Monoclonal goat intramuscular precursor fat cell immortalized cell line, preparation method and application

Abstract

The invention discloses a monoclonal goat intramuscular precursor fat cell immortalized cell line as well as a preparation method and application thereof, and relates to the field of immortalized cells. The method comprises the following steps: acquiring precursor fat cells in primary goat muscle; the method comprises the following steps: infecting precursor adipocytes in primary goat muscle with a lentivirus carrying SV40-T, and adding puromycin to screen positive cells infected with the lentivirus carrying SV40-T; a limited dilution method is used, the screened positive cells are laid on a plate according to one cell per hole, and the monoclonal goat intramuscular precursor fat cell strain is obtained after culture; and carrying out amplification culture on the monoclonal goat intramuscular precursor fat cell strain to obtain the immortalized cell line of the monoclonal goat intramuscular precursor fat cell. According to the immortalized cell line obtained by the method, while the morphology and the function of the precursor fat cells in the goat muscle are ensured, the passage generation number of the cells is remarkably increased, and the cells do not need to be repeatedly sampled and separated, so that the same genetic background of the cells is ensured, and the cost and the workload are greatly saved.

Description

Technical Field

[0001] The invention relates to the technical field of immortalized cells, and in particular to a monoclonal goat intramuscular preadipocyte immortalized cell line, a preparation method and application thereof. Background Art

[0002] The China Statistical Yearbook shows that in the ten years from 2012 to 2022, China's mutton production has steadily increased from 4.045 million tons to 5.245 million tons. With the improvement of living standards and dietary structure, consumers' demand for mutton has increased, and higher requirements have been placed on the quality of mutton. Intramuscular fat (IMF), also known as marbled fat, is closely related to the tenderness, flavor and juiciness of goat meat, which are indicators that affect the quality of meat. The increase in intramuscular fat may be caused by an increase in the number of intramuscular fat cells or an increase in the volume of a single fat cell. By exploring the proliferation and differentiation process of intramuscular adipocytes and clarifying the regulatory mechanism of intramuscular fat deposition in goats, it is of great significance to improve the lipid metabolism network of goats and improve the quality of goat meat through molecular biology.

[0003] Adipose tissue is the place where animals store and supply energy, and plays an important role in maintaining energy homeostasis. At present, most animal fat-related research still relies on primary preadipocytes obtained by tissue separation and culture. Primary preadipocytes are directly isolated from living tissues, and their morphological structure and function are closer to their living state in vivo, so they can be used as models for lipid metabolism-related research. However, only a limited number of primary preadipocytes can be isolated from each tissue block, and primary intramuscular preadipocytes cannot be passed on indefinitely. Therefore, primary cells need to be repeatedly isolated from tissues during the research process, resulting in insurmountable shortcomings and deficiencies in the primary cell culture process. Specifically, (1) Long separation cycle and high separation cost: Each time goat intramuscular preadipocytes are isolated, newborn goats of 0-3 days old need to be slaughtered. It takes at least one week from collecting the longissimus dorsi muscle of the goat to isolating and obtaining usable goat intramuscular preadipocytes; (2) The genetic background of cells from different batches may be different: primary cells isolated from different batches are taken from different individuals, and their genetic background may be different, making it difficult to obtain stable and reproducible results. These shortcomings and deficiencies in the primary goat intramuscular preadipocyte culture system have, to a certain extent, hindered the progress of in-depth research on the effects of intramuscular fat on goat meat quality.

[0004] At present, the research on goat intramuscular fat still relies on primary goat intramuscular preadipocytes cultured in vitro. Primary intramuscular preadipocytes have shortcomings such as long separation cycle, high separation cost and difficulty in obtaining stable experimental results from different batches of cells. So far, immortalized goat intramuscular preadipocytes have not been established, which greatly restricts the research speed and depth of goat intramuscular fat deposition. Therefore, the establishment of a monoclonal immortalized cell line of goat intramuscular preadipocytes will help clarify the regulatory mechanism of goat intramuscular fat, promote animal genetic breeding for goat meat quality improvement, and promote the development and growth of the mutton sheep industry. Summary of the invention

[0005] The invention discloses a monoclonal goat intramuscular preadipocyte immortalized cell line, a preparation method and an application thereof, in order to solve the technical problems in the related art of culturing primary goat intramuscular preadipocytes, such as long separation cycle, high separation cost and difficulty in obtaining stable experimental results from different batches of cells.

