Application of protein and coding gene thereof in regulating and controlling plant bacterial fruit blotch resistance

Abstract

The invention discloses application of a protein and a coding gene thereof in regulating and controlling plant bacterial fruit blotch resistance. The protein provided by the invention is named as AopP2 protein, and is a protein as shown in SEQ ID NO: 1. A nucleic acid molecule for coding the AopP2 protein also belongs to the protection range of the invention. The invention also protects the application of the AopP2 protein or the nucleic acid molecule for coding the AopP2 protein in regulating the disease resistance and / or antibacterial property of plants. The inventor of the invention explains the function of the effect protein AopP2 in the interaction process with the plant for the first time, and the AopP2 protein is an effect protein with elicitor activity and can be used for improving the disease resistance of the plant. The invention has important significance for realizing fruit blotch resistant plant breeding and improving the broad-spectrum and lasting disease resistance of the plant to fruit blotch.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to application of a protein and a coding gene thereof in positively regulating plant bacterial fruit spot resistance. Background Art

[0002] Bacterial fruit blotch (BFB) is a bacterial disease caused by Paracidovorax citrulli (Pc) that harms cucurbit crops worldwide. It mainly harms the fruits of watermelon and melon, as well as their leaves, producing lesions and causing fruit rot, resulting in reduced production and lowered commercial value.

[0003] The pathogenic bacteria of bacterial fruit spot disease are mainly transmitted through seeds. The pathogenic bacteria are transmitted to seedlings through the infected seeds, causing the seedlings to become sick. Once the disease occurs, it is difficult to prevent and control, posing a huge threat to crop production.

[0004] In terms of disease control, seed treatment, seed quarantine, and drug control have limited effectiveness against bacterial fruit spot. So far, no commercially available watermelon or melon varieties that are immune or highly resistant have been found, and there is also a lack of targeted control agents. Controlling bacterial fruit spot has become a difficult problem that needs to be overcome. Therefore, genetic analysis and localization of bacterial fruit spot resistance genes and their use in breeding disease-resistant plants are imminent. Summary of the invention

[0005] The purpose of the present invention is to provide an application of a protein and a coding gene thereof in regulating plant resistance to bacterial fruit spot.

[0006] The protein provided by the present invention, named AopP2 protein, is as follows (a1) or (a2) or (a3) ​​or (a4) or (a5) or (a6):

[0007] (a1) the protein shown in SEQ ID NO: 1;

[0008] (a2) a fusion protein having the protein described in (a1);

[0009] (a3) a protein related to plant disease resistance obtained by replacing and / or deleting and / or adding one or more amino acid residues of the protein described in (a1);

[0010] (a4) a protein that has 98% or more identity with the protein described in (a1) and is associated with plant disease resistance;

[0011] (a5) a protein related to plant antibacterial activity obtained by replacing and / or deleting and / or adding one or more amino acid residues of the protein described in (a1);

[0012] (a6) A protein having 98% or more identity with the protein described in (a1) and associated with plant antibacterial activity.

[0013] Specifically, the fusion protein (a2) may be a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein (a1).

[0014] Nucleic acid molecules encoding AopP2 protein also fall within the protection scope of the present invention.

[0015] The nucleic acid molecule may be a DNA molecule or an RNA molecule.

[0016] Specifically, the nucleic acid molecule is as follows (b1) or (b2) or (b3):

[0017] (b1) a nucleic acid molecule whose coding region is shown in positions 1 to 1515 of SEQ ID NO: 2;

[0018] (b2) a nucleic acid molecule having 95% or more identity with (b1) and encoding the protein;

[0019] (b3) A nucleic acid molecule that hybridizes with the nucleic acid molecule defined in (b1) under stringent conditions and encodes the protein.

[0020] The stringent conditions mentioned above may be using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS, hybridizing at 65° C. and washing the membrane in a DNA or RNA hybridization experiment.

