Engineering bacterium for producing fulvic alcohol as well as construction method and application of engineering bacterium

Abstract

The invention belongs to the technical field of microbial metabolism engineering and industrial biology, and relates to an engineering bacterium for producing fulvic alcohol and a construction method and application thereof. The engineering bacteria capable of increasing the content of demethylated fulvic alcohol serving as a synthetic precursor are obtained by regulating and controlling the metabolic pathway synthetase of fulvic alcohol in a host strain, and then the methyltransferase of the engineering bacteria is optimized, so that the engineering bacteria capable of producing fulvic alcohol are obtained. Wherein the host strain is selected from any saccharomyces cerevisiae carrying a fulvic alcohol path. The yeast cell factory is constructed by coordinating and balancing a plurality of precursor module metabolic flows, and the heavy synthesis of the fulvic alcohol is realized for the first time.

Description

Technical Field

[0001] The invention belongs to the field of microbial metabolic engineering and industrial biotechnology, and relates to an engineering bacterium for producing xanthohumol, a construction method and an application thereof. Background Art

[0002] The global production of hops (Humulus lupulus L.) is about 130,000 tons, most of which is used for beer making. The unique glandular hairs of hops can synthesize and store a large number of plant secondary metabolites, including terpenes, bitter acids and flavonoids. The content and proportion of these compounds have an important influence on the flavor quality of beer, and they can also be used as natural preservatives to extend the shelf life of beer. With the growing demand for beer, more and more studies have begun to explore the biological activity and medicinal value of hop metabolites. Xanthohumol is a natural prenylated chalcone with α, β-unsaturated ketone functional groups. It is the most abundant prenylated flavonoid in hops, accounting for 0.1-1% of the dry weight of female flowers. Many studies have shown that xanthohumol has a variety of biological activities, such as cancer prevention, prevention and relief of diabetes, antioxidant, anti-inflammatory, antibacterial and immunomodulatory effects (Miranda et al., J. Agric. Food Chem., 2000, 48: 3876-3884; Stevens et al., Phytochemistry, 2004, 65: 1317-1330), and has high medicinal potential.

[0003] However, during the brewing process, xanthohumol undergoes a series of changes, such as being oxidized to isoxanthohumol during boiling and being lost during filtration, etc. Therefore, the content of xanthohumol in finished beer is very low, only about 0.1 mg / L. Therefore, xanthohumol cannot simply obtain pharmacological and health effects through beer intake. On the other hand, although xanthohumol can be obtained from hops through plant extraction, the cultivation of hops is greatly affected by climate and geographical location. In addition, the traditional extraction process uses volatile organic solvents and produces a large amount of solid waste during the brewing process, causing environmental pollution problems. In order to increase the content of xanthohumol in beer, reduce environmental pollution as much as possible, and improve the brewing process without increasing costs, it has become a research hotspot in the beer brewing industry.

[0004] Microorganisms are a very ideal "cell factory" with advantages such as short growth cycle, high-density culture, and no interference from the external environment. The rapid development of synthetic biotechnology and metabolic engineering in recent years has accelerated the construction of microbial cell factories and provided an alternative method for the synthesis of complex secondary metabolites of plants. Among them, Saccharomyces cerevisiae, as an ideal host for the production of natural products, has successfully produced terpenes (Paddon et al., Nature, 2013, 496: 528-532), alkaloids (Galani et al., Science, 2015, 349: 1095-1100) and flavonoids (Liu et al., Nat. Commun., 2018, 9: 448). Therefore, the production of xanthohumol using Saccharomyces cerevisiae will serve as a sustainable development approach. However, the complexity of the biosynthetic process and the strict regulation of the metabolic supply of the precursor module make it challenging to reconstruct the synthesis pathway of xanthohumol in the yeast cell factory. In fact, there is no literature report on the production of xanthohumol using microorganisms as a platform, but the key enzymes in the biosynthesis pathway of xanthohumol in hop plants have been explored in the early stage (Novák et al., Biol. Plant., 2003, 46: 375-381; Nagel et al., Plant Cell, 2008, 20: 186-200; Xue et al., Mol. Plant. 2013, 6: 1301-1317; Li et al., Plant. Physiol., 2015, 167: 650-659). Moreover, Ban Zhaonan et al. transferred these key enzyme genes into Saccharomyces cerevisiae and achieved the biosynthesis of demethylxanthohumol, the precursor product of xanthohumol, in Saccharomyces cerevisiae by feeding p-coumaric acid (Ban et al., Proc. Natl Acad. Sci. USA, 2018, 115: E5223-E5232). Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the current difficulties in the balanced regulation of the multi-module biosynthetic pathway of yeast engineering bacteria and the adaptability of yeast endogenous metabolism, and to provide a method for constructing an engineering bacterium that produces xanthohumol and its application

[0006] To achieve the above object, the technical solution adopted by the present invention is:

[0007] A method for constructing an engineered bacterium that produces xanthohumol, comprising: regulating the synthase of the xanthohumol metabolic pathway in a host strain to obtain an engineered bacterium that increases the content of its synthetic precursor demethylxanthohumol, and then optimizing the methyltransferase of the engineered bacterium to obtain an engineered bacterium that produces xanthohumol; wherein the host strain is selected from any brewer's yeast that carries the xanthohumol pathway.

[0008] The method of regulating the enzyme synthesizing the xanthohumol metabolic pathway in the host strain is to optimize the precursor demethylxanthohumol metabolic pathway and then further regulate the substrate pathway, or to optimize the precursor demethylxanthohumol metabolic pathway and then further enhance the transferase that optimizes the synthetic precursor.

[0009] The optimized precursor demethylxanthohumol metabolic pathway is at least one of a 1-amino acid pathway metabolic pathway, a 2-malonyl coenzyme A pathway metabolic pathway, and a 3-mevalonic acid (MVA) biosynthetic pathway.

[0010] Preferably, the optimized precursor demethylxanthohumol metabolic pathway is the 1-amino acid pathway metabolic pathway, the 2-malonyl-CoA pathway metabolic pathway and the 3-mevalonic acid (MVA) biosynthetic pathway.

[0011] The amino acid pathway is:

[0012] (a) knocking out the gene encoding phenylpyruvate decarboxylase gene (ARO10) of the host strain;

[0013] (b) ARO4 containing mutant DAHP synthase gene K229L and chorismate mutase gene ARO7 G141S The expression cassette is introduced into the host strain;

[0014] The malonyl-CoA pathway is to replace the promoter of the ACC1 gene in the host strain with P TEF1 ;

[0015] The synthetic route of the MVA is:

[0016] (a) introducing an expression cassette containing a truncated hydroxy-3-methylglutaryl-CoA reductase gene tHMG1 and an isopentenyl pyrophosphate isomerase gene IDI1 into a host strain;

[0017] (b) Mutate the ERG20 gene in the host strain genome to ERG20 N127W Gene.

[0018] The transferase for enhancing and optimizing the synthesis of precursors is to transfer the isopentenyl transferase into the engineered bacteria with optimized precursor demethylxanthohumol metabolic pathway; wherein the isopentenyl transferase is HlPT1L and HlPT-1 from Humulus lupulus, the gene MaIDT from Morus alba, the gene CtIDT from Cudraniatricuspidata, the gene GuiLDT from Glycyrrhiza uralensis, the genes SfFPT and SfiLDT from Sophora flavescens, the gene LaPT1 from Lupinus albus, the genes CsPT3 and CsPT4 from Cannabis sativa, the gene NphB from Streptomyces sp.CL190, the gene AhR4DT-1 from Arachis hypogaea or the gene PcM4DT from Psoralea corylifolia.

[0019] Specifically, the above-mentioned isopentenyl transferases from different sources are introduced into the strain via plasmids, specifically:

[0020] (A) The plasmid pESC-MaIDT containing the MaIDT gene was introduced into the host strain;

[0021] (B) The plasmid pESC-CtIDT containing the CtIDT gene was introduced into the host strain;

[0022] (C) The plasmid pESC-GuILDT containing the GuiLDT gene was introduced into the host strain;

[0023] (D) The plasmid pESC-SfFPT containing the SfFPT gene was introduced into the host strain;

[0024] (E) The plasmid pESC-SfiLDT containing the SfiLDT gene was introduced into the host strain;

[0025] (F) introducing the plasmid pESC-H1PT-1 containing the H1PT-1 gene into the host strain;

[0026] (G) Introducing the plasmid pESC-LaPT1 containing the LaPT1 gene into the host strain;

[0027] (H) introducing the plasmid pESC-CsPT3 containing the CsPT3 gene into the host strain;

[0028] (I) introducing the plasmid pESC-CsPT4 containing the CsPT4 gene into the host strain;

[0029] (J) The plasmid pESC-NphB containing the NphB gene was introduced into the host strain;

[0030] (K) The plasmid pESC-PcM4DT containing the PcM4DT gene was introduced into the host strain;

[0031] (L) Plasmid pESC-AhR4DT-1 containing the AhR4DT-1 gene was introduced into the host strain.

[0032] (M) The plasmid pESC-H1PT1L containing the H1PT1L gene was introduced into the host strain.

[0033] The above (A) to (M) are in no particular order.

[0034] The substrate supply and substrate transport pathways are optimized as follows:

[0035] Increase DMAPP supply by optimizing the MVA pathway, specifically, by enhancing the upstream metabolic flux of DMAPP and by enhancing the expression of rate-limiting enzyme genes in the MVA biosynthesis pathway, including the mutant hydroxymethylglutaryl-CoA reductase 2 gene HMG2 K6R , the acetoacetyl-CoA thiolase gene ERG10 and two copies of the gene HMG2 K6R ; and strategies including attenuation of DMAPP flux to competing pathways by targeting ERG20 N127W The promoter of the gene was replaced by P HXT1 and P ERG1 Dynamic regulation of ERG20 N127W Express;

[0036] Increasing the supply of naringenin chalcone substrates by enhancing the expression of synthase genes, including chalcone synthase gene CHS_H1 and chalcone isomerase HlCHIL2;

[0037] The fusion strategy for optimizing substrate transport pathways includes removing the N-terminal signal peptide of the isopentenyl transferase gene HlPT1L to obtain a truncated isopentenyl transferase gene HlPT1L Δ1-86 , and enhanced expression of 2 copies of the gene HlPT1L Δ1-86 ; Then the isopentenyl pyrophosphate isomerase gene IDI1 and the truncated isopentenyl transferase H1PT1L Δ1-86 A fusion gene was obtained by tandem fusion, the connecting peptide was (GGGS)3, and two copies of the fusion gene were strongly expressed;

[0038] Further details include (1) to (7):

[0039] (1) ERG20 in the engineered bacteria with optimized precursor demethyl xanthohumol metabolic pathway N127W The promoter of the gene was replaced by PHXT1 ;

[0040] (2) The ERG20 in the strain obtained above was N127W The promoter of the gene was replaced by P ERG1 ;

[0041] (3) HMG2 K6R The gene and ERG10 gene expression cassette were introduced into the above strain; that is, the P GAL10 -ERG10-T CPS1 -P GAL1 -HMG2 K6R -P PGK1 The DNA fragment was integrated into the Ⅺ-2 gene locus of the strain;

[0042] (4) Containing 2 copies of HMG2 K6R The DNA fragment containing the gene expression cassette is introduced into the above strain; that is, the DNA fragment containing P GAL10 -HMG2 K6R -T TDH2 -P GAL1 -HMG2 K6R -P DIT1 The DNA fragment was integrated into the Ⅻ-3 gene locus of the strain;

[0043] (5) Introducing the CHS_H1 gene and H1CHIL2 gene expression cassettes into the above strain; that is, introducing the P GAL2 -CHS_H1-T PGK1 -P GAL7 -HlCHIL2-P PRM9 The DNA fragment was integrated into the Ⅺ-6 gene locus of the strain;

[0044] (6) The CHS_H1 gene, HlCHIL2 gene expression cassette and a gene containing two copies of HlPT1L Δ1-86 The DNA fragment containing the gene expression cassette is introduced into the above strain; that is, the DNA fragment containing P GAL2 -CHS_H1-T PGK1 -P GAL7 -HlCHIL2-P PRM9 -P GAL10 -HlPT1L Δ1-86 -T ENO2 -P GAL1 -HlPT1L Δ1-86 -T C PS1 The DNA fragment is integrated into the Ⅺ-6 gene site of the host strain;

[0045] (7) The CHS_H1 gene, HlCHIL2 gene expression cassette and a gene containing two copies of IDI1-HlPT1LΔ1-86 The DNA fragment containing the fusion gene expression cassette is introduced into the above strain, that is, GAL2 -CHS_H1-T PGK1 -P GAL7 -HlCHIL2-P PRM9 -P GAL10 -(IDI1-HlPT1L Δ1-86 )-T ENO2 -P GAL1 -(IDI1-HlPT1L Δ1-86 )-T CPS1 The DNA fragment was integrated into the Ⅺ-6 gene site of the strain.

