Cell line with stable and low expression of ADGRV1 as well as construction method and application of cell line

Abstract

The invention discloses a stable and low-expression ADGRV1 cell line as well as a construction method and application thereof. The method comprises the following steps: constructing a retroviral vector containing a simian virus 40 large T antigen gene sequence, carrying out virus packaging on the retroviral vector, a packaging plasmid, a transfer plasmid and a membrane protein expression plasmid, transfecting to separated primary fibroblasts, and carrying out expanding culture to obtain the stable low-expression ADGRV1 immortalized cell line. The immortalized cell line disclosed by the invention can be used for researching the change of related protein expression quantity caused by low-expression ADGRV1, so that a strategy for effectively treating fibrinopathy such as retinitis pigmentosa can be obtained, and compared with animal experiments, the immortalized cell line disclosed by the invention can effectively shorten the experimental period and remarkably save the experimental cost.

Description

Technical Field

[0001] The invention belongs to the field of cell biology, and particularly relates to a cell line stably low-expressing ADGRV1 and a construction method and application thereof. Background Art

[0002] Usher syndrome (USH) is the most common inherited retinal ciliopathy, manifested as blindness and deafness. Pathologically, the retinal and cochlear cilia undergo progressive degeneration, requiring lifelong support services, which imposes a huge burden on the patient's family and society. Type 2 USH (USH2) is the most common subtype. Although great progress has been made in clinical gene identification and phenotypic research, there is a lack of clear understanding of its pathogenic mechanism, and treatment still faces challenges. Therefore, revealing the pathogenesis of USH2 and exploring the signal transduction pathways by which gene mutations regulate retinal ciliogenesis are cutting-edge issues in the field of inherited eye and ear diseases. ADGRV1 pathogenic variants can cause USH2, which encodes a G protein-coupled receptor (GPCR) protein. The specific molecular mechanism of regulating ciliary development is unknown, and it is still an orphan receptor.

[0003] However, most animal models are currently used to study the pathogenesis of USH, which is long and inconvenient to operate. In addition, primary cultured cells have the disadvantages of relatively short life cycle, limited cell number, limited proliferation potential, and no reproducibility or homogeneity during pharmacological or toxicological tests.

[0004] Therefore, there is an urgent need to establish an immortalized cell line with stable low expression of ADGRV1 to deeply understand the biological function of ADGRV1 and the mechanism of retinal ciliogenesis, and to provide a research basis for the study of the mechanism of occurrence and development of USH2 and clinical drug guidance. Summary of the invention

[0005] In order to solve at least some of the technical problems in the above-mentioned prior art, the present invention constructs a retroviral vector containing the simian virus 40 large T antigen gene sequence, packages it with a packaging plasmid, a transfer plasmid and a membrane protein expression plasmid, transfects it into isolated primary fibroblasts, and expands the culture to obtain an immortalized cell line with stable low expression of ADGRV1. Specifically, the present invention includes the following contents.

[0006] The first aspect of the present invention provides a method for constructing an immortalized cell line that stably low-expresses ADGRV1, comprising the following steps:

[0007] (1) constructing a retroviral vector pMMLV[Exp]-SV40-T, wherein the vector has the sequence shown in SEQ ID No. 1;

[0008] (2) packaging the vector with a packaging plasmid, a transfer plasmid, and a membrane protein expression plasmid;

[0009] (3) isolating fibroblasts and performing primary culture, wherein the fibroblasts have the ADGRV1 gene mutation sequence shown in SEQ ID No. 2;

[0010] (4) transfecting the retrovirus containing the vector into the cells and continuing to culture;

[0011] (5) Selecting the transfected monoclonal cells, digesting them and then expanding them in culture medium to obtain a cell line with stable low expression of ADGRV1.

[0012] In certain embodiments, the method for constructing an immortalized cell line with stable low expression of ADGRV1 according to the present invention further comprises detecting the amount of ADGRV1 protein and comparing it with the amount of ADGRV1 protein in normal cells to determine the stable low expression of ADGRV1 in the cell line.

[0013] In certain embodiments, according to the method for constructing an immortalized cell line with stable low expression of ADGRV1 described in the present invention, the vector is co-transfected with a packaging plasmid, a transfer plasmid and a membrane protein expression plasmid into HEK293 cells, and the transfection is performed for 50-90 hours, and the supernatant is collected and purified.