[0021] The nucleic acid molecule may be the AopP2 gene.

[0022] Specifically, the AopP2 gene may be a DNA molecule whose coding region is shown in positions 1 to 1515 in SEQ ID NO:2.

[0023] Specifically, the AopP2 gene may be a DNA molecule whose coding region is shown in SEQ ID NO:2.

[0024] The expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell containing the nucleic acid molecule all fall within the protection scope of the present invention.

[0025] Specifically, the recombinant vector containing the nucleic acid molecule is a recombinant plasmid obtained by replacing the DNA fragment containing the CmR gene and ccdB gene from attR1 to attR2 in the vector pCPP5371 with a DNA fragment containing an exogenous DNA molecule (such as nucleotides 1-1515 in SEQ ID NO: 2). Specifically, the preparation method of the recombinant vector containing the nucleic acid molecule is as follows: using the double-stranded DNA molecule shown in SEQ ID NO: 2 as a template, using the primer pair consisting of aopP2-attB1 and aopP2-attB2 to perform PCR amplification to obtain a PCR amplification product. The PCR amplification product is then amplified with the Gateway TM pDON TM The 221 vector was recombined by BP to obtain an intermediate vector, and the intermediate vector was recombined with the vector pCPP5371 by LR to obtain the recombinant plasmid pCPP5371-AopP2.

[0026] Specifically, the recombinant microorganism containing the nucleic acid molecule is a recombinant bacterium obtained by introducing a recombinant vector containing the nucleic acid molecule into Pseudomonas fluorescens EtHAn. Specifically, the preparation method of the recombinant microorganism containing the nucleic acid molecule is: co-cultivating the AopP2 gene donor bacteria, the pRK600 plasmid donor bacteria and Pseudomonas fluorescens EtHAn to obtain the recombinant Pseudomonas fluorescens containing the nucleic acid molecule. Introduce the recombinant plasmid pCPP5371-AopP2 into Escherichia coli DH5α competent cells to obtain recombinant Escherichia coli, which is the AopP2 gene donor bacteria. Introduce the pRK600 plasmid into Escherichia coli DH5α competent cells to obtain recombinant Escherichia coli, which is the pRK600 plasmid donor bacteria.

[0027] The present invention also protects the use of AopP2 protein or nucleic acid molecules encoding AopP2 protein in positively regulating the disease resistance and / or antibacterial properties of plants.

[0028] Positive regulation means that the AopP2 protein content increases and the plant's disease resistance and / or antibacterial ability increases.

[0029] Positive regulation means that the content of nucleic acid molecules encoding AopP2 protein increases, and the disease resistance and / or antibacterial ability of the plant increases.

[0030] The present invention also protects the use of biological materials, which is as follows (c1) or (c2) or (c3):

[0031] (c1) Use in the preparation of products for improving the disease resistance and / or antibacterial properties of plants;

[0032] (c2) Application in plant breeding; the goal of plant breeding is to obtain plant germplasm with improved disease resistance and / or antibacterial properties;

[0033] (c3) Application in the preparation of antibacterial agents.

[0034] The present invention also provides a product comprising a biological material;

[0035] The functions of the product are as follows (d1) or (d2) or (d3):

[0036] (d1) improving the disease resistance and / or antibacterial ability of plants;

[0037] (d2) Plant breeding; the goal of plant breeding is to obtain plant germplasm with improved disease resistance and / or antibacterial properties;

[0038] (d3) Antimicrobial agents.

[0039] Any of the above biological materials can be AopP2 protein, a nucleic acid molecule encoding AopP2 protein, an expression cassette containing a nucleic acid molecule encoding AopP2 protein, a recombinant vector containing a nucleic acid molecule encoding AopP2 protein, or a recombinant microorganism containing a nucleic acid molecule encoding AopP2 protein.