[0046] The host strain is a strain in which the exogenous gene expression cassette of the xanthohumol pathway is introduced into any one of the cerevisiae yeasts; wherein the exogenous gene expression cassette of the xanthohumol pathway is

[0047] (I) Introducing the HlCCL1 gene and FjTAL gene expression cassettes into the host strain;

[0048] (II) introducing the CHS_H1 gene and HlCHIL2 gene expression cassettes into the host strain;

[0049] (III) introducing the H1PT1L gene and H1OMT1 gene expression cassette into one or more of the host strains. GAL1 -HlCCL1-T ADH1 -P GAL10 -FjTAL-T CYC1 The DNA fragment is integrated into the Ⅹ-2 gene site of the host strain;

[0050] (II) GAL1 -CHS_H1-T TDH2 -P GAL10 -HlCHIL2-T FBA1 The DNA fragment is integrated into the Ⅻ-1 gene site of the host strain;

[0051] (III) GAL1 -H1OMT1-T pYX212 -P GAL10 -HlPT1L-T ADH1 The DNA fragment is integrated into the Ⅻ-5 gene site of the host strain.

[0052] The optimized methyltransferase comprises at least one of (i) and (ii):

[0053] (i) introducing a DNA fragment containing two copies of the H10MT1 gene expression cassette into an engineered strain that increases the content of its synthetic precursor, demethylxanthohumol;

[0054] (ii) Introducing a DNA fragment containing two copies of the H10MT1sc gene expression cassette into an engineered strain to increase the content of its synthetic precursor, demethylxanthohumol.

[0055] As mentioned above, (a) GAL10 -H1OMT1-T TPS1 -P GAL1 -H1OMT1-T FBA1 The DNA fragment is integrated into the Ⅺ-8 gene site of the host strain;

[0056] (ii) GAL10 -H1OMT1sc-T TPS1 -P GAL1 -H1OMT1sc-T FBA1 The DNA fragment is integrated into the Ⅺ-8 gene site of the host strain.

[0057] The construction method is constructed by adopting CRISPR / Cas9 technology.

[0058] The engineering bacteria constructed by the construction method.

[0059] The application of the engineered bacteria in the preparation of xanthohumol.

[0060] The engineered bacteria are used to prepare xanthohumol. The engineered bacteria obtained above are transferred to a container containing a fermentation medium, and fermented and cultured at room temperature with shaking for 96 hours. The fermentation culture contains xanthohumol.

[0061] The beneficial effects of this application include:

[0062] The present invention constructs a yeast cell factory by coordinating and balancing the metabolic flows of multiple precursor modules, and realizes the de novo synthesis of xanthohumol for the first time.

[0063] The construction method of the engineered bacteria provided in the present application improves the production of the precursor demethylated xanthohumol by optimizing the metabolism of multiple precursor modules, screening isopentenyl transferase, increasing substrate supply, and optimizing substrate transport channels, and then synthesizes xanthohumol by optimizing methyltransferase, thereby achieving synergistic cooperation between modules, thereby successfully synthesizing 142 μg / L xanthohumol in brewer's yeast. BRIEF DESCRIPTION OF THE DRAWINGS

[0064] Figure 1 Schematic diagram of the metabolic engineering strategy provided in an embodiment of the present invention to promote the synthesis of xanthohumol in Saccharomyces cerevisiae.

[0065] Figure 2 The yield of the optimized precursor module metabolism provided in the embodiment of the present invention, wherein A is the yield of the precursor products naringenin chalcone and naringenin; B is the yield effect diagram of the precursor product demethylxanthohumol.

[0066] Figure 3 The results of screening isopentenyl transferase to regulate the production of the precursor demethylxanthohumol provided in the embodiments of the present invention, wherein A is a phylogenetic tree analysis of 13 isopentenyl transferases; and B is a diagram showing the production effect of the precursor product demethylxanthohumol.

[0067] Figure 4 The invention provides an embodiment of the invention for increasing substrate supply and optimizing substrate transport channels to regulate the production of the precursor product demethylxanthohumol, wherein A and B are the production of the precursor product demethylxanthohumol modified by enhancing the supply of the substrate DMAPP; C is the production of the precursor product demethylxanthohumol regulated by increasing the supply of the substrate naringenin chalcone and optimizing the substrate transport channels.

[0068] Figure 5 This is a diagram showing the yield effect of xanthohumol synthesis by optimizing methyltransferase provided in an embodiment of the present invention.

[0069] Figure 6 The liquid chromatogram and mass spectrum of xanthohumol synthesized by Saccharomyces cerevisiae provided in the embodiments of the present invention. DETAILED DESCRIPTION

[0070] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments.

[0071] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0072] Unless otherwise specified, the reagents and materials used in the following examples can be obtained from commercial sources;

[0073] Unless otherwise specified, the parameters used in the following examples are those recommended by the manufacturer.

[0074] In the present embodiment, based on strain SY03 (MATa, MAL2-8c, SUC2, his3Δ, ura3-52, gal80Δ, XI-5::P TEF1 -Cas9-T CYC1 ) were transformed; among them, the brewer's yeast strain SY03 was obtained by knocking out the gene GAL80 based on the SY02 strain; the strain SY02 has been recorded in patent 202010428088.2.

[0075] The Saccharomyces cerevisiae CEN.PK113-11C used in the examples of the present application was from Euroscarf (Oberursel, Germany).

[0076] The formula of the basic component fermentation medium (Delft-D) used in the examples of this application is as follows: 20g / L glucose, 2.5g / L (NH4)2SO4, 14.4g / L KH2PO4, 0.5g / L MgSO4·7H2O, 2mL trace metal solution (including: 3mg / L FeSO4·7H2O, 4.5mg / L ZnSO4·7H2O, 4.5mg / L CaCl2·2H2O, 1mg / L MnCl2·4H2O, 0.3mg / LCoCl2·6H2O, 0.3mg / L CuSO4·5H2O, 0.4mg / L Na2MoO4·2H2O, 1mg / L H3BO3, 0.1mg / L KI, 19mg / L Na2EDTA·2H2O), 1mL vitamin solution (including: 0.05mg / L D-biotin, 1mg / L D-calcium pantothenate, 1 mg / L thiamine, 1 mg / L pyridoxine nicotinate, 1 mg / L nicotinic acid, 0.2 mg / L p-aminobenzoic acid, 25 mg / L inositol), the initial pH is adjusted to 5.6 with 2 mM KOH solution; the formula of the screening medium (SD) is: 6.7 g / L yeast basal nitrogen medium (YNB) and 20 g / L glucose; the above two culture media are supplemented with 0.02 g / L amino acid uracil (URA) or 0.02 g / L amino acid histidine (HIS) according to the corresponding situation.

[0077] In the following examples, gene modification was performed using the CRISPR / Cas9 system (see Yang et al., Appl. Microbiol. Biotechnol., 2020, 104: 3037-3047).

[0078] The schematic diagram of the metabolic engineering transformation strategy of the present invention to construct an engineering bacterium that promotes the synthesis of xanthohumol in Saccharomyces cerevisiae is as follows Figure 1 shown.

[0079] Firstly, a Saccharomyces cerevisiae strain producing a precursor product demethylxanthohumol and a construction method thereof are constructed, which can synthesize the precursor product demethylxanthohumol.

[0080] The construction method comprises: optimizing the metabolism of multiple precursor modules and screening isopentenyl transferase.

[0081] In a specific embodiment,

[0082] (1) Construction of a host strain carrying the xanthohumol pathway: First, a yeast strain YS103 carrying the xanthohumol pathway was constructed. Using the CRISPR / Cas9 system, a gene containing P GAL1 -HlCCL1-T ADH1 -P GAL10 -FjTAL-T CYC1 , PGAL1 -CHS_H1-T TDH2 -P GAL10 -HlCHIL2-T FBA1 and P GAL1 -H1OMT1-T pYX212 -P GAL10 -HlPT1L-T ADH1 The three gene expression cassettes containing exogenous genes of the fusion DNA fragment were respectively integrated into the three X-2, XII-1, and XII-5 gene sites of the yeast strain SY03, thereby obtaining the yeast strain YS103. The exogenous gene FjTAL was obtained by whole gene synthesis (sequence reference Jendrese et al., Appl. Environ. Microbiol, 2015, 81: 4458-4476), the exogenous gene HlCCL1 (sequence reference Xue et al., Mol. Plant., 2013, 6: 1301-1317), HlCHIL2 (sequence reference Ban et al., Proc. Natl Acad. Sci. USA, 2018, 115: E5223-E5232), CHS_H1 (sequence reference Novák et al., Biol. Plant., 2003, 46: 375-381), HlPT1L (sequence reference Li et al., Plant. Physiol., 2015, 167: 650-659), HlOMT1 (sequence reference Nagel et al., Plant Cell, 2008, 20: 186-200) was provided directly by Wang Guodong's research group (see Ban et al., Proc. Natl Acad. Sci. USA, 2018, 115: E5223-E5232). Promoter P GAL10 , P GAL1 and terminator T CYC1 、T ADH1 、T FBA1 、T TDH2 The CEN.PK113-11C genome (wild-type Saccharomyces cerevisiae) was used as a template for amplification, and the terminator T pYX212 The gene was amplified using plasmid PYX212 as template.

[0083] The fermentation broth of the strain YS103 was extracted and tested, and only the precursor products naringenin chalcone and naringenin ( Figure 2 ).

