or assisting in identifying the height of goats and its application provided by the present invention are described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0064] Example 1

[0065] Sample collection

[0066] A total of 188 blood samples of Leizhou goats used in the present invention were collected from Guangdong Lingtouyang Agricultural Smart Agriculture Co., Ltd. 5 mL of blood was collected from the jugular vein, anticoagulated with EDTAK2, stored in a refrigerator at -20°C for later use, and the ear number and body size data of each individual were marked and recorded.

[0067] Extraction and quality testing of blood genomic DNA

[0068] The Hipure Universal DNAKit D3018 kit from Meiji Biotechnology was used to extract genomic DNA from blood. The concentration and purity of the extracted DNA fragments were detected by nanodrop spectrophotometer. Buffer AE was used as a blank control to ensure that the concentration of the extracted DNA sample was not less than 30 ng / μL. 260 / OD 280 The value of was between 1.8 and 2.0, and then the quality of the extracted DNA was detected by 1% agarose gel electrophoresis. Figure 1 .

[0069] Depend on Figure 1 It can be seen that the extracted goat genomic DNA samples are good, and the purity and concentration meet the test requirements and can be used for subsequent experiments.

[0070] Primer synthesis of candidate genes

[0071] Based on the candidate gene sequence published on GenBank, primers were designed for the SNP mutation site of the 937bp sequence of the SHBG gene coding region on goat chromosome 19 (accession number: NC_030826.1), and the primers were synthesized by Sangon Biotechnology Co., Ltd. The primer sequences are as follows:

[0072] F: 5'-GAGAGGAAAGGGAATTCCAG-3' (SEQ ID NO. 2);

[0073] R: 5'-CCCTGGCTCAAAACCACC A T-3' (SEQ ID NO. 3);

[0074] The bases marked with underlines in the downstream primer (R) sequence are mismatched bases introduced by primer-induced enzyme digestion analysis technology, forming Sty I (C↓CWWGG) enzyme digestion recognition sites.

[0075] The primers used for Sanger sequencing are as follows:

[0076] F: 5'-GAGAGGAAAGGGAATTCCAG-3' (SEQ ID NO. 2);

[0077] R1: 5'-TTGAAAGCACTTCCTCCCACCA-3' (SEQ ID NO. 4).

[0078] PCR amplification

[0079] The reaction system for PCR amplification was: 1 μL of genomic DNA template, 0.4 μL of upstream and downstream primers, 10 μL of Taq DNA polymerase, and deionized double-distilled water to 20 μL.

[0080] The reaction procedure of PCR amplification was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 60°C for 15 s, extension at 72°C for 10 s, 35 cycles; post-extension at 72°C for 5 min, and storage at 4°C.

[0081] After the reaction was completed, 5 μL of the reaction product was taken and subjected to 2% agarose gel electrophoresis to detect its length and integrity.

[0082] RELP test

[0083] The enzyme digestion system is: 10× Buffer O 2μL, Sty I 1μL, genomic DNA 10μL, ddH2O 17μL. After sufficient shaking and mixing, put it into a 37℃ constant temperature water tank for enzyme digestion for 2h. After digestion, take out the sample and use 3% agarose gel electrophoresis to analyze the genotype presented in each lane according to the gel imaging results.

[0084] Data statistics and analysis

[0085] The data were statistically analyzed using the GLM (General Linear Model) program in SPSS26.0 statistical analysis software in conjunction with the constructed single-site effect model. LSD and Dunnett's T3 methods were used for multiple comparisons between means to study the effect of genotype on the leg length of Leizhou goats. The results were presented in the form of mean ± standard deviation (Mean ± SD). The linear model used for statistical analysis is as follows:

[0086] yjkl=μ+G k +ejkl;

[0087] Among them: yjkl is the leg length of Leizhou goats; μ is the group average; G k is the fixed effect of the kth genotype; ejkl is the random residual effect.

[0088] Results and Analysis

[0089] 1. PCR amplification results of mutation site genes

[0090] The genomic DNA of Leizhou goat was used as a template and the primers shown in SEQ ID NO.2 and SEQ ID NO.3 were used for PCR amplification. After PCR electrophoresis, the target band was clear and bright without any other bands, and the size of the target fragment was consistent with the expected result, which was 440 bp (see Figure 2 ).

[0091] 2. PCR-RFLP analysis of mutation site genes

[0092] DNA samples of 20 and 50 different Leizhou goat individuals were extracted respectively, and two DNA pools were made according to the principle of equal mixing. PCR amplification was performed using these as templates, and the PCR products were sequenced. The results are shown in Figures 3 to 5 The sequencing results were sorted using DNAMAN software and compared with the genome sequence on NCBI. It was found that there was an A→G mutation at the 421bp of the amplified sequence, which was a non-synonymous mutation. The amino acid here mutated from arginine to glycine, which was the SNP site. The primer-induced enzyme digestion analysis technology was used to make the specific fragment product contain the Sty I restriction endonuclease polymorphic site. After the amplified product was digested by Sty I restriction endonuclease, it was detected by 3% agarose gel electrophoresis. The results showed three genotypes (see Figure 6 ): mutant heterozygous AG (440bp, 419bp and 21bp), mutant homozygous GG (440bp) and wild homozygous AA (419bp and 21bp).