[0040] The present invention also provides a method for cultivating plants with improved disease resistance and / or antibacterial properties, comprising the following steps: introducing a nucleic acid molecule encoding an AopP2 protein into a recipient plant to obtain a plant with improved disease resistance and / or antibacterial properties. Specifically, in the method, a recombinant vector containing the nucleic acid molecule or a recombinant microorganism containing the nucleic acid molecule is introduced into the recipient plant.

[0041] The present invention also provides a method for cultivating plants with improved disease resistance and / or antibacterial properties, comprising the following steps: increasing the content of AopP2 protein in the plants to obtain plants with improved disease resistance and / or antibacterial properties.

[0042] The present invention also protects the use of any of the above methods in plant breeding. The goal of the plant breeding is to obtain plant germplasm with improved disease resistance and / or antibacterial properties.

[0043] Specifically, the disease resistance is resistance to fruit spot disease.

[0044] Specifically, the disease resistance is resistance to bacterial fruit spot.

[0045] Specifically, the bacterial fruit spot disease is bacterial fruit spot disease of melons.

[0046] Specifically, the melons are watermelon and / or melon.

[0047] Specifically, the bacterial fruit spot disease is a bacterial fruit spot disease caused by Acidovorax citrullus.

[0048] Specifically, the antibacterial property is resistance to acidophages.

[0049] Specifically, the antibacterial property is resistance to Acidobacterium citrullum.

[0050] Specifically, the plant is a dicotyledon or a monocotyledon.

[0051] Specifically, the plant is a plant of the Cucurbitales order.

[0052] Specifically, the plant is a Cucurbitaceae plant.

[0053] Specifically, the plant is a plant of the genus Cucurbita.

[0054] Specifically, the plant is watermelon, such as Jingxin No. 4 watermelon.

[0055] After the plant (such as watermelon leaves) is pretreated with the biological material, an ETI reaction (ETI reaction: immune response triggered by effector factors) is triggered, thereby improving the disease resistance of the plant.

[0056] The inventors of the present invention explained for the first time the function of the effector protein AopP2 in the process of interaction with plants. The AopP2 protein is an effector protein with elicitor activity, which can be used to improve plant disease resistance. The present invention is of great significance for achieving fruit spot disease resistance plant breeding and improving the broad-spectrum and long-lasting disease resistance of plants to fruit spot disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0057] Figure 1 For Gateway TM pDON TM Vector map of the 221 vector.

[0058] Figure 2 This is the vector map of vector pCPP5371.

[0059] Figure 3 This is an exemplary photo of the leaf blade taken in step 2 of Example 2.

[0060] Figure 4 This is the result of detecting ROS in step 2 of Example 2.

[0061] Figure 5 This is the result of measuring the conductivity in step 2 of Example 2.

[0062] Figure 6 This is a photo of the Western bolt results of Example 3.

[0063] Figure 7 This is an exemplary photo of the leaf blade taken in step 3 of Example 4.

[0064] Figure 8This is the statistical result of the number of pathogenic bacteria colonies in step 3 of Example 4. DETAILED DESCRIPTION

[0065] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0066] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources. Unless otherwise specified, the quantitative tests in the following examples are set up for three repeated experiments, and the results are averaged. Escherichia coli DH5α competent cells: Shanghai Tolo Biotech. products, product catalog number CC96102. Gateway TM pDON TM 221 vector: product of Invitrogen. The effector protein discovered in the present invention is AopP2 protein, as shown in SEQ ID NO: 1. The gene encoding AopP2 protein is named AopP2 gene, and its open reading frame is shown in SEQ ID NO: 2.

[0067] The composition of each liter of liquid KB medium (pH 7.2) is: peptone 20g, glycerol 15mL, K2HPO4 1.5g, MgSO4·7H2O 1.5g, and the balance is water. Compared with liquid KB medium, the difference in the composition of each liter of solid KB medium is the addition of 15g agar.