[0014] In certain embodiments, according to the method for constructing an immortalized cell line with stable low expression of ADGRV1 of the present invention, in step (5), the culture medium used for expansion culture includes DMEM culture medium containing 10% fetal bovine serum and double antibody culture medium.

[0015] In certain embodiments, according to the method for constructing an immortalized cell line with stable low expression of ADGRV1 according to the present invention, the DMEM culture medium includes 4000-5000 mg / L of D-glucose, 3000-4500 mg / L of NaHCO3, 500-650 mg / L of L-glutamine, 50-200 mg / L of sodium pyruvate and 5-25 mg / L of phenol red.

[0016] The second aspect of the present invention provides an immortalized cell line with stable low expression of ADGRV1, which is obtained by the method described in the present invention.

[0017] The third aspect of the present invention provides an animal model with stable low expression of ADGRV1, which comprises the immortalized cell line with stable low expression of ADGRV1 according to the present invention.

[0018] In a fourth aspect, the present invention provides a method for screening drugs for treating Usher syndrome, comprising the step of contacting the drug to be tested with the immortalized cell line stably under-expressing ADGRV1 according to the present invention or the animal model according to the present invention.

[0019] In certain embodiments, the screening method according to the present invention comprises the following steps:

[0020] (1) quantifying the expression level of ADGRV1 or its gene in the immortalized cell line or the animal model of the present invention to obtain a first measurement value;

[0021] (2) contacting the test drug with the immortalized cell line or the animal model;

[0022] (3) quantifying the expression level of ADGRV1 or its gene in the immortalized cell line or the animal model after administration of the drug to obtain a second measurement value;

[0023] (4) comparing the first measurement value and the second measurement value;

[0024] (5) When the second measured value is greater than the first measured value, the drug to be tested is screened as a drug useful for treating Usher syndrome; when the second measured value is less than or equal to the first measured value, the drug to be tested is screened as a drug useless for treating Usher syndrome.

[0025] The fifth aspect of the present invention provides use of the immortalized cell line stably low-expressing ADGRV1 according to the present invention or the animal model according to the present invention in screening drugs for treating Usher syndrome.

[0026] The present invention constructs a retroviral vector (pMMLV[Exp]-SV40-T) by using Moloney murine leukemia retrovirus (MMLV) and simian virus 40 large T antigen (SV40 T antigen), and performs virus packaging on the retroviral vector, and then transfects primary fibroblasts that low-express ADGRV1 to deliver SV40 T, thereby constructing an immortalized cell line that stably low-expresses ADGRV1. The immortalized cell line of the present invention can be used to study the changes in the expression of related proteins caused by low expression of ADGRV1, and provides a convenient and stable platform for the development of drugs for ADGRV1-related targets, thereby obtaining a strategy for effectively treating ciliary diseases such as retinitis pigmentosa, and can effectively shorten the experimental cycle and significantly save experimental costs compared to animal experiments. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 The vector map of pMMLV[Exp]-SV40-T is shown.

[0028] Figure 2 Shown are the results of qPCR (A), Western blot (B), and immunofluorescence (C) of Adgrv1 gene expression in cells of different passages. DETAILED DESCRIPTION

[0029] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0030] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that the upper and lower limits of the scope and each intermediate value therebetween are specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0031] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which the invention belongs. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0032] Methods for constructing immortalized cell lines

[0033] In one aspect of the present invention, a method for constructing an immortalized cell line that stably and lowly expresses ADGRV1 is provided, which comprises steps (1) to (5), which are described in detail below.

[0034] In the present invention, "immortalized cell line" refers to cells that can grow in culture for more than 20 generations.

[0035] Step (1) of the construction method of the present invention is a step of constructing a retroviral vector pMMLV[Exp]-SV40-T. In a preferred embodiment, the vector has the sequence shown in SEQ ID No.1.

[0036] Step (2) of the construction method of the present invention is a step of viral packaging the vector, packaging plasmid, transfer plasmid and membrane protein expression plasmid. In a preferred embodiment, the vector, packaging plasmid, transfer plasmid and membrane protein expression plasmid are co-transfected into HEK293 cells, transfected for 50-90 hours, preferably 55-85 hours, and also preferably 60-80 hours, such as 60, 62, 64, 66, 68, 70, 72 hours, and the supernatant is collected and purified, wherein the purification method is not particularly limited and can be carried out by methods known in the art, such as purification by filtration.