[0006] In order to solve the above problems, the present invention adopts the following technical solutions: The first aspect of the present invention provides a method for preparing a monoclonal immortalized goat intramuscular preadipocyte cell line.

[0007] The method for preparing the monoclonal goat intramuscular preadipocyte immortalized cell line of the present invention comprises the following steps: Step S100: taking the longissimus dorsi muscle of goat, isolating and culturing to obtain primary goat intramuscular preadipocytes; Step S200: Infecting primary goat intramuscular preadipocytes with a lentivirus carrying SV40-T, and adding puromycin to screen out positive cells infected with the lentivirus carrying SV40-T. The sequence information of SV40-T is shown in Seq. 1; Step S300: using the limiting dilution method, the screened positive cells are plated at a rate of one cell per well, and after culture, a monoclonal goat intramuscular preadipocyte cell line is obtained; Step S400: selecting a monoclonal goat intramuscular preadipocyte cell line with a cell fusion density of 90% or more for expansion culture to obtain a monoclonal goat intramuscular preadipocyte immortalized cell line.

[0008] According to an optional embodiment, in step S200, the concentration of puromycin added is 0.5-1.5 μg / ml.

[0009] According to an optional embodiment, in step S200, the concentration of puromycin added is 0.5-1.0 μg / ml.

[0010] According to an optional embodiment, in step S200, the concentration of puromycin added is 1.0 μg / ml.

[0011] According to an optional embodiment, in step S200, when the lentivirus carrying SV40-T is added to the primary goat intramuscular preadipocytes, a transfer agent is also added to the primary goat intramuscular preadipocytes, and the transfer agent is polybrene, and the added concentration of polybrene is 10 μg / ml.

[0012] According to an optional embodiment, in step S100, the longissimus dorsi muscle of goat is taken and isolated and cultured to obtain primary goat intramuscular preadipocytes, comprising the following steps: Step S110: The longissimus dorsi muscle of goats was collected under sterile conditions, washed with PBS, and then cut into pieces; Step S120: adding 2 volumes of type II collagenase and digesting in a 37°C water bath for 1.5 h; Step S130: adding an equal volume of complete culture medium to terminate digestion, and filtering to remove undigested tissue; Step S140: sieving the filtrate, centrifuging and discarding the supernatant to collect the cells; Step S150: adding red blood cell lysis solution, standing and centrifuging, and discarding the supernatant; Step S160: adding complete culture medium for culturing to obtain primary goat intramuscular preadipocytes.

[0013] According to an optional embodiment, in step S200, primary goat intramuscular preadipocytes are infected with a lentivirus carrying SV40-T, and puromycin is added to screen out positive cells infected with the lentivirus carrying SV40-T, comprising the following steps: Primary goat intramuscular preadipocytes were plated, and when the cell fusion density reached 70-80%, lentivirus carrying SV40-T and 10 μg / ml of the transfer agent polybrene were added. 1.0 μg / ml of puromycin was added 48 hours after infection to screen out positive cells infected with lentivirus carrying SV40-T.

[0014] According to an optional embodiment, in step S300, when culturing the screened positive cells, the culture medium is replaced every 2 days.

[0015] The second aspect of the present invention provides a monoclonal goat intramuscular preadipocyte immortalized cell line obtained by the preparation method described in any one of the technical solutions of the present invention.

[0016] The third aspect of the present invention provides the use of the monoclonal goat intramuscular preadipocyte immortalized cell line described in any technical solution of the present invention in preparing a goat intramuscular preadipocyte model, wherein the model is used for studying the proliferation, differentiation, polymerization and / or regulation mechanism of goat intramuscular preadipocytes.