[0068] The vector pCPP5371 is described in the following literature: Supramolecular Structure and Functional Analysis of the Type III Secretion System in Pseudomonas fluorescens 2P24; Frontiers in Plant Science (www.frontiersin.org), January 2016, Volume 6, Article 1190; doi: 10.3389 / fpls.2015.01190. The vector pCPP5371 has a gentamicin resistance gene.

[0069] Pseudomonas fluorescens EtHAn is described in the following document: A Bacterial Type Three Secretion-Based Delivery System for Functional Characterization of Sporisorium scitamineum Plant Immune Suppressing Effector Proteins; Molecular and Physiological Plant Pathology; DOI: 10.1094 / PHYTO-08-21-0326-R.

[0070] The pRK600 plasmid is described in the following literature: Involvement of hrpX and hrpG in the Virulence of Acidovorax citrulli Strain Aac5, Causal Agent of Bacterial Fruit Blotch in Cucurbits; Frontiers in Microbiology, March 2018, Volume 9, Article 507; doi: 10.3389 / fmicb.2018.00507.

[0071] The pBBR1MCS-2 plasmid is described in the following literature: Four new derivatives of the broad-host-range cloning vector pBBR1MCS, carrying different antibiotic-resistance cassettes; Gene, 166 (1995) 175-176; DOI: 10.1016 / 0378-1119 (95) 00584-1. The pBBR1MCS-2 plasmid has a kanamycin resistance gene.

[0072] Example 1: Preparation of recombinant bacteria

[0073] 1. Construction of recombinant plasmid

[0074] The double-stranded DNA molecule shown in SEQ ID NO: 2 was used as a template and the primer pair consisting of aopP2-attB1 and aopP2-attB2 was used for PCR amplification to obtain a PCR amplification product. TM pDON TM221 vector (vector map see Figure 1 ) to perform BP recombination to obtain an intermediate vector. The intermediate vector and vector pCPP5371 (vector map see Figure 2 ) was subjected to LR recombination to obtain the recombinant plasmid pCPP5371-AopP2. Compared with the vector pCPP5371, the difference of the recombinant plasmid pCPP5371-AopP2 is that the DNA fragment containing the CmR gene and ccdB gene from attR1 to attR2 in the vector is replaced by a DNA fragment containing an exogenous DNA molecule (as shown in nucleotides 1-1515 in SEQ ID NO: 2).

[0075] aopP2-attB1:ggggacaagtttgtacaaaaaagcaggctATGCCCCGTTCCGTCA;

[0076] aopP2-attB2:ggggacccactttgtacaagaaagctgggtATGCCTGTACCAGTCGCG.

[0077] 2. Prepare the recombinant bacterium EtHAn-AopP2 using triparental hybridization.

[0078] 1. Introduce the recombinant plasmid pCPP5371-AopP2 into E. coli DH5α competent cells to obtain recombinant E. coli, which is the AopP2 gene donor bacteria. Introduce the pRK600 plasmid into E. coli DH5α competent cells to obtain recombinant E. coli, which is the pRK600 plasmid donor bacteria.

[0079] 2. AopP2 gene donor bacteria, pRK600 plasmid donor bacteria and Pseudomonas fluorescens EtHAn were mixed and inoculated on a pH 7.4 LB medium plate, co-cultured at 28°C for 8 h, and then the bacteria on the plate were collected with sterile water to obtain a bacterial solution.

[0080] 3. Inoculate the bacterial solution obtained in step 2 onto a KB medium plate containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and culture at 28°C for 48 h.

[0081] 4. After completing step 3, single clones were picked from the plate for PCR identification, and the fluorescent Pseudomonas that were positive for PCR identification were selected as the recombinant bacteria EtHAn-AopP2.

[0082] PCR identification method: extract genomic DNA, use the primer pair consisting of aopP2-JC-F (CCTCAATGCGGAGGACCCG) and aopP2-JC-R (cagcgcgaagatcctgcagg) for PCR amplification. If an amplification product of about 385 bp is obtained, the identification result is positive.