[0037] Step (3) of the construction method of the present invention is to separate fibroblasts and perform primary culture. In a preferred embodiment, the fibroblasts have the ADGRV1 gene mutation sequence shown in SEQ ID No.2.

[0038] In the present invention, fibroblasts are derived from body parts or organs of mammals, including but not limited to humans, mice, pigs, cattle, sheep, etc., and body parts or organs include but are not limited to neurons, brain, retina, kidney, liver, heart, skin, muscle, embryo protection tissue, etc.

[0039] In the present invention, the method of isolating and primary culturing fibroblasts is not particularly limited, and the method can be performed by methods known in the art.

[0040] Step (4) of the construction method of the present invention is to transfect the retrovirus packaging the vector into the fibroblasts and continue culturing.

[0041] In order to obtain an immortalized cell line with stable low expression of ADGRV1, the conditions for viral transfection of primary cells are important. In a preferred embodiment, the degree of confluence of fibroblasts during transfection is 30%-50%, preferably 35%-45%, such as 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, the amount of virus solution used is 80-120 μl / c㎡, preferably 90-110 μl / c㎡, such as 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110 μl / c㎡, and the transfection time is 2-5d, such as 2, 3, 4, 5d.

[0042] Step (5) of the construction method of the present invention is to select the transfected monoclonal cells, digest them and then culture them in a culture medium to obtain a cell line that stably and low-expresses ADGRV1.

[0043] In order to obtain an immortalized cell line with stable low expression of ADGRV1, the transfected monoclonal cells need to be expanded under appropriate conditions. In a preferred embodiment, the culture medium used for the expansion culture includes a DMEM culture medium containing 10% fetal bovine serum and a double-antibody culture medium, wherein the DMEM culture medium includes 4000-5000 mg / L of D-glucose, preferably 4200-4800 mg / L, such as 4200, 4300, 4400, 4500, 4600, 4700, 4800 mg / L of D-glucose, 3000-4500 mg / L of NaHCO3, preferably 3200-4200 mg / L, such as 3200, 3300, 3400, 3500, 3600, 3700, 3800, 3900, 4000, 4100, 4200 mg / L of NaHCO3. CO3, 500-650mg / L of L-glutamine, preferably 520-620mg / L, for example 520, 530, 540, 550, 560, 570, 580, 590, 600, 610, 620mg / L of L-glutamine, 50-200mg / L of sodium pyruvate, preferably 70-180mg / L, for example 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180mg / L of sodium pyruvate, and 5-25mg / L of phenol red, preferably 10-20mg / L, for example 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20mg / L of phenol red.

[0044] In a preferred embodiment, the construction method of the present invention further comprises detecting the amount of ADGRV1 protein and comparing it with the amount of ADGRV1 protein in normal cells to determine the stable low expression of ADGRV1 in the cell line.

[0045] The present invention also provides an immortalized cell line stably low-expressing ADGRV1, which is obtained by the construction method of the present invention.

[0046] The present invention further provides an animal model with stable low expression of ADGRV1, which comprises the immortalized cell line with stable low expression of ADGRV1 described in the present invention.

[0047] Drug Screening Methods

[0048] One aspect of the present invention provides a method for screening drugs for treating Usher syndrome, comprising the step of contacting the drug to be tested with the immortalized cell line stably low-expressing ADGRV1 of the present invention or the animal model of the present invention.

[0049] In a preferred embodiment, the screening method of the present invention comprises the following steps:

[0050] (1) quantifying the expression level of ADGRV1 or its gene in the immortalized cell line or the animal model of the present invention to obtain a first measurement value;

[0051] (2) contacting the test drug with the immortalized cell line or the animal model;

[0052] (3) quantifying the expression level of ADGRV1 or its gene in the immortalized cell line or the animal model after administration of the drug to obtain a second measurement value;

[0053] (4) comparing the first measurement value and the second measurement value;

[0054] (5) When the second measured value is greater than the first measured value, the drug to be tested is screened as a drug useful for treating Usher syndrome; when the second measured value is less than or equal to the first measured value, the drug to be tested is screened as a drug useless for treating Usher syndrome.