[0084] (2) Optimizing multiple prerequisite metabolic modules on the host strain:

[0085] For the amino acid pathway of module 1, the supply of precursor p-coumaric acid coenzyme A was increased. Based on the engineered bacteria YS103, the phenylpyruvate decarboxylase gene ARO10 in the competitive pathway was knocked out, and a gene expression cassette that relieved the negative feedback inhibition of L-tyrosine was constructed and integrated into the ARO10 gene site: P GAL10 -ARO7 G141S -T HIS3 -P GAL1 -ARO4 K229L -T ENO2 , and obtained the engineered bacteria YS107; for module 2 malonyl-CoA pathway, the supply of precursor malonyl-CoA was increased, and on the basis of the engineered bacteria YS107, P TEF1 Replace the ACC1 gene promoter to enhance metabolic flow and obtain the engineered bacteria YS111; for module 3, the MVA pathway is used to increase the supply of the precursor DMAPP. Based on the engineered bacteria YS111, the first step is to construct a gene expression cassette for the rate-limiting enzyme integrated into the X-4 gene site: P GAL10 -IDI1-P DIT1 -P GAL1 -tHMG1-T PRM9 , and obtain the engineered bacteria YS112; the second step is to mutate the ERG20 gene on the genome of the engineered bacteria into ERG20 N127W gene (method reference: Yang et al., Appl. Microbiol. Biotechnol., 2020, 104: 3037-3047) to obtain the engineered bacteria YS116.

[0086] After fermentation, extraction and testing, the precursor products naringenin chalcone and naringenin were detected in the engineered bacteria YS107, YS111, YS112 and YS116. In addition, the precursor product demethyl xanthohumol was obtained by the engineered bacteria YS116, and the yield reached 13 μg / L ( Figure 2 ).

[0087] (3) After optimizing the metabolic module, the engineered bacteria can further increase the precursor content by increasing the enzyme expression, screening enzymes or regulating substrates, specifically:

[0088] 1) By increasing enzyme expression and screening enzymes

[0089] ① By constructing a high-copy plasmid pESC-HlPT1L carrying the rate-limiting step isopentenyl transferase, the expression of the enzyme was enhanced. The plasmid was constructed by digesting pESC-URA with BamHⅠ / SalⅠ restriction sites to obtain a linear plasmid, and then connected with the isopentenyl transferase gene HlPT1L by seamless cloning, and transformed into Escherichia coli competent cells. The correct plasmid was named pESC-HlPT1L after colony PCR verification, restriction digestion verification and sequencing verification, and the plasmid was transferred into the engineering bacteria YS116 to obtain the engineering bacteria YS117. After fermentation, extraction and detection of 104 μg / L of demethyl xanthohumol ( Figure 2 ), and thus concluded that isopentenylation is the rate-limiting step of the xanthohumol pathway, and the yield of demethylated xanthohumol can be increased by increasing the expression level of isopentenyl transferase or the activity of the enzyme. The construction of other isopentenyl transferase plasmids and the editing work of expression in Saccharomyces cerevisiae follow a similar process.

[0090] ② On this basis, isopentenyl transferase was screened, and the specific implementation method was as follows: 12 isopentenyl transferase genes were selected through literature research, and all of these enzymes were fully synthesized after Saccharomyces cerevisiae codon optimization, including: HlPT-1 from Humulus lupulus, gene MaIDT from Morus alba, gene CtIDT from Cudraniatricuspidata, gene GuiLDT from Glycyrrhiza uralensis, gene SfFPT and SfiLDT from Sophora flavescens, gene LaPT1 from Lupinus albus, gene CsPT3 and CsPT4 from Cannabis sativa, gene NphB from Streptomyces sp. CL190, gene AhR4DT-1 from Arachis hypogaea, gene AhR4DT-2 from Psoralea corylifolia gene PcM4DT. First, the protein sequences of these 12 enzymes and HlPT1L were compared. The phylogenetic tree was constructed using the software MEGA7 to analyze the evolutionary relationship of these 13 enzymes. The results showed that enzymes HlPT1L and CsPT4 were in the same branch, indicating that their enzyme catalytic functions were similar. At the same time, HlPT1L had a close evolutionary relationship with MaIDT, CtIDT and CsPT3, but a distant evolutionary relationship with other isopentenyl transferases ( Figure 3 A).

[0091] ③Construct high-copy plasmids carrying these 12 isopentenyl transferases, including: pESC-MaIDT, pESC-CtIDT, pESC-GuILDT, pESC-SfFPT, pESC-SfiLDT, pESC-HlPT-1, pESC-LaPT1, pESC-CsPT3, pESC-CsPT4, pESC-NphB. The construction method is as mentioned above. These plasmids are also transferred into the engineering bacteria YS116 to obtain the corresponding engineering bacteria (named after the isopentenyl transferase). After fermentation, extraction and detection, the results showed that the enzymes MaIDT, HlPT-1 and LaPT1 obtained the most significant demethylated xanthohumol production, which were 84μg / L, 112μg / L and 121μg / L, respectively. Figure 3 B).

[0092] The results showed that although the isopentenyl transferases screened from other sources could increase the precursor content to a certain extent, the increase was not obvious compared with the control HlPT1L from Humulus lupulus, so it was necessary to develop and construct other pathways.

[0093] 2) By regulating substrates:

[0094] ① Based on the engineered bacteria YS116, increase the substrate supply and optimize the substrate transport channel. Specifically, increase the substrate supply, including increasing the DMAPP supply. With the help of the CRISPR / Cas9 system, first increase the ERG20 N127W The promoter of the gene was replaced by P HXT1 and P ERG1 Dynamic regulation of ERG20 N127W The expression of the MVA pathway rate-limiting enzyme gene was strongly expressed on the basis of the engineered bacteria YS116 to enhance the upstream metabolic flow of DMAPP and convert HMG2 K6R and ERG10 gene expression cassette (P GAL10 -ERG10-T CPS1 -P GAL1 -HMG2 K6R -P PGK1 ) was integrated into the Ⅺ-2 gene locus to obtain the engineered strain YS121, and two copies of HMG2 were further added to the engineered strain YS121. K6R Gene expression cassette (P GAL10 -HMG2 K6R -T TDH2 -P GAL1 -HMG2 K6R -P DIT1 ) was integrated into the Ⅻ-3 gene locus to obtain the engineered bacterium YS123.

[0095] After fermentation, extraction and testing, the engineered bacteria YS119, YS120, YS121 and YS123 can increase the production of demethylated xanthohumol ( Figure 4 ).

[0096] ② Increasing the substrate supply also includes increasing the supply of naringenin chalcone. By strongly expressing the chalcone synthase gene CHS_H1 and the chalcone isomerase gene HlCHIL2 that enhances the activity of chalcone synthase, these two genes were integrated into the Ⅺ-6 gene site of the engineered bacteria YS116 to obtain the engineered bacteria YS125. After fermentation, extraction and testing, the yield of demethylated xanthohumol can be increased to 149μg / L ( Figure 4 ).

[0097] ③ Based on the engineered bacteria YS116, the substrate transport pathway was further optimized. The specific implementation method is as follows: First, the key rate-limiting isopentenyl transferase gene HlPT1L was removed by removing the signal peptide to obtain a truncated HlPT1L. Δ1-86 , two copies of HlPT1L Δ1-86 The gene expression cassette was integrated into its Ⅺ-6 gene site to obtain the engineered bacterium YSC1.

[0098] ④ In truncated HlPT1L Δ1-86 Based on the gene, the truncated HlPT1L was fused with a connecting peptide (GGGS)3 by protein fusion. Δ1-86 The specific implementation method is as follows: the IDI1 gene is fused with H1PT1L Δ1-86 The N-terminus of the gene was fused through a connecting peptide (GGGS) 3 to obtain the fusion gene IDI1-HlPT1L Δ1-86 Then the fusion gene IDI1-H1PT1L Δ1-86 The gene expression cassette constructed with the promoter and terminator was fused with the upstream and downstream homologous arms of the Ⅺ-6 site to obtain the donor DNA, which was integrated into the Ⅺ-6 gene site of the engineering bacteria YS116 to obtain the engineering bacteria YSC3.

[0099] After fermentation, extraction and testing, the engineered bacteria YSC1 and YSC3 can increase the production of demethylxanthohumol, and the production of YSC3 is particularly significant, reaching 4 mg / L. It is concluded that the fusion method is most conducive to the synthesis of demethylxanthohumol ( Figure 4 ).

[0100] Then, the engineered bacteria that produced demethylated xanthohumol by methyltransferase were optimized to synthesize xanthohumol, thereby obtaining an engineered bacteria that synthesizes xanthohumol. Specifically, the methyltransferase gene HlOMT1 codon was first optimized and then the whole gene was synthesized to obtain HlOMT1sc. Then, with the help of CRISPR / Cas9 system, two copies of HlOMT1 and HlOMT1sc gene expression cassettes were respectively integrated into the Ⅺ-8 gene site of the engineered bacteria YSC3 to obtain engineered bacteria YSC6 and YSC7, respectively. After fermentation, extraction and detection, xanthohumol was detected in both of them. Among them, YSC7 had the highest content, reaching 142μg / L ( Figure 4 ).

[0101] Example 1 Optimization of precursor module metabolism to produce demethylated xanthohumol

[0102] (1) Integration and expression of exogenous genes

[0103] Based on the chassis strain SY02 (described in patent 202010428088.2), the GAL80 gene was knocked out with the help of the CRISPR / Cas9 system to obtain the engineered strain SY03 (MATa, MAL2-8c, SUC2, his3Δ, ura3-52, gal80Δ, XI-5::P TEF1 -Cas9-T CYC1 ), and strain SY03 was used as the starting strain.

[0104] First, the exogenous genes FjTAL and HlCCL1 were integrated into the engineered bacteria SY03 into the X-2 locus (the donor DNA was X-2up-T CYC1 -FjTAL-P GAL10-GAL1 -HlCCL1-T ADH1 -X-2dw) synthesis precursor p-coumaric acid coenzyme A;

[0105] Subsequently, CHS_H1 and H1CHIL2 were integrated into the Ⅻ-1 locus (donor DNA was Ⅻ-1up-T FBA1 -HlCHIL2-P GAL10-GAL1 -CHS_H1-T TDH2 -Ⅻ-1dw) synthetic precursor product naringenin chalcone;

[0106] Re-integrate genes H1PT1L and H1OMT1 into the Ⅻ-5 site (donor DNA is Ⅻ-5up-T ADH1 -HlPT1L-P GAL10-GAL1 -H1OMT1-T pYX212 -Ⅻ-5dw) constructed a complete xanthohumol pathway and obtained the engineered bacterium YS103.

[0107] The exogenous gene FjTAL was obtained by whole gene synthesis (sequence reference Jendrese et al., Appl. Environ. Microbiol, 2015, 81: 4458-4476), the exogenous gene HlCCL1 (sequence reference Xu et al., Mol. Plant., 2013, 6: 1301-1317), HlCHIL2 (sequence reference Ban et al., Proc. Natl Acad. Sci. USA, 2018, 115: E5223-E5232), CHS_H1 (sequence reference Novák et al., Biol. Plant., 2003, 46: 375-381), HlPT1L (sequence reference Li et al., Plant. Physiol., 2015, 167: 650-659), HlOMT1 (sequence reference Nagel et al., Plant Cell, 2008, 20: 186-200) was directly provided by Wang Guodong's research group (see Ban et al., Proc. Natl Acad. Sci. USA, 2018, 115: E5223-E5232);

[0108] Promoter P GAL10-GAL1 and terminator T CYC1 、T ADH1 、T FBA1 、T TDH2 The CEN.PK113-11C genome (wild-type Saccharomyces cerevisiae) was used as a template for amplification, and the terminator T pYX212 The gene was amplified using plasmid PYX212 as template.