[0083] 3. Preparation of recombinant bacteria EtHAn-EV.

[0084] Replace the recombinant plasmid pCPP5371-AopP2 with the vector pCPP5371 and follow the procedure in step 2 to obtain the recombinant bacterium EtHAn-EV.

[0085] Example 2: Functional verification of AopP2 protein

[0086] 1. Preparation of bacterial solution

[0087] The recombinant bacteria EtHAn-AopP2 was inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and cultured at 28°C and 200 rpm until the OD 600nm The value is 2.0, and then 10mmol / L MgCl2 aqueous solution is added until the system OD 600nm The value is 0.5, which means the bacterial solution is EtHAn-AopP2.

[0088] The recombinant bacteria EtHAn-EV were inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and cultured at 28°C and 200 rpm until the OD 600nm The value is 2.0, and then 10mmol / L MgCl2 aqueous solution is added until the system OD 600nm The value is 0.5, which means the bacterial solution is EtHAn-EV.

[0089] 2. Functional verification of AopP2 protein

[0090] Test bacterial solution: EtHAn-AopP2 or EtHAn-EV prepared in step 1.

[0091] Normally cultivate Jingxin No. 4 watermelon until it has only two cotyledons, and then inoculate the test bacteria solution. Inoculation method: Inject each cotyledon on the left and right sides of the main vein to fill the leaf with the test bacteria solution. Then continue normal cultivation.

[0092] 1. Phenotypic observation

[0093] The time starts from the inoculation of the test bacteria solution, and the leaves inoculated with the test bacteria solution are photographed 4 days later.

[0094] See photos Figure 3The leaves inoculated with the bacterial solution EtHAn-AopP2 showed water-soaked necrotic spots. The leaves inoculated with the bacterial solution EtHAn-EV did not show water-soaked necrotic spots.

[0095] 2. Detection of ROS

[0096] Start timing from the inoculation of the test bacterial solution. Take the leaves 15 hours later and use a circular hole puncher with a diameter of 4 mm to punch holes and obtain circular leaf samples with a diameter of 4 mm, called leaf discs. Take a white 96-well plate, add 10 μL of deionized water to each well, then add 1 leaf disc to each well, and then add 100 μL of L-012 working solution to each well. Use the ELISA light module to detect for 120 minutes and calculate the statistics.

[0097] L-012 working solution: weigh 0.0209g MOPS in 10mL deionized water, then add KOH to pH 7.4, then add 0.0016g L-012 chemiluminescent probe (WAKO Pure Chemical Industries, Ltd.). MOPS, the full name is 3-(N-morpholino)propanesulfonic acid, CAS number is 1132-61-2, a product of Shanghai Yuanye Biotechnology Co., Ltd.

[0098] Results Figure 4 (Number of samples: N=12) Compared with the group treated with EtHAn-EV, the ROS burst in the group treated with EtHAn-AopP2 was suppressed.

[0099] 3. Statistical conductivity

[0100] The timing starts from the inoculation of the test bacteria solution. After 96 hours, the leaves inoculated with the test bacteria solution are taken and punched with a circular puncher with a diameter of 1 cm to obtain circular leaf samples with a diameter of 1 cm, which are called leaf discs. Take 5 mL centrifuge tubes, add 1 leaf disc to each centrifuge tube, and then add 4 mL of deionized water, and culture at 37°C and 220 rpm for 4 hours, and then measure and record the conductivity.

[0101] Results Figure 5 (Number of samples: N=6) Compared with the group treated with the bacterial solution EtHAn-EV, the conductivity of the group treated with the bacterial solution EtHAn-AopP2 was significantly increased.

[0102] Example 3: AopP2 protein inhibits the expression of MAPK pathway

[0103] Test bacterial solution: bacterial solution EtHAn-AopP2 or bacterial solution EtHAn-EV prepared in step 1 of Example 2.