[0055] application

[0056] One aspect of the present invention provides the use of the immortalized cell line stably low-expressing ADGRV1 or the animal model in screening drugs for treating Usher syndrome.

[0057] Example

[0058] The following is an exemplary method for constructing an immortalized cell line that stably low-expresses ADGRV1.

[0059] 1) Vector construction: construct a retroviral vector (pMMLV[Exp]-SV40-T) with an SV40-T sequence, wherein the sequence of SV40-T is shown in SEQ ID NO.1:

[0060] ATGGATAAAGTTTTAAACAGAGAGGAATCTTTGCAGCTAATGGACCTTCTAGGTCTTGAAAGGAGTGCCTGGGGGAATATTCCTCTGATGAGAAAGGCATATTTAAAAAAATGCAAGGAGTTTCATCCTGATAAAGGAGGAGATGAAGAAAAAATGAAGAAAATGAATACTCTGTACAAGAAAATGGAAGATGGAGTAAAATATGCTCATCAACCTGACTTTGGAGGCTTCTGGGATGCAACTGAGATTCCAACCTATGGAACTGATGAATGGGAGCAGTGGTGGAATGCCTTTAATGAGGAAAACCTGTTTTGCTCAGAAGAAATGCCATCTAGTGATGATGAGGCTACTGCTGACTCTCAACATTCTACTCCTCCAAAAAAGAAGAGAAAGGTAGAAGACCCCAAGGACTTTCCTTCAGAATTGCTAAGTTTTT TGAGTCATGCTGTGTTTAGTAATAGAACTCTTGCTTGCTTTGCTATTTACACCACAAAGGAAAAAGCTGCACTGCTATACAAGAAAATTATGGAAAAATATTCTGTAACCTTTATAAGTAGGCATAACAGTTATAATCATAACATACTGTTTTTTCTTACTCCACACAGGCATAGAGTGTCTGCTATTAATAACTATGCTCAAAAATTGTGTACCTTTAGCTTTTTAATTTGTAAAGGGGTTAATAAGGAATATTTGATGTATAGTGCCTTGACTAGAGATCCATTTTCTGTTATTGAGGAAAGTTTGCCAGGTGGGTTAAAGGAGCATGATTTTAATCCAGAAGAAGCAGAGGAAACTAAACAAGTGTCCTGGAAGCTTGTAACAGAGTATGCAATGGAAACAAAATGTGATGATGTGTTGTTATTGCTTGGGATG