[0109] The specific steps of gene expression cassette construction and genome integration are as follows: first, construct an sgRNA expression vector and a gene expression cassette targeting a chromosomal integration gene site; then, amplify 300 bp sequences upstream and downstream of the integration site, the gene reading frame, the promoter and the terminator, respectively, and obtain a complete fusion donor DNA fragment by a fusion PCR method (refer to Zhou et al., J. Am. Chem. Soc., 2012, 134: 3234-3241 for the construction process of the fusion fragment); then, the sgRNA expression vector and the donor DNA fragment (500 ng each) are transformed into a cerevisiae strain by a chemical transformation method, spread on a screening plate and cultured at 30°C for 3 days. After the transformants are cultured in liquid SD medium, they are verified to be correct by bacterial PCR, and spread on an SD plate containing 5-fluoroorotic acid for plasmid loss. The strain after plasmid loss is stored for future use. Taking the integration of FjTAL and HlCCL1 genes into chromosome X-2 gene locus as an example: construct an sgRNA expression vector targeting chromosome X-2 locus; at the same time, construct FjTAL and HlCCL1 gene expression cassettes, amplify 300bp sequences of upstream and downstream homologous arms of gene X-2 locus (X-2up and X-2dw), genes FjTAL and HlCCL1, bidirectional promoter P GAL10-1 , terminator T CYC1 and terminator T ADH1 The complete donor DNA fragment was obtained by fusion PCR; the chromosome X-2 site in Saccharomyces cerevisiae was determined by searching the reference (Mikkelsen et al., Metab. Eng., 2012, 14: 104-111) and NCBI database (the primer sequences for the upstream homology arm X-2up amplification were X-2up-F: ATATCAACTACGAGAGCGATCGATT, X-2up-(cyc1t)-R: GAGAAGGTTTTGGGACGCTCGAAGGCTTTAATTTGCGCACGTGACCACTTCGAGA G; the primer sequences for the downstream homology arm X-2dw amplification were X-2dw-(adh1t)-F: CAAATCGCTCCCCATTTCACCCAATTGTAGATATGCACCGGGCGACTAGGAAGAG, X-2dw-R: CTCGCCAAGGCATTACCATC). The correct transformants were then transformed and verified by the above method. Other genome editing work on Saccharomyces cerevisiae described below follows a similar process.

[0110] The engineered bacteria YS103 was fermented, extracted and tested, and the results showed that the engineered bacteria only synthesized the precursor products naringenin chalcone and naringenin ( Figure 2), Fermentation conditions: The activated strain YS103 was cultured in 2 mL Delft-D medium at 30°C and 220 rpm for 24 h, then transferred to 20 mL Delft-D fermentation medium / 100 mL shake flask, with initial OD 600 = 0.1, initial pH 5.6, and fermented at 30°C and 220 rpm for 96 h. The medium was supplemented with the corresponding amino acids according to the genotype defects of the strain, and finally the biomass and yield were determined; Extraction conditions: The fermentation broth was crushed 3 times with an ultra-high pressure continuous flow cell disruptor at 1800 MPa, then extracted with ethyl acetate at 1600 rpm for 20 min, centrifuged at 2000 g for 10 min, and the upper organic clear liquid was evaporated to dry ethyl acetate on a rotary evaporator, and finally re-dissolved with methanol and filtered into liquid chromatography to detect the yield. The engineering bacteria fermentation and extraction work below all follow similar processes.

[0111] (2) Optimizing metabolism of multiple precursor modules

[0112] Based on the engineered bacteria SY103, the metabolism of multiple precursor modules was optimized, including: module 1 amino acid pathway to enhance the supply of precursor p-coumaric acid CoA, module 2 malonyl CoA pathway to enhance the supply of precursor malonyl CoA, module 3 MVA pathway to enhance the supply of precursor DMAPP, and the engineered bacteria YS116 was obtained.

[0113] The detailed process is as follows. Based on the engineered bacteria YS103, the phenylpyruvate decarboxylase gene ARO10 in the competitive pathway was first knocked out, and then the mutant DAHP synthase gene ARO4 that relieves the negative feedback inhibition of L-tyrosine was K229L and chorismate mutase gene ARO7 G141S Integrated into the ARO10 gene locus (donor DNA is aro10up-T HIS3 -ARO7 G141S -P GAL10-GAL1 -ARO4 K229L -T ENO2 -aro10dw), to obtain the engineered bacteria YS107; then, based on the engineered bacteria YS107, promoter P TEF1 The ACC1 gene promoter was replaced to enhance the malonyl-CoA metabolic flow, and the engineered bacterium YS111 was obtained. Then, based on the engineered bacterium YS111, the truncated hydroxy-3-methylglutaryl-CoA reductase gene tHMG1 and the isopentenyl pyrophosphate isomerase gene IDI1 of the rate-limiting step of the MVA pathway were integrated into the X-4 gene locus (the donor DNA was X-4up-T DIT1 -IDI1-P GAL10-GAL1 -tHMG1-T PRM9 -X-4dw), to obtain the engineered bacteria YS112; the ERG20 gene on the genome of the engineered bacteria YS112 was mutated to ERG20N127W The gene is about to mutate the base AAT to TGG (method reference: Yang et al., Appl. Microbiol. Biotechnol., 2020, 104: 3037-3047) to obtain the engineered bacteria YS116.

[0114] After fermentation, extraction and testing, the engineered bacteria YS107, YS111, YS112 and YS116 were able to detect the precursor products naringenin chalcone and naringenin. In addition, the engineered bacteria YS116 was able to obtain the precursor product demethyl xanthohumol, with a yield of 13 μg / L.

[0115] Example 2 Screening of isopentenyl transferase to improve the efficiency of demethylxanthohumol synthesis

[0116] Through the above transformation, it was found that isopentenylation was the rate-limiting step, so a high-copy plasmid pESC-HlPT1L carrying isopentenyl transferase was constructed to increase the synthesis of the precursor product demethylxanthohumol by enhancing the expression level of the enzyme.

[0117] The method for constructing the plasmid is as follows: the empty plasmid pESC-URA is digested with BamHⅠ / SalⅠ restriction sites to obtain a linear plasmid, and then connected with the isopentenyl transferase gene HlPT1L (the gene amplification sequence has restriction site nucleotides at both ends, and the corresponding amplification primer sequences are HlPT1L-F: TCAAGGAGAAAAAACCCCGGATCCATGGAATTGTCTTCTGTTTCTTCTTTTTC, HlPT1L-R: ATCAACTTCTGTTCCATGTCGACTTAAATAAACAAATAAACAACATATTCAGCAG) by a seamless cloning method, and transformed into Escherichia coli competent cells. The correct plasmid verified by colony PCR, restriction digestion and sequencing was named pESC-HlPT1L, and then the plasmid was transferred into the engineered bacteria YS116 to obtain the engineered bacteria YS117.

[0118] After fermentation and extraction, 104 μg / L of demethyl xanthohumol was detected ( Figure 2 ), it was concluded that isopentenylation is the rate-limiting step of the xanthohumol pathway, and increasing the expression of isopentenyl transferase by using high-copy plasmid expression can increase the yield of demethylated xanthohumol. Therefore, isopentenyl transferases from other sources were screened to replace HlPT1L to improve the reaction efficiency. The construction of other isopentenyl transferase plasmids and the editing work of expression in Saccharomyces cerevisiae follow similar procedures.

[0119] On this basis, isopentenyl transferase was screened, and the specific implementation method was as follows: first, 12 isopentenyl transferase genes were selected through literature research, and all of these enzymes were fully synthesized after Saccharomyces cerevisiae codon optimization, including: HlPT-1 from Humulus lupulus, gene MaIDT from Morus alba, gene CtIDT from Cudraniatricuspidata, gene GuiLDT from Glycyrrhiza uralensis, genes SfFPT and SfiLDT from Sophora flavescens, gene LaPT1 from Lupinus albus, genes CsPT3 and CsPT4 from Cannabis sativa, gene NphB from Streptomyces sp.CL190, gene AhR4DT-1 from Arachis hypogaea, and gene AhR4DT-2 from Psoralea corylifolia gene PcM4DT. First, the protein sequences of these 12 enzymes and HlPT1L were compared. The phylogenetic tree was constructed using the software MEGA7. The evolutionary relationship of these 13 enzymes was first analyzed. The results showed that the enzymes HlPT1L and CsPT4 were in the same branch, indicating that their enzyme catalytic functions were similar. At the same time, HlPT1L had a close evolutionary relationship with MaIDT, CtIDT and CsPT3, but a distant evolutionary relationship with other isopentenyl transferases ( Figure 3 A).

[0120] Secondly, high-copy plasmids carrying these 12 isopentenyl transferases were constructed respectively. The construction method was the same as above. The correct plasmids were named as follows: pESC-MaIDT, pESC-CtIDT, pESC-GuILDT, pESC-SfFPT, pESC-SfiLDT, pESC-HlPT-1, pESC-LaPT1, pESC-CsPT3, pESC-CsPT4, and pESC-NphB. These plasmids were also transferred into the engineering bacteria YS116 to obtain the corresponding engineering bacteria (named after the isopentenyl transferase). After fermentation, extraction and detection, the results showed that the enzymes MaIDT, HlPT-1, and LaPT1 obtained the most significant demethylated xanthohumol production, which were 84 μg / L, 112 μg / L, and 121 μg / L, respectively (see Figure 3 B)

[0121] The results showed that although the isopentenyl transferases screened from other sources could increase the precursor content to a certain extent, the increase was not obvious compared with the control HlPT1L from Humulus lupulus, so it was necessary to develop and construct other pathways.

[0122] Example 3 Increasing substrate supply and optimizing substrate channels to improve demethylxanthohumol synthesis efficiency

[0123] (1) Increase substrate supply

[0124] Based on the engineered bacteria YS116, the demethylation synthesis efficiency was improved by increasing the substrate supply, including optimizing the substrates DMAPP and naringenin chalcone. The detailed process is shown below.

[0125] To increase the supply of substrate DMAPP, firstly N127W The promoter of the gene is replaced by promoter P HXT1 and P ERG1 , dynamically regulates ERG20 N127W expression, reducing the metabolic flow from the downstream of DMAPP to FPP, and obtaining the engineered bacteria YS119 (promoter P HXT1 ) and YS120 (promoter P ERG1 );

[0126] After fermentation, extraction and testing, the engineered bacteria YS119 and YS120 can increase the production of demethylxanthohumol, but YS119 (replaced with promoter P HXT1 ) is more prominent ( Figure 4 )

[0127] The rate-limiting enzyme gene of the MVA pathway was strongly expressed in the engineered bacteria YS116 to enhance the upstream metabolic flow of DMAPP and to convert the gene HMG2 K6R and ERG10 were integrated into the Ⅺ-2 gene locus (donor DNA was Ⅺ-2up-T CPS1 -ERG10-P GAL10-GAL1 -HMG2 K6R -P PGK1 -Ⅺ-2dw), and obtained the engineered bacteria YS121; on this basis, two copies of the gene HMG2 K6R Integrated into the Ⅻ-3 gene locus (donor DNA is Ⅻ-3up-T TDH2 -HMG2 K6R -P GAL10-GAL1 -HMG2 K6R -P DIT1 -Ⅻ-3dw) to obtain the engineered bacteria YS123.