[0017] The technical solution adopted by the present invention can achieve the following beneficial effects: The method for preparing a monoclonal goat intramuscular preadipocyte immortalized cell line provided by the present invention can obtain a monoclonal goat intramuscular preadipocyte immortalized cell line. Compared with primary goat intramuscular preadipocytes, the monoclonal goat intramuscular preadipocyte immortalized cell line obtained by the present invention significantly increases the number of cell generations while ensuring the morphology and function of goat intramuscular preadipocytes, and does not require repeated sampling and separation of cells. Since the immortalized cell line is obtained from a monoclonal cell line, it is ensured that the cells have the same genetic background, the repeatability of the experiment is enhanced, and the cost and workload are greatly saved. It can be used as an ideal model for research on the proliferation, differentiation, polymerization and regulation mechanism of goat intramuscular preadipocytes.

[0018] That is, the monoclonal goat intramuscular preadipocyte immortalized cell line of the present invention solves the technical problems of long separation cycle, high separation cost and difficulty in obtaining stable experimental results from different batches of cells in the culture process of primary goat intramuscular preadipocytes in the related art. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0020] Figure 1 A schematic diagram showing the survival of cells after culture at different puromycin concentrations in the present application example is shown; Figure 2 A schematic diagram showing cell survival under different culture conditions in the embodiments of the present application is shown; Figure 3 The photos of the primary goat intramuscular preadipocytes and the monoclonal goat intramuscular preadipocyte immortalized cell line in the examples of the present application under an optical microscope are shown; Figure 4 The graphs showing the expression results of SV40-T protein in primary goat intramuscular preadipocytes and monoclonal goat intramuscular preadipocyte immortalized cell lines in the examples of the present application are shown; Figure 5The photographs of the 1st generation primary goat intramuscular preadipocytes and the 15th generation monoclonal goat intramuscular preadipocyte immortalized cell line under a fluorescence microscope are shown in the examples of the present application; Figure 6 The proliferation rate diagram of the 1st generation primary goat intramuscular preadipocyte and the 15th generation monoclonal goat intramuscular preadipocyte immortalized cell line of the embodiment of the present application is shown; Figure 7 The photographs of the 9th generation primary goat intramuscular preadipocytes and the 15th generation monoclonal goat intramuscular preadipocyte immortalized cell line under an optical microscope are shown in the examples of the present application; Figure 8 The photo of cells under an optical microscope after oleic acid was added to induce cell differentiation in the embodiment of the present application is shown; Fig. 9 The results of the cell lipid droplet content detection after oleic acid was added to induce cell differentiation in the embodiment of the present application are shown; Fig.10 A photograph of cells under an optical microscope is shown after oleic acid is added to induce cell differentiation in another embodiment of the present application; Fig.11 A graph showing the results of detecting cell lipid droplet content after adding oleic acid to induce cell differentiation in another embodiment of the present application is shown; Fig.12 The results of the detection of the SREBP1 gene expression level of the monoclonal goat intramuscular preadipocyte immortalized cell line in the embodiment of the present application are shown; Fig.13 The graph shows the detection result of the CEBP / α gene expression level of the monoclonal goat intramuscular preadipocyte immortalized cell line in the example of the present application. DETAILED DESCRIPTION

[0021] To make the purpose, technical solution and advantages of the present invention clearer, the technical solution of the present invention will be described in detail below. Obviously, the described embodiments are only part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other implementation methods obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention.

[0022] The terms "first", "second", etc. in the specification and claims of the present application are used to distinguish similar objects, and are not used to describe a specific order or sequence. It should be understood that the data used in this way can be interchangeable under appropriate circumstances, so that the embodiments of the present application can be implemented in an order other than those illustrated or described here, and the objects distinguished by "first", "second", etc. are generally of one type, and the number of objects is not limited. For example, the first object can be one or more. In addition, "and / or" in the specification and claims represents at least one of the connected objects, and the character " / " generally indicates that the objects associated with each other are in an "or" relationship.

[0023] The following is combined with Figures 1 to 13 The monoclonal goat intramuscular preadipocyte immortalized cell line, preparation method and application provided by the present application are described in detail through specific embodiments and application scenarios.

[0024] The method for preparing the monoclonal immortalized goat intramuscular preadipocyte cell line of this embodiment comprises the following steps: Step S100: The longissimus dorsi muscle of goat is taken and isolated and cultured to obtain primary goat intramuscular preadipocytes.