[0061] TACTTGGAATTTCAGTACAGTTTTGAAATGTGTTTAAAATGTATTAAAA

[0062] AAGAACAGCCCAGCCACTATAAGTACCATGAAAAGCATTATGCAAATG

[0063] CTGCTATATTGCTGACAGCAAAAACCAAAAAACCATATGCCAACAGG

[0064] CTGTTGATACTGTTTTAGCTAAAAAGCGGGTTGATAGCCTACAATTAAC

[0065] TAGAGAACAAATGTTAACAAACAGATTTAATGATCTTTTGGATAGGATG

[0066] GATATAATGTTTGGTTCTACAGGCTCTGCTGACATAGAAGAATGGATGG

[0067] CTGGAGTTGCTTGGCTACACTGTTTGTTGCCCAAAATGGATTCAGTGGT

[0068] GTATGACTTTTTAAAATGCATGGTGTACAACATTCCTAAAAAAAGATAC

[0069] TGGCTGTTTAAAGGACCAATTGATAGTGGTAAAACTACATTAGCAGCTG

[0070] CTTTGCTTGAATTATGTGGGGGAAAGCTTTAAATGTTAATTTGCCCTT

[0071] GGACAGGCTGAACTTTGAGCTAGGAGTAGCTATTGACCAGTTTTTAGT

[0072] AGTTTTTGAGGATGTAAAGGGCACTGGAGGGGAGTCCAGAGATTTGCC

[0073] TTCAGGTCAGGGAATTAATAACCTGGACAATTTAAGGGATTTTGGAT

[0074] GGCAGTGTTAAGGTAAACTTAGAAAAGAAACACCTAAATAAAGAAC

[0075] TCAAATATTTCCCCCTGGATAGTCACCATGATGAGTACAGTGTGCCT

[0076] AAAACACTGCAGGCCAGATTTGTAAAACAAATATATTAGGCCCAAA

[0077] GATTATTAAAGCATTGCCTGGAACGCAGTGAGTTTTTGTTAGAAAAAGA

[0078] GAATAATTCAAAGTGGCATTGCTTTGCTTCTTATGTTAATTTGGTACAGA

[0079] CCTGTGGCTGAGTTTGCTCAAAGTATTCAGAGCAGAATTGTGGAGTGG

[0080] AAGAGATTGGACAAAAGTTTAGTTTGTCAGTGTATCAAAAAATG

[0081] AAGTTTAATGTGGCTATGGGAATTGGAGTTTGATTGGCTAAAGAAACA

[0082] GTGATGATGATGAGCCAGGAAAATGCTGATAAAAATGAAG

[0083] ATGGTGGGGAGAGAACATGGAAGACTCAGGGCATGAACAGGCATT

[0084] GATTCACAGTCCCAAGGCTCATTTCAGGCCCCTCAGTCCTCACAGTCT

[0085] GTTCATGATCATAATCAGCCATACCACATTTGTAGGGTTTTACTTGCTT

[0086] TAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAA(SEQ ID

[0087] NO.1)。

[0088] 2) Virus packaging: The extracted high-purity target plasmid, packaging plasmid, transfer plasmid and membrane protein expression plasmid were co-transfected into HEK293 cells, and the transfection efficiency was observed under a microscope. The virus-containing supernatant was collected 72 hours after transfection, filtered and purified, and stored at -80°C after titer determination.

[0089] 3) Primary culture of mouse skin fibroblasts: SPF-grade newborn mice with Adgrv1 gene mutation (deletion mutation at the 52nd nucleotide site of the 31st exon of the Adgrv1 gene) were taken from 0-3 days old, regardless of gender. After deep anesthesia, the whole body was wiped with 75% alcohol. The back skin was taken and soaked in 75% alcohol for 15 minutes, and then transferred to the clean bench. The skin tissue was fully minced in a sterile culture dish and digested with a 1:1 mixture of 0.2% collagenase I and 0.25% trypsin at 37°C for 15 minutes. The digestion was terminated with complete medium containing serum. After rinsing once with PBS, the precipitated tissue block was applied to a 25cm 2 At the bottom of the culture bottle, about 15-20 pieces of minced tissue were applied to each culture bottle, the bottle mouth was half loose, and placed in a carbon dioxide incubator for 30 minutes. After adding 10% FBS+DMEM+double antibody culture medium, the culture medium was changed every 3-4 days. The primary fibroblast Adgrv1 gene variant sequence gtttaactcagtga-ggtaaacgtg (SEQ ID No. 2).

[0090] 4) Subculture: After the cells have grown to cover the entire bottom of the bottle, remove the culture medium, add PBS, wash away the remaining culture medium, and then add 0.25% trypsin to digest. After terminating the digestion, gently blow and collect the digestion solution, centrifuge, and re-inoculate the precipitated cells at a ratio of 1:3.

[0091] 5) Retroviral transfection: One day before transfection (Day 0), a certain number of primary cells were inoculated into a new culture dish (the cell confluency should be 30%-50% during transfection), and placed in a carbon dioxide incubator at 37°C and 5% CO2 for 18-20 hours. On the day of transfection (Day 1), the previously purified virus solution was thawed on ice, and an appropriate amount of virus solution was added to the antibody-free and blood-free DMEM culture medium at a dosage of 100μl / cm2. On the second day, the medium containing the virus was aspirated, and fresh complete culture medium was added. The culture was placed in a carbon dioxide incubator at 37°C and 5% CO2 for overnight culture. On the third day and thereafter, the genes carried by the MMLV retroviral vector usually begin to express on the second day of transfection. In order to allow the gene products to continue to accumulate in the cells, the transfected cells should continue to be cultured.

[0092] 6) Monoclonal cells were selected, digested with trypsin, and after serum termination, they were expanded with 10% FBS + DMEM (4500 mg / L D-glucose, 3700 mg / L NaHCO3, 584 mg / L L-glutamine, 110 mg / L sodium pyruvate, 15 mg / L phenol red) + double-antibody culture medium until the 10 cm culture dish was full. 1 / 3 of the cells were frozen for storage, 1 / 3 of the cells were collected for further passaging and immunofluorescence detection, and 1 / 3 of the cell pellets were added with 1 ml Trizol and mixed evenly for RT-PCR detection.