[0128] After fermentation, extraction and testing, the engineered bacteria YS119, YS120, YS121 and YS123 can increase the production of demethylated xanthohumol ( Figure 4 ).

[0129] To enhance the supply of naringenin chalcone, the chalcone synthase gene CHS_H1 and the chalcone isomerase gene HlCHIL2, which assists in increasing the activity of the enzyme, were strongly expressed and integrated into the Ⅺ-6 gene locus (donor DNA was Ⅺ-6up-P GAL2 -CHS_H1-T PGK1 -P PRM9 -HlCHIL2-P GAL7 -Ⅺ-6dw), and obtained the engineered bacteria YS125. After fermentation, extraction and testing, it was found that the synthesis efficiency of demethylxanthohumol could be improved, and the yield reached 149μg / L.

[0130] (2) Optimizing substrate channels

[0131] On the basis of increasing the substrate supply, the free substrate in the cytoplasm is optimized. The specific implementation method is as follows: the isopentenyl transferase in the rate-limiting step has a membrane-targeting signal peptide. The truncated HlPT1L is first obtained by removing the signal peptide from the isopentenyl transferase gene HlPT1L. Δ1-86 (Based on the HlPT1L gene sequence, the N-terminal 1 to 86 bases were truncated, and the start codon ATG was added before the remaining base sequence) to increase the contact opportunity between the enzyme and the substrate. Based on the engineered bacteria YS116, two copies of HlPT1L Δ1-86 The enzyme genes CHS_H1 and H1CHIL2 were integrated into the Ⅺ-6 gene locus (donor DNA was Ⅺ-6up-P GAL2 -CHS_H1-T PGK1 -T ENO2 -HlPT1L Δ1-86 -P GAL10-GAL1 -HlPT1L Δ1-86 -T CPS1 -P PRM9 -HlCHIL2

[0132] -P GAL7 -Ⅺ-6dw) to obtain the engineered bacteria YSC1.

[0133] Based on the engineered strain YS116, two copies of the truncated HlPT1L were integrated Δ1-86 Compared with the previous gene, the truncated HlPT1L was fused to the truncated HlPT1L gene using a connecting peptide (GGGS) 3 (the base sequence of the gene is GGCGGTGGTGGTAGTGGTGGCGGAGGTTCTGGTGGAGGAGGTAGC). Δ1-86 The specific implementation method is as follows: the IDI1 gene is fused with H1PT1L Δ1-86 The N-terminus of the gene was fused through a connecting peptide (GGGS) 3 to obtain the fusion gene IDI1-HlPT1LΔ1-86 , the fusion gene IDI1-HlPT1L Δ1-86 and promoter (P GAL10-GAL1 ), terminator (T ENO2 and T CPS1 ) was constructed into a gene expression cassette, and then two copies of the gene expression cassette (carrying the fusion gene IDI1-H1PT1L Δ1-86 ) and the enzyme genes CHS_H1 and H1CHIL2 were integrated into the Ⅺ-6 gene locus (donor DNA was Ⅺ-6up-P GAL2 -CHS_H1-T PGK1 -T ENO2 -(IDI1-HlPT1L Δ1-86 )-P GAL10-GAL1 -(IDI1-HlPT1L Δ1-86 )-T CPS1 -P PRM9 -HlCHIL2-P GAL7 -Ⅺ-6dw) to obtain the engineered bacteria YSC3.

[0134] After fermentation, extraction and testing, the engineered bacteria YSC1 and YSC3 can increase the production of demethylxanthohumol, and the production of YSC3 is particularly significant, reaching 4 mg / L. The results show that IDI1-HlPT1L Δ1-86 The fusion method is most conducive to the synthesis of xanthohumol.

[0135] Example 4 Optimization of demethyltransferase to synthesize xanthohumol

[0136] Based on the ability to synthesize sufficient demethylated xanthohumol engineering bacteria YSC3, the methyltransferase gene H10MT1 from Humulus lupulus was codon optimized and then fully synthesized to obtain H10MT1sc, and then the two genes were strongly expressed. The specific implementation method is as follows: With the help of the CRISPR / Cas9 system, two copies of each gene H10MT1 and H10MT1sc were integrated into the Ⅺ-8 gene locus, and the donor DNA was: Ⅺ-8up-T TPS1 -H1OMT1-P GAL10-GAL1 -H1OMT1-T FBA1 -Ⅺ-8dw and Ⅺ-8up-T TPS1 -H10MT1sc-P GAL10-GAL1 -H1OMT1sc-T FBA1 -Ⅺ-8dw, respectively, obtained engineered bacteria YSC6 and YSC7, after fermentation extraction and testing, both detected xanthohumol, the engineered strain YSC7 had the highest yield, reaching 142μg / L ( Figure 5In addition, liquid chromatography-mass spectrometry analysis was performed on the engineered bacteria YSC3 and YSC7 to characterize the xanthohumol produced by the engineered bacteria. The results showed that the engineered bacteria synthesized xanthohumol ( Figure 6 ).

[0137] The above are only a few embodiments of the present application and do not constitute any form of limitation to the present application. Although the present application is disclosed as above with preferred embodiments, it is not intended to limit the present application. Any technician familiar with the profession, without departing from the scope of the technical solution of the present application, using the technical content disclosed above to make slight changes or modifications are equivalent to equivalent implementation cases and fall within the scope of the technical solution.