[0025] Step S200: Infecting primary goat intramuscular preadipocytes with a lentivirus carrying SV40-T, and adding puromycin to screen out positive cells infected with the lentivirus carrying SV40-T. The sequence information of SV40-T is shown in Seq. 1.

[0026] Step S300: Using the limiting dilution method, the screened positive cells are plated at a rate of one cell per well, and after culture, a monoclonal goat intramuscular preadipocyte cell line is obtained.

[0027] Step S400: selecting a monoclonal goat intramuscular preadipocyte cell line with a cell fusion density of 90% or more for expansion culture to obtain a monoclonal goat intramuscular preadipocyte immortalized cell line.

[0028] In the method for preparing a monoclonal goat intramuscular preadipocyte immortalized cell line of this embodiment, a lentivirus carrying SV40-T is used to infect primary goat intramuscular preadipocytes. SV40-T helps to maintain the original phenotype and function of the cells. The obtained monoclonal goat intramuscular preadipocyte immortalized cell line is used to prepare a cell model to study the proliferation, differentiation, lipopolysaccharide and / or regulatory mechanism of goat intramuscular preadipocytes. The specific functions and characteristics of the primary cells can be retained in the immortalized cells, and the cell model can provide a test environment that is closer to the original physiological conditions of the goat.

[0029] In some embodiments, before adding puromycin (Puro) to select positive cells infected with lentivirus carrying SV40-T, the method further includes a step of determining the concentration of puromycin for selection.

[0030] In some embodiments, determining the puromycin screening concentration comprises the following steps: Primary goat intramuscular preadipocytes were plated in 6-well plates. When the cell fusion density reached 80%, puromycin at concentrations of 0 μg / ml, 0.5 μg / ml, 1.0 μg / ml, 1.5 μg / ml, 2 μg / ml, 2.5 μg / ml, 3 μg / ml, and 4 μg / ml were added and cultured for 48 hours. The degree of cell death under different puromycin concentrations was observed, and the puromycin screening concentration was determined based on the degree of cell death.

[0031] The culture results are as follows Figure 1 As shown, from Figure 1 It can be seen that most of the cells added with 0.5 μg / ml puromycin died, almost all of the cells added with 1.0 μg / ml puromycin died, and all of the cells added with 1.5 μg / ml puromycin died. Therefore, the concentration of 1.0 μg / ml puromycin was used as the screening concentration.

[0032] In the method for preparing the monoclonal goat intramuscular preadipocyte immortalized cell line of this embodiment, 1.0 μg / ml puromycin is selected as the screening concentration, which helps to balance the retention of cell characteristics and the screening efficiency.

[0033] Specifically, on the one hand, a lower concentration of puromycin has less toxicity to goat intramuscular preadipocytes, which is beneficial to reducing the possibility of goat intramuscular preadipocytes producing stress responses and can improve the stability of long-term culture of goat intramuscular preadipocytes; and a lower concentration of puromycin has less inhibitory effect on cell growth, which helps to maintain the proliferation ability of cells, especially in long-term culture, and can enable goat intramuscular preadipocytes to maintain their proliferation ability for a long time; secondly, goat intramuscular preadipocytes have weak integration ability of lentivirus carrying SV40-T, and a lower concentration of puromycin helps to improve the success rate of screening, and can screen out cells that have only integrated a small amount of exogenous genes.

[0034] In some embodiments, in step S200, when adding the lentivirus carrying SV40-T to the primary goat intramuscular preadipocytes, a transfer agent is also added to the primary goat intramuscular preadipocytes. Exemplarily, the transfer agent is polybrene, and the added concentration of polybrene is 10 μg / ml.

[0035] In the method for preparing a monoclonal goat intramuscular preadipocyte immortalized cell line of this embodiment, when adding a lentivirus carrying SV40-T to primary goat intramuscular preadipocytes, polybrene is also added to the primary goat intramuscular preadipocytes as a transfer agent. Polybrene can not only increase the binding of the virus to the primary cells and improve the infection efficiency, but also help to increase the expression level of the SV40-T antigen, thereby more effectively inhibiting tumor suppressor proteins and improving the immortalization ability of goat intramuscular preadipocytes.