[0104] Normally cultivate Jingxin No. 4 watermelon until it has only two cotyledons, and then inoculate the test bacterial solution. Inoculation method: Each cotyledon is injected on the left and right sides of the main vein, so that the test bacterial solution fills the leaf.

[0105] The time was counted from the inoculation of the test bacteria solution. Leaves were taken at time 0, 4 hours, and 8 hours later, and total protein was extracted after rapid freezing in liquid nitrogen. Western bolt was performed. The primary antibody used in Western bolt was phospho-p44 / 42 antibody (Cell Signaling Technology; 1:1000), and the secondary antibody used was goat anti-rabbit IgG HRP (Abmart; 1:5000). Protein images were taken using the Tanon-5200 imaging system (Tanon).

[0106] Results Figure 6 Compared with the group treated with EtHAn-EV, the expression of MAPK pathway in the group treated with EtHAn-AopP2 was inhibited.

[0107] Example 4: AopP2 protein positively regulates watermelon's resistance to bacterial fruit spot

[0108] 1. Preparation of antibacterial liquid

[0109] The recombinant bacteria EtHAn-AopP2 was inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and cultured at 28°C and 200 rpm until the OD 600nm The value was 2.0, and then 10mmol / L MgCl2 aqueous solution was added to obtain a bacterial concentration of 5×10 6 cfu / mL of bacterial solution is the bacterial solution EtHAn-AopP2.

[0110] The recombinant bacteria EtHAn-EV were inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL gentamicin, and cultured at 28°C and 200 rpm until the OD 600nm The value was 2.0, and then 10mmol / L MgCl2 aqueous solution was added to obtain a bacterial concentration of 5×10 6 cfu / mL of bacterial solution is the bacterial solution EtHAn-EV.

[0111] 2. Preparation of pathogenic bacteria solution

[0112] Acidovorax citrulli AAC00-1, its full name is Paracidovorax citrulli AAC00-1, and its NCBI number is GCA_000015325.1 (RefSeq: GCF_000015325.1).

[0113] The pBBR1MCS-2 plasmid was introduced into the watermelon acidophilic bacteria AAC00-1 to obtain the recombinant bacteria AAC00-1-pBBR1MCS2.

[0114] The recombinant bacteria AAC00-1-pBBR1MCS2 was inoculated into liquid KB medium containing 100 μg / mL ampicillin and 50 μg / mL kanamycin, and cultured at 28°C and 200 rpm until the OD 600nm The value was 2.0, and then 10mmol / L MgCl2 aqueous solution was added to obtain a bacterial concentration of 2×10 8 cfu / mL of bacterial solution is pathogenic bacteria solution.

[0115] 3. Disease resistance testing

[0116] Test bacterial solution: EtHAn-AopP2 or EtHAn-EV prepared in step 1.

[0117] Normally culture the Jingxin No. 4 watermelon until it has only two cotyledons, then inoculate the test bacteria solution, and 24 hours later inoculate the pathogenic bacteria solution. Then continue normal culture.

[0118] Inoculation method of the test bacterial solution: Each cotyledon is injected on the left and right sides of the main vein so that the test bacterial solution fills the leaf.

[0119] Inoculation method of pathogenic bacteria solution: spray the whole plant, spraying about 20mL of pathogenic bacteria solution on each plant.

[0120] The time starts from the time of inoculation with the pathogenic bacteria solution. The original leaves for inoculation are taken and photographed 2, 4 and 6 days later. Figure 7 .