[0093] 7) Cell line detection: The obtained cells were used to identify the expression of Adgrv1 gene by Q-PCR and Western blot. The expression of Adgrv1 gene mRNA and protein in non-immortalized cells (primary) and immortalized cells at the 3rd and 10th generations was significantly decreased compared with normal cells by Q-PCR and Western blot. The expression of Adgrv1 gene mRNA and protein levels in the three groups of cells was consistent ( Figure 2 A, B), immunofluorescence also showed that the ADGRV1 protein in the immortalized 3rd and 10th generation cells was significantly lower than that in normal cells, and immortalization did not change the low expression characteristics of the cell gene. Currently, the cells have been passaged for more than 20 generations. Therefore, this cell line is a stable cell line with low expression of ADGRV1 protein.

[0094] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the above embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the above embodiments, or replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for constructing an immortalized cell line with stable low expression of ADGRV1, characterized in that: The following steps are involved: (1) constructing a retroviral vector pMMLV[Exp]-SV40-T, wherein the vector has the sequence shown in SEQ ID No. 1; (2) performing viral packaging on the vector, packaging plasmid, transfer plasmid and membrane protein expression plasmid; (3) isolating fibroblasts and performing primary culture, wherein the fibroblasts have the ADGRV1 gene mutation sequence shown in SEQ ID No. 2; (4) transfecting the retrovirus containing the vector into the cells and continuing to culture; (5) Selecting monoclonal cells after transfection, digesting them and then expanding them in culture medium to obtain a cell line with stable low expression of ADGRV1.

2. The method for constructing an immortalized cell line stably expressing low levels of ADGRV1 according to claim 1, characterized in that: The method further includes detecting the amount of ADGRV1 protein and comparing it with the amount of ADGRV1 protein in normal cells to determine the stable low expression of ADGRV1 in the cell line.

3. The method for constructing an immortalized cell line stably expressing low levels of ADGRV1 according to claim 1, characterized in that: The vector, packaging plasmid, transfer plasmid and membrane protein expression plasmid were co-transfected into HEK293 cells for 50-90 hours, and the supernatant was collected for purification.

4. The method for constructing an immortalized cell line stably expressing low levels of ADGRV1 according to claim 1, characterized in that: In step (5), the culture medium used for the expansion culture includes DMEM culture medium containing 10% fetal bovine serum and double antibody culture medium.

5. The method for constructing an immortalized cell line stably expressing low levels of ADGRV1 according to claim 4, characterized in that: The DMEM culture medium includes 4000-5000 mg / L of D-glucose, 3000-4500 mg / L of NaHCO3, 500-650 mg / L of L-glutamine, 50-200 mg / L of sodium pyruvate and 5-25 mg / L of phenol red.

6. An immortalized cell line with stable low expression of ADGRV1, characterized in that: It is obtained according to the method according to any one of claims 1 to 5.

7. An animal model with stable low expression of ADGRV1, characterized in that: It comprises the immortalized cell line stably low-expressing ADGRV1 as claimed in claim 6.

8. A method for screening drugs for treating Usher syndrome, characterized in that: The method comprises the step of contacting the drug to be tested with the immortalized cell line stably low-expressing ADGRV1 as claimed in claim 6 or the animal model as claimed in claim 7 .

9. The screening method according to claim 8, characterized in that The following steps are involved: (1) quantifying the expression level of ADGRV1 or its gene in the immortalized cell line of claim 6 or the animal model of claim 7 to obtain a first measurement value; (2) contacting the test drug with the immortalized cell line or the animal model; (3) quantifying the expression level of ADGRV1 or its gene in the immortalized cell line or the animal model after administration of the drug to obtain a second measurement value; (4) comparing the first measurement value and the second measurement value; (5) When the second measured value is greater than the first measured value, the drug to be tested is screened as a drug useful for treating Usher syndrome; when the second measured value is less than or equal to the first measured value, the drug to be tested is screened as a drug useless for treating Usher syndrome.

10. Use of the immortalized cell line stably low-expressing ADGRV1 according to claim 6 or the animal model according to claim 7 in screening drugs for treating Usher syndrome.

Images