[0036] In some embodiments, in step S100, the longissimus dorsi muscle of goat is taken and isolated and cultured to obtain primary goat intramuscular preadipocytes, comprising the following steps: Step S110: The longissimus dorsi muscle of goats was collected under sterile conditions, washed with PBS, and then cut into pieces; Step S120: adding 2 volumes of type II collagenase and digesting in a 37°C water bath for 1.5 h; Step S130: adding an equal volume of complete culture medium to terminate digestion, and filtering to remove undigested tissue; Step S140: sieving the filtrate, centrifuging and discarding the supernatant to collect the cells; Step S150: adding red blood cell lysis solution, standing and centrifuging, and discarding the supernatant; Step S160: adding complete culture medium for culturing to obtain primary goat intramuscular preadipocytes.

[0037] The specific experimental process is as follows: (1) After the goats born 2-3 days ago were brought back to the laboratory, the carotid artery was bled, washed 2-3 times, and then wiped and disinfected with 75% alcohol. (2) The longissimus dorsi muscle of the goats was collected under sterile conditions, washed 3 times with PBS containing 3-5 times double antibody, and the tissue was cut into pieces with ophthalmic scissors. (3) Two volumes of type II collagenase were added and digested in a 37 ℃ water bath for 1.5 h (inverted and mixed every 5 min). (4) An equal volume of complete culture medium was added to terminate the digestion, and the undigested large pieces of tissue were filtered with sterile gauze. (5) The filtrate was passed through a 200 mesh (75 μm) sieve, centrifuged at 2000 r / min for 5 min, and the supernatant was discarded. (6) Red blood cell lysis buffer was added to blow off the precipitate, let it stand for 5 min, centrifuged at 2000 r / min for 5 min, and the supernatant was discarded. (7) The precipitate was resuspended in complete culture medium, and an appropriate amount of cell resuspension was divided into 25 cm 2 Add an appropriate amount of complete culture medium to the culture flask and culture for 2 h. (8) Discard the culture medium and non-adherent cells, wash 1-2 times with PBS, and add fresh culture medium to obtain primary goat intramuscular preadipocytes.

[0038] In some embodiments, in step S200, primary goat intramuscular preadipocytes are infected with a lentivirus carrying SV40-T, and puromycin is added to screen out positive cells infected with the lentivirus carrying SV40-T, comprising the following steps: primary goat intramuscular preadipocytes are plated, and when the cell fusion density reaches 70-80%, a lentivirus carrying SV40-T (purchased from Hanheng Bio) and 10 μg / ml of a transfer agent polybrene are added, and 1.0 μg / ml of puromycin is added 48 hours after infection to screen out positive cells infected with the lentivirus carrying SV40-T.

[0039] After adding 1.0 μg / ml puromycin, the cells were cultured for 48 h. The culture results were as follows: Figure 2 As shown. Figure 2 As shown, after 48 hours of culture, cells that were not infected with the lentivirus carrying SV40-T and not supplemented with puromycin did not die; most of the cells that were not infected with the lentivirus carrying SV40-T and supplemented with puromycin died; and cells that were infected with the lentivirus carrying SV40-T and supplemented with puromycin did not die.

[0040] In some embodiments, the limiting dilution method is used to plate positive cells infected with lentivirus carrying SV40-T into a 96-well plate at a rate of one cell per well, and the culture medium is replaced every 2 days to obtain a monoclonal goat intramuscular preadipocyte cell line. Cell lines with a cell fusion density of 90% or more are selected for expansion culture to obtain a monoclonal goat intramuscular preadipocyte immortalized cell line.

[0041] The specific experimental process is as follows: Using the limiting dilution method, positive cells infected with lentivirus carrying SV40-T were plated into 96-well plates at the amount of one cell per well, and the culture medium was replaced every 2 days to obtain a monoclonal goat intramuscular preadipocyte cell line. 22 cells with good growth status, fast growth rate, and cell fusion density of 90% were selected from 384 wells for expansion culture to obtain a monoclonal goat intramuscular preadipocyte immortalized cell line.

[0042] Observation under an optical microscope showed that the immortalized monoclonal goat intramuscular preadipocyte cell line had the same morphological characteristics as the primary goat intramuscular preadipocytes, both of which were plump spindle-shaped. Figure 3 shown.