[0121] The timing starts from the time of inoculation with the pathogenic bacteria solution, and the original inoculated leaves are taken after 2 days and 4 days respectively. Take the leaves, use a circular hole puncher with a diameter of 1 cm to punch holes for sampling, and obtain circular leaf samples with a diameter of 1 cm, called leaf discs. Take 2mL centrifuge tubes, add 6 leaf discs to each centrifuge tube, and then add 1mL of deionized water, mash the leaves, and then use sterile deionized water to perform 10-fold gradient dilutions to obtain dilutions of various dilutions. Sample 10μL of each dilution and inoculate it on a KB culture medium plate containing 100μg / mL ampicillin and 100μg / mL kanamycin (set 6 culture medium plates for each dilution as biological replicates), culture at 28°C for 48h, and then count the number of pathogenic bacteria colonies. Calculate the number of pathogenic bacteria colonies per square centimeter of leaf discs, and the results are shown in Figure 8 (Sample size N=6).

[0122] The results showed that the disease resistance of the group inoculated with EtHAn-AopP2 was higher than that of the group inoculated with EtHAn-EV.

[0123] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A protein, which is (a1) or (a2) or (a3) ​​or (a4) or (a5) or (a6): (a1) the protein shown in SEQ ID NO: 1; (a2) a fusion protein having the protein described in (a1); (a3) a protein related to plant disease resistance obtained by replacing and / or deleting and / or adding one or more amino acid residues of the protein described in (a1); (a4) a protein that has 98% or more identity with the protein described in (a1) and is associated with plant disease resistance; (a5) a protein related to plant antibacterial activity obtained by replacing and / or deleting and / or adding one or more amino acid residues of the protein described in (a1); (a6) A protein having 98% or more identity with the protein described in (a1) and associated with plant antibacterial activity.

2. A nucleic acid molecule encoding the protein of claim 1.

3. The nucleic acid molecule according to claim 2, characterized in that: The nucleic acid molecule is as follows (b1) or (b2) or (b3): (b1) a nucleic acid molecule whose coding region is shown in positions 1 to 1515 of SEQ ID NO: 2; (b2) a nucleic acid molecule having 95% or more identity with (b1) and encoding the protein; (b3) A nucleic acid molecule that hybridizes with the nucleic acid molecule defined in (b1) under stringent conditions and encodes the protein.

4. An expression cassette, recombinant vector, recombinant microorganism or transgenic plant cell containing the nucleic acid molecule according to claim 2 or 3.

5. Use of the protein according to claim 1, the nucleic acid molecule according to claim 2, or the nucleic acid molecule according to claim 3 in positively regulating the disease resistance and / or antibacterial property of a plant.

6. The use of biomaterials as described in (c1) or (c2) or (c3): (c1) Use in the preparation of products for improving the disease resistance and / or antibacterial properties of plants; (c2) Application in plant breeding; the goal of plant breeding is to obtain plant germplasm with improved disease resistance and / or antibacterial properties; (c3) Application in the preparation of antibacterial agents; The biological material is the protein according to claim 1, the nucleic acid molecule according to claim 2, the nucleic acid molecule according to claim 3, the expression cassette according to claim 4, the recombinant vector according to claim 4 or the recombinant microorganism according to claim 4.

7. A product containing biological material; The functions of the product are as follows (d1) or (d2) or (d3): (d1) improving the disease resistance and / or antibacterial ability of plants; (d2) Plant breeding; the goal of plant breeding is to obtain plant germplasm with improved disease resistance and / or antibacterial properties; (d3) antimicrobial agents; The biological material is the protein according to claim 1, the nucleic acid molecule according to claim 2, the nucleic acid molecule according to claim 3, the expression cassette according to claim 4, the recombinant vector according to claim 4 or the recombinant microorganism according to claim 4.

8. A method for cultivating plants with improved disease resistance and / or antibacterial properties, comprising the following steps: introducing the nucleic acid molecule according to claim 2 or 3 into a recipient plant to obtain a plant with improved disease resistance and / or antibacterial properties.

9. A method for cultivating plants with improved disease resistance and / or antibacterial properties, comprising the steps of: increasing the content of the protein according to claim 1 in the plants to obtain plants with improved disease resistance and / or antibacterial properties.

10. Use of the method according to claim 8 or 9 in plant breeding.

Images