[0138] IDT

[0139] ATGGAACTTAGTATCAGTCACAGTAGTTTGAGGTTGCCAGCTATCATCCCACAAAGATGCAAGG

[0140] CCAGTTCTCACGAGAAGAGGTTGTTCAGTATCAAACCAACTACTAAAAATATTAAATCTTCTAA

[0141] CTTTCCTTCTAATTGTTCTACCGCTAATAAATTGATCTTGCCACTTGGTCTTTACGGAGAGAGGA

[0142] AGTTGTCTAAGTCTTTGTTGTACGGTCAGCATAGAAGGAATTCTACCACCATTAGAGCCAGTGC

[0143] TGAAGCCCACGAGTCTGCCAACAATTCTGACGGTACCTTCGCTAAATTCAGTTCTTTCGGTTCT

[0144] GCCTTGTATAAGTTTTTGAGAATCTATGCCTTGAGTCACACCATCGTCAGTACCGTCAGTTTGTT

[0145] TGCTAGAGTCTTGGCGAAACCCACACCTTTTCAAGTGGTCTTTGGTCTTGAAGGCCTTCCCC

[0146] GGTTTGATCGCTATGACCCTTGCTAATGCTTATTACATTGGTATTAATCAAATTTATGACGCTGATA

[0147] TCGATAGAGTCAACAAGCCATATTTGCCAATCCCAGCCGGAGAGCTTAGTCTTAAGCACGCTTG

[0148] GATCTTGGTCATTTCTTTCGCCGTTGGTGCCCTTTCTATCCTTAGACTTATGAATGCTGACTGGAT

[0149] CACTACTTCTATTTTCTGCTTTGGATTGTTCCTTGCCCACTTCTATTCTGCCCCACCACTTAGGTT

[0150] CAAGCAGTCTCCAATCGCCACCTCTATCGTCAACCCACTTAACGCCGGTATCGTCCATAACTTGG

[0151] GACTTATCTACGCCACTAGAGCCTCTTTGGGATTGCCTTTCGTCTGGAACCCAAGTACCTTGTTC

[0152] ATTGTTAATTTTATCACCCCATTCTTCCTTGCCATCACCAACCTTAAGGACTTGACCGACATGGA

[0153] GGGAGACAGTAAACACAACATTAGAACCTTGCCTACCATCTACGGACCAAGGAAAATCACCTT

[0154] TTTTTTTGTCGGTATGCTTCTTACCCATTACGTCGCTGCCGCCTTGGCCGGTATCCTTTTGCCAAA

[0155] GGTCTTCAACCCATACGTCATGGCCCCAGCTCACGCTATTTTGGGTTTGTTGTTGTTCTTGAAGA

[0156] CTAGAGAGTTGGACAAGGCCAACTATACCGTCGAGGCCAGTGAGACCTTCTACAAGTTCATCT

[0157] GGAAGATTTTGTTGCTTGAATTTGTTATCTTTCCATTCATCTAA

[0158] CtIDTsc

[0159] ATGGCTTTTAGTATTTCTCATTCTTCTCTTAGGTTGTCTCCTATCGCCCCACACCAGAGGTTCATT

[0160] AGAGCCTCTTCTCACGACAACAACTCTGTCTTGTCTATTAAAAACAAAATTAAATCTCCAAATTT

[0161] CCCTTCTAAATCTTCTACTGATAAATTGATTTTCCCAGTCGGTCTTTACGGAGAGAACCAGTTCT

[0162] CTAAATCTTTGTCTTACGGTAAGGATAGAAGGAACAACATCAGAGCCTCTTTCGAGGCCCAACC

[0163] AGCTGATTCTAAGACCACCCTTGCCAAGGTCTCTAGATTCGGTTCTACTTGTTACAAGTTCTTGA

[0164] GGCCATACGCCATGTCTCACACCGTTGCTTCTGCCATCGGTTTGTTCGCTAGAGTTCTTGTCGAC

[0165] AACCCACAGTTCTTGAAGTGGAGTGTCGTCTTGAAGGCCTTCCCCGGTTTGATCGCCATGATTC

[0166] TTGCCACTGCCTATTATATCGGTATCAATCAGATCTACGACGCCGACATCGATAGAGTTAACAAG

[0167] CCTTACCTTCCAATCCCTTCTGGTGAGTTGTCTTTGAAGCAAGCATGGTTCCTTGTCATCTCTGA

[0168] CTTGTTGGCCGGACTTCTTATCTTGAGGTTGATGAACGCCGACTTGATCACCACCTCTCTTTACT

[0169] GCGCCGGATTGTTCCTTGGAACCTTCTACTCTGCCCCTCCATTGAGATTCAAGGAGTCTTCTTTT

[0170] CAGACTAGTATCGTCAACCCATTGATGGCCGGAATCCTTCACAACATCGGTGTCTTGTACGCCTC

[0171] TACCGTTTCTTTGGGTCTTCCATTCAACTTGAGTTCTCCTCCAGTTGTTTTTATCGTTATTTTTATT

[0172] ACCTTGTATTTTATTGTTATCACTAACTTGAAAGATCTTACCGATATTGAAGGTGATATCAAACAT

[0173] AACATTAGGACCTTGCCAGCTATCTTCGGTCCTAGGAAGACCACCTTCTTCTTCGCCGGTATCTT

[0174] GCTTGCCACCTACGTCGGATCTATGGCCGCTGGTATTTGCATGCCACAAGCCTTCAGACCATACG

[0175] TCATGGTTCCAGCTCACGCCATTCTTGGTGCCTTGACCTTCTTTAAAGTTAGAAAATTGGACAA

[0176] GGCTAACTACTCTATGGAGGAGTCTGCCGACTTCTACCAGTTCTTGTGGAAGATCTTGTGTTTG

[0177] GAATTTGTTATTTTTCCATTCATTTAA

[0178] GuILDTsc

[0179] ATGGATTCTATGGTCATTGGAAGTTTTCCAAATATCTCTAGTATTACTACCGTTGGTAATTTGAGG

[0180] CAAGGTAAGGACTGCACCAAGAACTACTACGCCACCGGATACTACACCCCAAAGGCCAGTCTT

[0181] CACAAGAGGAAAATTCAGAAGGAATATAACTTTTTGAGAGTTCAACAACCATCTCTTAAGCACT

[0182] TGTACAAGGGTATCGAGGGTGGTCACACCTACCAAGAGTGCAATAGAAAGTACGTCGTCAAGG

[0183] CCACCCCAAAAAGTTCTTTCGAATATGATCCTAGGTCTAGTGATAGGAAAAACATTTTGGCTTCT

[0184] TTCAAGAATTTCTTGGATGCTTTTTACATGTTTTGTACCCCATATTCTTTTATCGGTGCCATGTTGA

[0185] ACATCATCAGTGCCAGTCTTGTCGCCGTCGAGAAGTTGAGTGACATCTCTCCTCTTTTTTTTATC

[0186] GGTGTCCTTCAAGCCCTTGTCCCTAATTTGTTCATGAGTATCTACGTTGCCGGTATCAACCAATT

[0187] GTGCGACGTCGAAATTGATAAGATTAATAAACCATACTTGCCATTGGCTAGTGGAAAAATCAGT

[0188] TTCACCACCGGAGTCTTCATTGTCGCTAGTTCTCTTATTTTGAGTCTTTGGTTGGGATGGATCATC

[0189] GGATCTTGGCCATCTATCTGGGCCTTGATCTCTTTCACCGTCATCTGGGCCGCCTACTCTATCAA

[0190] CGTCCCATTGTTGAGGTGGAAGAGAAACCCAGTCTTGAGTGCCATGATCTCTTTCGCCAGTTTC

[0191] GCCATTACCTTCCCTATCGGATATTTCTTTCATATGCAAACCTTTGTCTTCAAGAGGCCAGCCTTG

[0192] TTCACCAGACCACTTATTTTTGCTATCACTTTTATGTCTTTTTATAGTATCGTTTTTAGTTTGTTCA

[0193] AGGATATCCCAGACATCGAGGGTGACCAAGCCTTCGGAATCCAGAGTTTCAGTATGAGGCTTGG

[0194] TCAAAAAAGGGTTTTTTGGATTTGTATTCTCTTTTGGAGATGGCCTACGGTGTTGCCTTGTTGA

[0195] TGGGTATCACCTCTTCTTGCTTGTGGAGTAAGATCGTCACCGTCTTGGGTCACGCTGTCCTTGCC

[0196] TCTATCGTTTGGTATAGAGCTAAGACCATCGACCTTAGGAACAAGGCTTCTATCGCTAGTTTTTA

[0197] CATTTTGATTTGGAAGTTGTTGTATGTTGAATATTTCTTGATTCCTCTTGTTAGATAA

[0198] SfFPTSc

[0199] ATGGGATCTATGTTGCTTGCCTCTTTCCCCGGTGCTTCTAGTATCACCACCGGAGGAAGTTGCAT

[0200] GAGATCTAAGCAGTATGCCAAGAACTACAACGCCTCTTCTTACGTCACCACCCTTTGGCACAAG

[0201] AAGGGTAAGATCCAAAAGGAGCACTGCGCCGTCATCTTCAGTAAGCATAATTTGAAACAGCAC

[0202] TACAAGGTTAACGAGGGAGGTTCTACCAGTAAGAAGAGAGAAAAAAATATACTGTTAATGCC

[0203] ATTAGTGAGGAGAGTTTCGAGTACGAGCCACAAGTTAGAGACCCAGAATCTATCTGGGTAGT

[0204] GTCAACGACGCTTTGGATACCTTCTATAAATTCTGCAGACCATACGCCATGTTCAGTATCGTCTT

[0205] GGGTGCCACTTTCAAGTCTTTCGTCGCCGTTGAGAAATTGTCTGATCTTTCTTTGACCTTCTTCA

[0206] TTGGATGGTTGCAAGTTGTCGTCGCCGTTATTTGCATCCACATCTTCGGTGTCGGTTTGAACCAG

[0207] CTTTGCGATATCGAGATCGACAAAATTAACAAGCCAGATTTGCCTTTGGCTTCTGGTAAGTTGA

[0208] GTTTTAGAAATGTTGTTATCATCACCGCCAGTTCTTTGATCTTGGGACTTGGATTCGCTTGGATC

[0209] GTTGGTAGTTGGCCTTTGTTCTGGACCGTCTTGATCTGCTGCATGTTCACCGCTGCCTACAACGT

[0210] CGACTTGCCACTTTTGAGGTGGAAGAAATACCCAGTCCTTACCGCCATCAACTTCATCGCCGAT

[0211] GTCGCCGTCACTAGATCTTTGGGTTTCTTCTTGCACATGCAGACTTGTGTCTTCAAGAGACCAA

[0212] CCACCTTCCCAAGGCCATTGATCTTCTGCACCGCCATCGTCTCTATCTACGCCATCGTCATCGCC

[0213] CTTTTCAAGGACATCCCAGATATGGAGGGTGATGAGAAGTTCGGTATTCAATCTCTTTCTTTGAG

[0214] ATTGGGTCCAAAGAGGGTCTTCTGGATCTGCGTCAGTTTGCTTGAGATGGCCTACGGAGTCACC

[0215] ATCTTGGTCGGTGCCACTTCTCCTATCTTGTGGTCTAAAATCATTACCGTCCTTGGTCACGCCGT

[0216] CTTGGCTTCTGTTTTGTGGTACCACGCCAAGTCTGTTGACTTGACCAGTAACGTCGTCCTTCAG

[0217] TCTTTTTATATGTTCATCTGGAAGTTGCACACCGCCGACTACTTCTTGATCCCACTTTTCAGATAA

[0218] SfiLDTsc

[0219] ATGGGATTTGTCTTGCCAGCCAGTTTCCCTAGGTCTTCTTCTATCACCACCGGATCTTACGGTAC

[0220] CACCCTTTGGCACAAGTCTGAAAAAATTCAAGAAGAATACTGTGTTATGCTTAGTAGTAGTCAC

[0221] AATTTGAAACATAGGCATAAGGTCATCCATAGAGGAAGTAGTTGCCAAGAATGCGAAAGAAAG

[0222] TACGTTGTCAACGCCACCAGTGGTCAGCTTTTCGAATACGAGCCACAAGCTACCGATATCAAGT

[0223] CTAACTGGGACAGTATCAAAGATGCTCTTAATGTTTTCTATTCTTTCATGAGGCCATACTCTGCCA

[0224] TCGCTGCTGCCATGGGAGCTACCTCTGTCAGTCTTCTTGCCGTCGAGAAATTGTCTGACTTGTC

[0225] TCTTCCTTTCTTCATTGGTTGGTTGCAAGCTGTCGTCTTTAGTTTCATCGTCAATATTTTTAATTG

[0226] CGGTTTGAACGAGTTGTGCGACGTCGAGCTTGATAAGATCAACAAGCCTAATTTGCCATTGGTC

[0227] AGTGGTGAGCTTTCTTTAGAACCGGTGTCTTGATCGTCGCCAGTTCTCTTATCATGTCTTTTGG

[0228] ATTGACCTTGATCGTCGGTTCTTGGCCACTTTTCTGGTCTCAGTTTGCCAGTTCTTTGTTGGCCG

[0229] CTGCCTACTCTATCAACTTGCCTTTGTTGAGATGGAAAAAAGTACCCTATCCTTGCCGCCACCAGT

[0230] ATTTTGACCAACGTCGCCGTCCGCGTTCCTTTGGGATACTTCTTGCACATGCAGACCCCATGTCTT

[0231] CAAGAGGCCAGCACTTTCCCTAGGCCACTTAACTTCTGCATCGCTATTTTGTCTTTGTTCTTTG

[0232] TTGTTATTGCCCTTTTTAAGGACATCCCAGACATCGAGGGTGACAAGAAATTCGGAGTCCAGTC

[0233] TTTGGCCGTCAGATTGGGACAGAAGAGGGTCTTCTGGATTTGCATTTCTCTTTTGGAGATGGCC

[0234] TACGGTGTCACCATCCTTGTCGGTGCCACCTCTCCTTTCTTGTGGAGTAAGTCAGTACCGGTCT

[0235] TGGACACGCTGTCTTGGCCTCTATTGTCTGGAATAGAGCCAAGTCTGTCGATTTGAAGAATAAA

[0236] GATTCTTATAAGAGTTTTTACATGTTTATCTGGAAGTTGATCTGCGCCGAATACTGCTTGATTCCA

[0237] CTTTTTAGATAA

[0238] HlPT-1sc

[0239] ATGGAATTGTCTTCTGTCTCTTCTTTTTCTCTTGGTACTAATCCATTCATTAGTATTCCTCATAATA

[0240] ATAATAACTTGAAAGTCTCTAGTTATTGTTGTAAATCTAAATCTAGAGTTATTAATTCTACTAATTC

[0241] TAAGCATTGTAGTCCAAATAACAATAACAACACCTCTAACAAGACCACCCACCTTTTGGGTCTT

[0242] TACGGTCAGTCTAGGTGCCTTTTGAAGCCTTTGAGTTTCATCTCTTGTAATGATCAGAGGGGTAA

[0243] CTCTATTAGAGCCAGTGCCCAGATTGAAGATAGACCTCCAGAAAGTGGTAACTTGAGTGCCCTT

[0244] ACCAACGTCAAGGACTTCGTCTCTGTCTGCTGGGAGTATGTTAGACCATACACTGCCAAGGGTG