[0043] Among the obtained monoclonal goat intramuscular preadipocyte immortalized cell lines, one was selected for subsequent experiments.

[0044] Experimental Example 1: WB detection of SV40-T expression.

[0045] Primary goat intramuscular preadipocytes and monoclonal goat intramuscular preadipocyte immortalized cell lines were plated in 6-well plates. The cell fusion density reached about 90%. 200 μl of cell lysis buffer was added to each well and lysed on ice for 10 min. An equal volume of 2× protein loading buffer was added and mixed. The mixture was incubated in a boiling water bath for 10 min. 20 μl of sample was taken for protein gel electrophoresis at 80 V for 20 min and 120 V for 1.5 h. The protein was transferred from the gel to the NC membrane using a semi-dry transfer apparatus, blocked with blocking solution containing 10% skim milk powder at room temperature for 1 h, incubated with the primary antibody (SV40-T) at room temperature for 2 h, washed with TBST 3 times, incubated with the secondary antibody at room temperature for 1 h, washed with TBST 3 times, and developed on a protein gel imaging system.

[0046] Test results such as Figure 4 As shown. Figure 4 It can be seen that SV40-T protein could not be detected in the samples of primary goat intramuscular preadipocytes, while SV40-T protein could be detected in the monoclonal goat intramuscular preadipocyte immortalized cell line infected with lentivirus carrying SV40-T, indicating that SV40-T has been stably expressed in the monoclonal goat intramuscular preadipocyte immortalized cell line.

[0047] Experimental Example 2: EDU staining to detect the proliferation rate of the monoclonal goat intramuscular preadipocyte immortalized cell line.

[0048] The 15th generation monoclonal goat intramuscular preadipocyte immortalized cell line was plated into 6-well plates. When the cell confluence density reached 90%, EDU solution (final concentration of 10 μM) preheated at 37 °C was added to the cells, cultured for 2 h, washed 3 times with PBS, fixed with 1 ml 4% paraformaldehyde at room temperature for 15 min, washed 3 times with washing solution (PBS containing 3% BSA), treated with permeabilization solution (PBS containing 0.3% Triton X-100) for 15 min, washed twice with washing solution, incubated with 1 ml click working solution for 30 min, washed 3 times with PBS, and photographed under a fluorescence microscope. Image Pro Plus 6.0 was used to measure the EDU-positive cell rate and quantify the staining results.

[0049] The results showed that the 15th generation monoclonal goat intramuscular preadipocyte immortalized cell line had a similar proliferation rate to the 1st generation primary goat intramuscular precursor cells, such as Figure 5 and Figure 6 As shown ( Figure 5 and Figure 6 In the figure, F0 indicates the first generation of primary goat intramuscular preadipocytes; I-F15 indicates the 15th generation of monoclonal goat intramuscular preadipocyte immortalized cell line).

[0050] like Figure 7As shown ( Figure 7 F9 in the figure indicates the 9th generation primary goat intramuscular preadipocytes; I-F15 indicates the 15th generation monoclonal goat intramuscular preadipocyte immortalized cell line). After continuous passage, primary goat intramuscular preadipocytes will show aging characteristics such as cell hypertrophy, slow cell growth rate and poor cell status (such as Figure 7 The monoclonal goat intramuscular preadipocyte immortalized cell line has a strong proliferation capacity and also stably maintains the morphology of intramuscular preadipocytes (as shown in Figure 7 B). This indicates that the monoclonal goat intramuscular preadipocyte immortalized cell line constructed in the present application example has strong proliferation ability while maintaining stability, and can be used for research related to intramuscular adipocyte proliferation. It has been stably propagated to the 20th generation.

[0051] Experimental Example 3: Detection of the differentiation and lipopolysaccharide ability of the immortalized monoclonal goat intramuscular preadipocyte cell line.

[0052] The monoclonal goat intramuscular preadipocyte immortalized cell line was plated into a 6-well plate. When the cell fusion density reached 80%, 50 μM oleic acid was added to induce cell differentiation. The group without oleic acid induction was used as a control group and cultured for 48 h before subsequent operations.