[0093] 3. Genetic parameter analysis of A937G locus

[0094] Genetic heterozygosity (He), genetic homozygosity (Ho), polymorphic information content (PIC) and effective allele number (Ne) are important parameters for judging population genetic variation. Different genetic parameters represent the essential genetic differences between populations. The genetic parameters of the A937G locus are shown in Table 1. As shown in Table 1, the polymorphic information content is 0.37, between 0.25 and 0.5, so it is moderately polymorphic. The purity and heterozygosity are not much different, both around 0.5, indicating that the two alleles are evenly distributed in the Leizhou goat population. The chi-square result shows that the Hardy-Weinberg equilibrium bias was detected at the A937G locus, which indicates that the A937G locus may be the result of long-term artificial selection of a certain trait.

[0095] Table 1 Genetic parameter analysis of A937G locus

[0096]

[0097] 4. Association analysis between A937G locus and leg length trait

[0098] SPSS26.0 software was used to analyze the association between the A937G mutation site and the leg length of Leizhou goats of different genotypes. The A937G mutation site was significantly associated with the leg length trait of Leizhou goats (P < 0.05). As shown in Table 2, the average leg length of Leizhou goats with GG genotype was 30.070 cm, the average leg length of Leizhou goats with AG genotype was 29.357 cm, and the average leg length of Leizhou goats with AA genotype was 25.248 cm. In terms of the leg length of Leizhou goats, the leg length of GG type was 4.822 cm longer than that of AA type, with a significant difference (P < 0.05). The leg length of GG type was 0.713 cm longer than that of AG type, with no significant difference (P > 0.05), and the leg length of AG type was 4.109 cm longer than that of AA type, with a significant difference (P < 0.05). The results showed that the GG genotype and AG genotype of the A937G mutation site of the SHBG gene belonged to the tall-legged population of Leizhou goats, while the AA genotype belonged to the short-legged population of Leizhou goats.

[0099] Table 2 Association analysis between A937G locus and leg length in Leizhou

[0100] genotype Leg length (cm) GG <![CDATA[30.070±0.602 a ]]> AG <![CDATA[29.357±0.404 a ]]> AA <![CDATA[25.248±0.820 b ]]>

[0101] Note: Different letters indicate significant differences (P<0.05).

[0102] In summary, the SNP molecular marker and the detection method thereof provided by the present invention can quickly and accurately distinguish the leg length of Leizhou goats, which is of great significance for optimizing goat breeding and improving breeding efficiency.

[0103] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A SNP molecular marker for identifying or assisting in identifying the height of goats, characterized in that: The SNP molecular marker is located at the 937th base in the SHBG gene coding region, and there is an A / G polymorphism; The accession number of the SHBG gene in the NCBI database is NC_030826.

1.

2. The SNP molecular marker according to claim 1, characterized in that: The nucleotide sequence of the SNP molecular marker is shown in SEQ ID NO.1, wherein R is A / G.

3. The SNP molecular marker according to claim 1 or 2, characterized in that: When the genotype of the SNP molecular marker is GG or AG, the goat is a tall goat; when the genotype of the SNP molecular marker is AA, the goat is a short goat.

4. A product for detecting the SNP molecular marker according to any one of claims 1 to 3, characterized in that: The product includes: one or more of an amplification primer, a kit, and a sequencing primer; The amplification primers include primers shown in SEQ ID NO.2 and SEQ ID NO.3; The kit is a kit containing the amplification primers; The sequencing primers include primers shown in SEQ ID NO.2 and SEQ ID NO.

4.

5. The product according to claim 4, characterized in that The kit also includes restriction endonuclease Sty I.

6. Use of the SNP molecular marker according to any one of claims 1 to 3 or the product according to claim 4 or 5 in identifying or assisting in identifying the height of goats.

7. Use of the SNP molecular marker according to any one of claims 1 to 3 or the product according to claim 4 or 5 in goat breeding, wherein the breeding includes breeding tall-legged goats or breeding short-legged goats.

8. The use according to claim 6 or 7, characterized in that: The goats are Leizhou goats.

9. A method for identifying or assisting in identifying the height of a goat, characterized in that: The following steps are involved: Using the genomic DNA of the goat to be tested as a template, PCR amplification is performed using the amplification primers in the product of claim 4 or 5 to obtain an amplified product; The amplified product is sequenced or digested with restriction endonuclease Sty I, and the genotype of the amplified product is determined according to the sequencing result or the size of the digested product; the genotype of the amplified product is the genotype of the SNP molecular marker according to any one of claims 1 to 3 in the amplified product; If the sizes of the enzyme digestion products are 440 bp, 419 bp, and 21 bp, the genotype of the amplified product is AG; If the size of the enzyme digestion product is only 440 bp, the genotype of the amplified product is GG; If the sizes of the enzyme digestion products are 419 bp and 21 bp, the genotype of the amplified product is AA; Determining the height of the goat to be tested according to the genotype of the amplified product; If the genotype of the amplified product is GG or AG, the goat to be tested is a tall goat; If the genotype of the amplified product is AA, the goat to be tested is a dwarf goat.

10. The method according to claim 9, characterized in that The primers used for sequencing are the sequencing primers in the product according to claim 4 or 5.

Images