[0245] TTATCATCTGCAGTAGTTGCTTGTTCGGTAGGGAGTTGCTTGAGAATCCTAATTTGTTTTCTAGA

[0246] CCATTGATCTTTAGAGCCTTGCTTGGAATGTTGGCCATCTTGGGATCTTGCTTCTACACCGCCGG

[0247] TATCAACCAGATCTTTGACATGGATATTGACAGAATTAATAAGCCAGACTTGCCATTGGTCTCTG

[0248] GTAGGATCTCTGTCGAGTCTGCTTGGTTGCTTACCTTGTCTCCAGCTATCATCGGATTCATCTTGA

[0249] TTTTGAAATTGAACTCTGGACCTTTGTTGACCAGTCTTTACTGCCTTGCCATCTTGTCTGGTACC

[0250] ATCTACAGTGTCCCACCATTTAGATGGAAGAAAAACCCAATTACTGCTTTCTTGTGCATTCTTAT

[0251] GATCCATGCTGGTTTGAACTTCAGTGTCTACTATGCCTCTAGGGCTGCTTTGGGTCTTGCCTTCG

[0252] CTTGGTCTCCATCTTTCTCTTTCATTACCGCCTTCATCACCTTCATGACCTTGACCTTGGCCTCTA

[0253] GTAAAGATTTGAGTGACATCAATGGTGATAGGAAGTTTGGTGTTGAGACCTTCGCCACCAAATT

[0254] GGGAGCCAAGAACATCACCTTGTTGGGAACCGGTCTTTTGCTTTTGAACTACGTCGCCGCCATC

[0255] AGTACCGCCATCATCTGGCCAAAGGCCTTTAAAAGTAACATCATGTTGCTTTCTCACGCCATCTT

[0256] GGCCTTCTCTTTGATCTTCCAAGCTAGAGAGCTTGACAGAACCAACTACACCCCAGAGGCTTGT

[0257] AAGAGTTTCTACGAATTCATCTGGATTCTTTTCTCTGCTGAATATGTTGTTTATTTGTTCATTTAA

[0258] LaPT1sc

[0259] ATGTCTGCTATGTTGGCCTCTTGCTTCACCATCCCATCTAGTATCAAGGCCGGTGGAAACAGACC

[0260] TAGGAGTAAGCAATGCGGTAAGACCTACTACGCCTCTAGTAACGTCCCTACCTTGTGGCACAAG

[0261] ACCGAGAAGATCCAGAAAGAGCACTGCGCTATGATGTCTTCTAACAGTTTGCAACATAGATGCA

[0262] AAGTCATCGAGGATGGATTTAAATACCAGCAATGGAAAAGAAAATGTACTATTAATGCCATTTCT

[0263] GAGCAGAGTTTCGAACCAGAATCTCAAGCTCAATACAAGAAGTCTATGAAAGACAGTGTCAAG

[0264] GACGGTCTTGTCGCCTTCTACGAATTCACTAGACCATACTCTGCCATCCCAATCATTCTTGAGGC

[0265] CACTTGTATGTCTTTGCTTGCTGTCGAGAAGTCTAGTGACTTGAGTTTGATCTTCTTCAAGGGAT

[0266] GGGTCCAGACCGTTGTCGCCACCCTTCTTATGATCATCGTTAATTGTGGATTGAATCAATTGTGT

[0267] GATTTGGAAATTGATAAGATCAACAAACCACACTTGCCATTGACCTCTGGTGCCCTTTCTATCAA

[0268] GGCCGCTATCGCTATTGTTGCCGCTAGTGCCTTCTTGGGTCTTTGGTTCTCTTGGTCTTCTGGTTC

[0269] TTGGCCATTGTTCTGGAACGTCCTTTACAACAACGTCCTTGCCGTCTTCTACTCTGTCGACCTTC

[0270] CATTGTTGAGGTGGAAGAAATCTAGTTTTCTTACTGCCGTCTACATCTTGACCAACATCGGTGTC

[0271] GTCATCCCTATTGGATCTTTCTTGCACATGCAGACCCCACGTCTTCAAGAGAGCCGCTACCTTGCC

[0272] AAGGTCTATGCTTTTGTCTACCACCGTCTTGAGTATCTTTTGTATTGTTATTTCTATGATCAAAGA

[0273] CATCCCAGATATGGAGGGAGACGAAAAGTTCGGAATTAAATCTTTTGCCTTGTCTTTGGGTCAA

[0274] AAAGAGTCTTCAGTATTTGTATCTCTTTGCTTCAGATGAGTTACGGAGTCGGTATCCTTGTCGG

[0275] AGCCACCTCTCCTTACTTGTGGAGTAAGATCTTCACTGTCGTCGGTCATGCCACCCTTGCCTTGG

[0276] TCCTTCAATATAGAGCTAAGAGTGTCGACCCTAAGAGTAAGGACTCTGTCCAAAGTTTTTACAT

[0277] GTTCATTTGGAAAAATTGTTCATTGCTGAATGTTTGCTTTTGCCATTGTTTAGATCTTAA

[0278] CsPT3sc

[0279] ATGGTTTTTAGTTCTGTTTGTAGTTTCCCAAGTTCTCTTGGTACTAATTTCAAATTGGTTCCTAGA

[0280] TTCTAATTTTAAGGCTTCTTCTTCTCACTACCATGAAATCAATAATTTCATTAATAATAAACCAATTA

[0281] AGTTTAGTTATTTTAGTTCTAGATTGTATTGCTCTGCCAAGCCTATTGTCCATAGAGAAAACAAAT

[0282] TTACCAAATCTTTCAGTCTTTCTCATTTGCAAAGGAAGAGTAGTATCAAGGCCCACGGTGAGAT

[0283] CGAGGCTGATGGTTCTAACGGTACCTCTGAATTTAACGTCATGAAGTCTGGTAATGCCATCTGG

[0284] AGGTCGTTAGACCATACGCCGCCAAGGGAGTTTTGTTCAACTCTGCCGCCATGTTCGCCAAGG

[0285] AATTGGTTGGTAACCTTAATCTTTTCTCTTGGCCATTGATGTTTAAAAATTCTTTCTTTCACCTTGG

[0286] TTATTTTGTGTATTTTCGGTTTCTACTTCTGGTATTAATCAGATTTATGATTTGGATATCGATAGACTT

[0287] AATAAGCCAAACTTGCCAGTCGCCTCTGGTGAGATCTCTGTCGAGCTTGCTTGGTTGTTGACCA

[0288] TCGTCTGCACCATCAGTGGTTTGACCCTTACTATTATCACTAATTCTGGACCATTCTTTCCATTTT

[0289] TGTACTCTGCTAGTATCTTTTTCGGTTTCTTGTATTCTGCCCCTCCTTTTTAGATGGAAGAAGAACC

[0290] CATTCACCCGCTTGCTTCTGCAACGTCATGCTTTACGTCGGAACCTCTGTCGGAGTCTACTACGCT

[0291] TGCAAAGCCTCTCTTGGTCTTCCAGCCAACTGGAGTCCAGCTTTCTGCTTGCTTTTCTGGTTCAT

[0292] CTCTCTTTTGTCTATTCCTATTTCTATCGCCAAAGATTTGAGTGATATCGAGGGTGACAGAAAGT

[0293] TCGGTATCATTACCTTCAGTACCAAGTTCGGTGCCAAGCCAATCGCCTACATCTGCCACGGTCTT

[0294] ATGCTTCTTAACTACGTCTCTGTCATGGCCGCTGCCATTATCTGGCCTCAATTTTTCAACTCTTCT

[0295] GTCATCTTGTTGTCTCATGCCTTCATGGCCATCTGGGTCTTGTATCAAGCATGGATCTTGGAAAA

[0296] ATCTAATTATGCTACTGAAACTTGCCAAAAATACTATATCTTTTTGTGGATTATTTTTAGTCTTGAA

[0297] CATGCTTTTTACCTTTCATGTAA

[0298] CsPT4sc

[0299] ATGGGATTGTCTTTGGTTTGTACTTTTTCTTTTCAAACCAATTATCATACCCTTTTGAATCCACAC

[0300] AACAAAAATCCAAAAAATTCTCTTTTGAGTTATCAACATCCAAAAACTCCAATTATTAAAAGTT

[0301] CTTATGATAATTTCCCATCTAAATACTGTCTTACTAAAAATTTCCATTTGTTGGGTCTTAATAGTCA

[0302] TAATAGAATCTCTTCTCAGTCTAGGAGTATTAGAGCCGGTTCTGACCAAATCGAGGGATCTCCAC

[0303] ACCACGAGTCTGACAACAGTATCGCCACCAAGATCTTGAACTTCGGTCACACTTGTTGGAAATT

[0304] GCAGAGGCCATACGTCGTCAAGGGTATGATCTCTATTGCTTGTGGTCTTTTTCGGTAGGGAGCTTT

[0305] TCAACAATAGACACTTGTTCTCTTGGGGTCTTATGTGGAAGGCCTTCTTCGCCCTTGTCCCAATC

[0306] CTTTCTTTCAATTTTTTTGCTGCTATTATGAATCAAATTTATGACGTCGACATCGATAGGATCAAC

[0307] AAGCCAGACTTGCCTCTTGTCTCTGGAGAGATGTCTATCGAGACCGCTTGGATCTTGAGTATCAT

[0308] CGTCGCCCTTACCGGTTTGATTGTTACCATCAAATTGAAAAGTGCTCCTCTTTTTGTTTTTATTTA

[0309] CATCTTCGGAATCTTTGCCGGTTTCGCCTACTCTGTCCCACCTATCAGATGGAAGCAGTACCCAT

[0310] TCACTAATTTTTTGATCACCATTAGTTCTCACGTCGGACTTGCCTTCACCTCTTACTCTGCCACTA

[0311] CCTCTGCCTTGGGTTTGCCATTCGTCTGGAGACCAGCCTTTTCTTTCATCATCGCCTTCATGACC

[0312] GTCATGGGAATGACCATCGCCTTCGCCAAAGACATCTCTGACATCGAGGGTGATGCCAAGTACG

[0313] GTGTTTCTACCGTCGCCACCAAGTTGGGTGCTAGGAACATGACCTTCGTCGTCTCTGGAGTCCT

[0314] TCTTTTGAATTACCTTGTCTCTATCTCTATCGGAATCATCTGGCCACAAGTTTTCAAATCTAATATT

[0315] ATGATCCTTTCTCATGCCATCTTGGCCTTTTGTTTGATCTTCCAGACTAGAGAGTTGGCCTTGGC

[0316] CAACTACGCCAGTGCCCCATCTAGACAATTCTTCGAATTCATTTGGCTTCTTTATTATGCCGAATA

[0317] TTTTGTTTATGTCTTTATTTAA

[0318] NphBsc

[0319] ATGAGTGAAGCTGCTGACGTCGAAAGAGTCTATGCCGCCATGGAAGAAGCTGCCGGTTTGTTG

[0320] GGTGTCGCTTGCGCTAGAGACAAAATCTACCCATTGCTTTCTACCTTCCAAGATACCCTTGTCGA

[0321] GGGAGGTAGTGTCGTTGTCTTCTCTATGGCCTCTGGTAGGCACTCTACCGAGCTTGACTTCTCTA

[0322] TCTCTGTCCCAACCAGTCACGGTGACCCTTATGCCACCGTTGTCGAGAAGGGTTTGTTCCCAGC

[0323] TACCGGACATCCAGTTGATGACCTTTTGGCCGACACCCAGAAGCACCTTCCAGTCTCTATGTTC

[0324] GCCATTGACGGTGAGGTCACCGGTGGTTTCAAGAAGACTTACGCCTTCTTCCCTACCGACAACA

[0325] TGCCCGGTGTTGCCGAGTTGTCTGCCATCCCTTCTATGCCACCAGCCGTTGCTGAGAATGCTGA

[0326] GTTGTTCGCTAGATACGGACTTGATAAGGTCCAAATGACTTCTATGGATTATAAAAAAAGACAA

[0327] GTCAATTTGTACTTCTCTGAGCTTAGTGCCCAGACCTTGGAAGCTGAGTCTGTCTTGGCTTTGG

[0328] TCAGAGAGTTGGGTCTTCACGTCCCTAACGAACTTGGTTTGAAATTTTGTAAAAGATCTTTCTC

[0329] TGCTTATCCAACCTTGAACTGGGAGACCGGAAAGATCGATAGATTGTGCTTCGCCGTCATCTCT

[0330] AACGACCCAACCTTGGTCCCTAGTTCTGACGAGGGTGACATCGAGAAGTTCCCACAACTACGCC

[0331] ACCAAGGCCCCATACGCCTATGTCGGAGAGAAGAGGACCCTTGTCTACGGACTTACCCTTTCTC

[0332] CAAAAGAAGAATACTATAAGTTGGGTGCCTACTATCACATCACCGACGTCCAGAGGGGTCTTCT

[0333] TAAAGCCTTCGACAGTCTTGAAGATTAA

[0334] PcM4DTsc

[0335] ATGGACTGGGGTCTTGCCATCAGTTCTAGTTCTAAGGCCTACTCTGTTACCACCGGTGCCAACTT

[0336] GTGGAGGTCTAAACATGTTACTAACAATATCCATCACCCTTCTAGTTGCATCACCAAGGCCTCTC

[0337] AGCACAAAAGAAGACCCAGATCGAATACAATGTCTTGAGGTTCCAGAGGCCATCTCTTGGAC

[0338] ACGGTTACACTTCTCTGGAGGTGGTGGTTCTACCTACCAAGAATGCAATAGAAAGTACGCTGT

[0339] CAAGGCCGTCTACGACCAGCCAAAGGATTTCGAGCTTGAGGCCAGTAACCCAAAGAACATCTT

[0340] GGATTCTGCCAAAAAATTTTTGGCTGCTTTTTATTATTTTTCTTATCCTTACACCATGATTGGAATC

[0341] ACCTTGTGCGCCTTCTGCTCTTCTGCTTTGGCCGTCGAGAAGTTGTCTGACATCAGTCTTCCTTT

[0342] CTTCATTGGAGTCTTGCAAGCTGTCATCCCTCAGTTGTTTATTGAAATCTATTTGTCTGGTGTTAA

[0343] TCAATTGTACGATTTGGAGATCGATAAAATTAACAAGCCACACCTTCCAATGGCCAGTGGACAG

[0344] TTCTCTTTCAAGACCGGTGTCATTATGAGTGCCGCCTTCTTGGCCTTGAGTTTCGGATTCACTTG

[0345] GCTTACCGGTTCTTGGCCACTTATCTGGAACCTTGTCGTCATCGCCAGTAGTTGGACCGCTTACA

[0346] GTATCGACGTCCCATTCATGAGGTGGAAGAGGTACCCATTGGTCGCTGCTATGTGCATGATTGCC

[0347] ACTTGGGGTTTGGCCTTGCCAATCAGTTTCTTCCACCACATGCAGACCTTCGTCTTGCAGAGGC

[0348] CAATTGGTTTCCCAAGGAGTCTTGGTTTCTTGGTCGCCTTCATGACCTTCTATTCTATGGGTATCG

[0349] CCCTTTCTAAGGACATCCCAGACGTCGAGGGAGATAAGGAGCACGGAATCAACTCTTTTAGTGT

[0350] CCTTTTGGGTCAAAAAAGAATTTTCTGGATCTGCGTTTCTTTGTTCGAGATGGCTTTCGGAGTC

[0351] GGACTTCTTGGTGGTGTCACCTCTCCACACTTCTGGACCAAGATCATCACCGGACTTGGAAACG