[0053] Oil Red O staining: discard the culture medium, wash the cells three times with PBS, fix the cells with 4% paraformaldehyde for 30 min, and wash them three times with PBS. Add Oil Red O working solution (a mixture of 3 ml 5g / L Oil Red O dissolved in isopropanol and 2 ml ddH2O) and incubate at room temperature for 20 min. Discard the Oil Red O working solution and wash with PBS. Take pictures with a microscope. The results are as follows: Figure 8 1 ml of isopropanol was added to each well to extract Oil Red O in the cells, and the absorbance at 510 nm was measured to quantify the Oil Red O staining results. Fig. 9 shown.

[0054] from Figure 8 and Fig. 9 It can be seen that the lipid droplet content of cells induced by adding 50 μM oleic acid was significantly higher than that of cells induced without adding oleic acid.

[0055] BODIPY staining: discard the culture medium, wash the cells three times with 4 ℃ pre-cooled PBS, treat the cells with 4% paraformaldehyde for 30 min, discard the paraformaldehyde, wash the cells three times with PBS, add 300 μL 1.0 μg / mL PBS diluted BODIPY staining solution to each well and incubate for 30 min in the dark, discard the BODIPY staining solution, wash the cells three times with PBS, add 300 μL DAPI (final concentration of 1 mg / ml) staining solution and incubate on a shaker in the dark for 10 min, wash the cells three times with PBS and take pictures with a fluorescence microscope. The results are as follows: Fig.10 As shown; Image Pro Plus 6.0 was used to measure the fluorescence intensity and cell number, and the staining results were quantified. Fig.11 shown.

[0056] from Fig.10 and Fig.11 It can be seen that the lipid droplet content of cells induced by 50 μM oleic acid was significantly higher than that of cells not induced by oleic acid, indicating that the monoclonal goat intramuscular preadipocyte immortalized cell line retains the characteristics of goat intramuscular preadipocytes and also has the potential for differentiation.

[0057] Experimental Example 4: Detection of lipid metabolism-related genes in a monoclonal immortalized goat intramuscular preadipocyte cell line.

[0058] The monoclonal goat intramuscular preadipocyte immortalized cell line was plated into a 6-well plate. When the cell fusion density reached 80%, 50 μM oleic acid was added to induce cell differentiation. The group without oleic acid induction was used as a control group and cultured for 48 h before subsequent operations.

[0059] Total RNA from the monoclonal goat intramuscular preadipocyte immortalized cell line was extracted using Trizol reagent according to the manufacturer's protocol. The concentration and purity of RNA were measured using Nanodrop 2000 (Thermo Fisher Scientific), and the absorbance ratio of total RNA (260 / 280 nm) was between 1.8 and 2.0 for subsequent experiments. 1 μg of total RNA was reverse transcribed into cDNA using the Novozyme reverse transcription kit, and RT-qPCR was performed on SREBP1 and CEBP / α genes using the SYBR Green Master Mix kit, with UXT as the internal reference gene and 2 -∆∆CT法计算这些基因的相对表达量，结果如图12和图13所示（***表示P<0.0001）。其中所使用的引物为： UXT-F: GCAAGTGGATTTGGGCTGTAAC; UXT-R: ATGGAGTCCTTGGTGAGGTTGT.

[0060] SREBP1-F:CTGCTGACCGACATAGAAGACAT; SREBP1-R: GTAGGGCGGGTCAAACAGG.

[0061] CEBP / α-F: CCGTGGACAAGAACAGCAAC; CEBP / α-R: AGGCGGTCA TTGTCACTGGT.

[0062] from Fig.12 and Fig.13 It can be seen that the addition of 50 μM oleic acid to the monoclonal goat intramuscular preadipocyte immortalized cell line significantly increased the expression levels of adipogenesis positively related genes SREBP1 and CEBP / α.

[0063] It should be noted that, in this article, the terms "comprise", "include" or any other variant thereof are intended to cover non-exclusive inclusion, so that the process, method, article or device including a series of elements includes not only those elements, but also includes other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, the elements defined by the sentence "comprise one..." do not exclude the presence of other identical elements in the process, method, article or device including the element. In addition, it should be pointed out that the scope of the methods and devices in the embodiments of the present application is not limited to performing functions in the order shown or discussed, and may also include performing functions in a substantially simultaneous manner or in reverse order according to the functions involved, for example, the described method may be performed in an order different from that described, and various steps may also be added, omitted, or combined. In addition, the features described with reference to certain examples may be combined in other examples.

[0064] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can easily think of changes or substitutions within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A method for preparing a monoclonal goat intramuscular preadipocyte immortalized cell line, characterized in that: The steps include: Step S100: taking the longissimus dorsi muscle of goat, isolating and culturing to obtain primary goat intramuscular preadipocytes; Step S200: Infecting primary goat intramuscular preadipocytes with a lentivirus carrying SV40-T, and adding puromycin to screen out positive cells infected with the lentivirus carrying SV40-T. The sequence information of SV40-T is shown in Seq. 1; Step S300: using the limiting dilution method, the screened positive cells are plated at a rate of one cell per well, and after culture, a monoclonal goat intramuscular preadipocyte cell line is obtained; Step S400: selecting a monoclonal goat intramuscular preadipocyte cell line with a cell fusion density of 90% or more for expansion culture to obtain a monoclonal goat intramuscular preadipocyte immortalized cell line.

2. The method for preparing the monoclonal goat intramuscular preadipocyte immortalized cell line according to claim 1, characterized in that: In step S200, the concentration of puromycin added is 0.5-1.5 μg / ml.

3. The method for preparing the monoclonal goat intramuscular preadipocyte immortalized cell line according to claim 2, characterized in that: In step S200, the concentration of puromycin added is 0.5-1.0 μg / ml.

4. The method for preparing a monoclonal goat intramuscular preadipocyte immortalized cell line according to any one of claims 1 to 3, characterized in that: In step S200, the concentration of puromycin added is 1.0 μg / ml.

5. The method for preparing the monoclonal goat intramuscular preadipocyte immortalized cell line according to claim 1, characterized in that: In step S200, when the lentivirus carrying SV40-T is added to the primary goat intramuscular preadipocytes, a transfer agent is also added to the primary goat intramuscular preadipocytes, and the transfer agent is polybrene, and the added concentration of polybrene is 10 μg / ml.

6. The method for preparing the monoclonal goat intramuscular preadipocyte immortalized cell line according to claim 1, characterized in that: In step S100, the longissimus dorsi muscle of goat is taken and isolated and cultured to obtain primary goat intramuscular preadipocytes, which comprises the following steps: Step S110: The longissimus dorsi muscle of goats was collected under sterile conditions, washed with PBS, and then cut into pieces; Step S120: adding 2 volumes of type II collagenase and digesting in a 37°C water bath for 1.5 h; Step S130: adding an equal volume of complete culture medium to terminate digestion, and filtering to remove undigested tissue; Step S140: sieving the filtrate, centrifuging and discarding the supernatant to collect the cells; Step S150: adding red blood cell lysis solution, standing and centrifuging, and discarding the supernatant; Step S160: adding complete culture medium for culturing to obtain primary goat intramuscular preadipocytes.

7. The method for preparing the monoclonal goat intramuscular preadipocyte immortalized cell line according to claim 1, characterized in that: In step S200, the primary goat intramuscular preadipocytes are infected with a lentivirus carrying SV40-T, and puromycin is added to screen out positive cells infected with the lentivirus carrying SV40-T, including the following steps: Primary goat intramuscular preadipocytes were plated, and when the cell fusion density reached 70-80%, lentivirus carrying SV40-T and 10 μg / ml of the transfer agent polybrene were added. 1.0 μg / ml of puromycin was added 48 hours after infection to screen out positive cells infected with lentivirus carrying SV40-T.

8. The method for preparing the monoclonal goat intramuscular preadipocyte immortalized cell line according to claim 1, characterized in that: In step S300, when culturing the screened positive cells, the culture medium is replaced every 2 days.

9. A monoclonal immortalized goat intramuscular preadipocyte cell line obtained by the preparation method according to any one of claims 1 to 8.

10. Use of the monoclonal goat intramuscular preadipocyte immortalized cell line according to claim 9 in preparing a goat intramuscular preadipocyte model, characterized in that: The model is used for studying the proliferation, differentiation, lipogenesis and / or regulatory mechanism of goat intramuscular preadipocytes.

Images