[0352] TCATCTTGGGATCTATCTTGTGGTACCAAGCTAAATCTTTCGATTTGACCGACAAGGCCAGTACC

[0353] GGTAGTTTCTATATGTACATCTGGAAGTTGTTGTACGCCGCCCTTCTTCTTATGGCCTTCGTTAGA

[0354] TAA

[0355] AhR4DTsc

[0356] ATGGCCTTCGGACACTTGGTCCTTATTCCAAGGTCTACCTCTTCTATCGCCACCACTGCCGCCTC

[0357] TTGCTGGAAGTCTAAGAAGTTCGCCGACAACTACTACGCCAACTCTTACGGTAGGAGGGCCCT

[0358] TTGGCAGTCTGATAGAAACTTGACCAAGGACCACTCTATTAAAACCAGTTTGCAACATAATATTT

[0359] CTAAGTTGCACTACAACCCTATCGAGAGGGGAAGTAGGTGTAACAAGATCGAGAAAACCTATC

[0360] TTACCAACGCCTCTAGTTCTGCCCAGAGTCACGAAAGTGAACCAGAAGTCCACGAGAGTCCAA

[0361] AGGCTCTTGAATCTATTAAAAAGGGATTGGTTATGTTCCTTCAATTCTGTAGATTGTACGCCTTCT

[0362] TGGGAATGATCCCAGCTGGATTGAGTAGTTCTCTTCTTGCCGTTGATAATTTTTCTGAAATTTCTC

[0363] CATTGTTGTTCTTGAAGGGTGTTCTTCAATATATTGTCACCTTCTTTTTTACCAGTCAATTCGTCA

[0364] TGGGTGTCAACCAGCTTAGTGACGTCGAGATCGATAAAATTAACAAACCAGACTTGCCTCTTGC

[0365] CTCTGGTGAGTACAGTTTCACTTCTGGTGTCATCTTGGTCACCTCTTTCCTTCTTGCCGGATTCG

[0366] GTGTTGCTTGGATGTTGGGTTCTCAGCCATTGATCTGGAGTGTCGTCGTCACCGCCGCTTTGATG

[0367] GGAGCCTACAGTGTCAACTTCCCTTTGTTGAGATGGAAAAGAAGTATCATCCTTACCAGTCTTT

[0368] CTAACGCCATCGCCATGCTTGCCTCTTTCCACATCGGACCTTTCCTT

[0369] CATATGAAAACCTTCGTCTTGAAAAAGGCTGCCACCTTCCCAAGGTCTATGATCTTGGGTTGCG

[0370] TCGTCATCGGACTTTTCTATACCATCATCACCCTTACCAAGGACCTTGGTGACGTCGAGGGTGA

[0371] CAAGGCCGCTGGATTGAAGACCTTGCCAATTAGATTGGGTGTCAAGCCAGTCTTCTGGTTGTGC

[0372] GTCTCTTTGATCCAGATGGCCTACGGAATCGCCATCACCATGGGTGCCCTTTCTCCAGTTTTGTG

[0373] GTCTAAGATTGTTACCGTTGTCGCCCACGCCTTCATGGTCTTCTATGTCTGGAACCACGCCTTGA

[0374] ACTCTGTCGACTTGTCTTCTAAAGATAGTCTTCATAGTTTCCATTTGTTCATGTTCAAATTGGTTA

[0375] CCGTCGAAGGAATTCTTATTCAATTCGTCAGATAA

[0376] Some site targeting sequences involved in the embodiments of this application

[0377]

[0378]

[0379]

[0380]

[0381]

[0382]

Claims

1. A method for constructing an engineered bacterium that produces xanthohumol, characterized in that: By regulating the enzymes synthesizing the xanthohumol metabolic pathway in the host strain, an engineered bacterium with increased content of its synthetic precursor demethylxanthohumol is obtained, and then the methyltransferase of the engineered bacterium is optimized to obtain an engineered bacterium producing xanthohumol; wherein the host strain is selected from any brewer's yeast carrying the xanthohumol pathway.

2. The method for constructing an engineered bacterium producing xanthohumol according to claim 1, characterized in that: The method of regulating the enzyme synthesizing the xanthohumol metabolic pathway in the host strain is to optimize the precursor demethylxanthohumol metabolic pathway and then further regulate the substrate pathway, or to optimize the precursor demethylxanthohumol metabolic pathway and then further enhance the transferase that optimizes the synthetic precursor.

3. The method for constructing an engineered bacterium producing xanthohumol according to claim 1 or 2, characterized in that: The optimized precursor demethylxanthohumol metabolic pathway is at least one of a 1-amino acid pathway metabolic pathway, a 2-malonyl coenzyme A pathway metabolic pathway, and a 3-mevalonic acid (MVA) biosynthetic pathway.

4. The method for constructing an engineered bacterium producing xanthohumol according to claim 3, characterized in that: The amino acid pathway is (a) knocking out the gene encoding the phenylpyruvate decarboxylase gene (ARO10) of the host strain; (b) ARO4 containing mutant DAHP synthase gene K229L and chorismate mutase gene ARO7 G141S The expression cassette is introduced into the host strain; The malonyl-CoA pathway is to replace the promoter of the ACC1 gene in the host strain with P TEF1 ; The synthesis pathway of MVA is as follows: (a) introducing an expression cassette containing a truncated hydroxy-3-methylglutaryl coenzyme A reductase gene tHMG1 and an isopentenyl pyrophosphate isomerase gene IDI1 into a host strain; (b) Mutate the ERG20 gene in the host strain genome to ERG20 N127W Gene.

5. The method for constructing an engineered bacterium producing xanthohumol according to claim 3, characterized in that: The transferase for enhancing and optimizing the synthesis of precursors is to transfer the isopentenyl transferase into the engineered bacteria with optimized precursor demethylxanthohumol metabolic pathway; wherein the isopentenyl transferase is HlPT1L and HlPT-1 from Humulus lupulus, the gene MaIDT from Morus alba, the gene CtIDT from Cudraniatricuspidata, the gene GuiLDT from Glycyrrhiza uralensis, the genes SfFPT and SfiLDT from Sophora flavescens, the gene LaPT1 from Lupinus albus, the genes CsPT3 and CsPT4 from Cannabis sativa, the gene NphB from Streptomyces sp.CL190, the gene AhR4DT-1 from Arachis hypogaea or the gene PcM4DT from Psoralea corylifolia.

6. The method for constructing an engineered bacterium producing xanthohumol according to claim 3, characterized in that: The substrate pathway regulation is to optimize substrate supply and substrate transport channels, including (1) to (7): (1) ERG20 in the engineered bacteria with optimized precursor demethyl xanthohumol metabolic pathway N127W The promoter of the gene was replaced by P HXT1 ; (2) The ERG20 in the strain obtained above was N127W The promoter of the gene was replaced by P ERG1 ; (3) HMG2 K6R gene and ERG10 gene expression cassette were introduced into the above strains; (4) Containing 2 copies of HMG2 K6R The DNA fragment of the gene expression cassette is introduced into the above strain; (5) introducing the CHS_H1 gene and H1CHIL2 gene expression cassettes into the above strains; (6) The CHS_H1 gene, HlCHIL2 gene expression cassette and a gene containing two copies of HlPT1L Δ1-86 The DNA fragment of the gene expression cassette is introduced into the above strain; (7) The CHS_H1 gene, HlCHIL2 gene expression cassette and a gene containing two copies of IDI1-HlPT1L Δ1-86 The DNA fragment fused with the gene expression cassette was introduced into the above strain.

7. The method for constructing an engineered bacterium producing xanthohumol according to claim 1, characterized in that: The host strain is a xanthohumol pathway exogenous gene expression cassette introduced into any one of the cerevisiae yeasts; wherein the xanthohumol pathway exogenous gene expression cassette is (I) introducing the HlCCL1 gene and the FjTAL gene expression cassette into the host strain; (II) introducing the CHS_H1 gene and HlCHIL2 gene expression cassettes into the host strain; (III) Introducing the H1PT1L gene and H1OMT1 gene expression cassettes into the host strain; one or more of the host strains.

8. The method for constructing an engineered bacterium producing xanthohumol according to claim 1, characterized in that: The optimized methyltransferase comprises at least one of (i) and (ii): (i) introducing a DNA fragment containing two copies of the H10MT1 gene expression cassette into an engineered strain that increases the content of its synthetic precursor, demethylxanthohumol; (ii) Introducing a DNA fragment containing two copies of the H10MT1sc gene expression cassette into an engineered bacterial strain that increases the content of its synthetic precursor, demethylxanthohumol.

9. The engineered bacteria constructed according to the construction method according to any one of claims 1 to 8.

10. The use of the engineered bacteria according to claim 9, characterized in that: The application of the engineered bacteria in the preparation of xanthohumol.

Images