7beta hydroxysteroid dehydrogenase mutant and application thereof in preparation of UDCA

Abstract

The invention belongs to the field of protein rational design and enzyme engineering, and particularly relates to a 7beta hydroxysteroid dehydrogenase mutant and application thereof in preparation of UDCA. Firstly, ruminococcus torquens 7beta-hydroxysteroid dehydrogenase is used as a template, hydrogen bonds are increased through homologous modeling prediction, a mutant 7beta-HSDH-3M is obtained through site-specific mutagenesis, the 50-DEG C thermal stability of the obtained 7beta-hydroxysteroid dehydrogenase is remarkably improved, the 7beta-hydroxysteroid dehydrogenase is used for catalyzing 80g / L L7-KLCA to generate UDCA, the conversion rate exceeds 99%, and the 7beta-hydroxysteroid dehydrogenase can be used for preparing a mutant 7beta-HSDH-3M mutant 7beta-HSDH-3M mutant 7beta-HSDH-3M mutant 7beta-HSDH-3M mutant 7beta-HSDH-3M. Complete conversion (greater than 99%) of a product substrate is realized through high conversion rate of 7beta-HSDH.

Description

Technical Field

[0001] The invention belongs to the field of protein rational design and enzyme engineering, and specifically relates to a 7β-hydroxysteroid dehydrogenase mutant and application thereof in the preparation of UDCA. Background Art

[0002] Ursodeoxycholic acid (UDCA) is the active ingredient of the precious Chinese medicinal material bear bile. Its chemical name is 3α,7β-dihydroxy-5β-cholestane-24-acid, also known as ursodeoxycholic acid. It is a drug approved by the US FDA for the treatment of primary biliary cirrhosis. It is also used to treat primary sclerosing cholangitis, alcoholic and fatty liver disease, viral hepatitis, drug-induced hepatitis and other cholestatic liver diseases. It is also the first choice for cholesterol stone dissolution treatment and is used to treat various gallstone diseases. In 1902, Swedish chemist Hammarsten first discovered UDCA from the bile of polar bears. In 1927, Shoda of Okayama University in Japan separated and crystallized UDCA from the bile of Chinese black bears and named it. In 1954, Kanazawa synthesized UDCA by chemical method and began to use it in clinical practice (Journal of Biotechnology, 2014, 191: 11-21).

[0003] UDCA is most abundant in bear bile, but only in other animals. At present, UDCA is mainly extracted from bear bile, and a small amount is synthesized artificially. "Extracting bile from live bears" is a method of extracting UDCA from live black bears. This method has low yield, long cycle, and has been controversial because it violates natural ethics. Since the 1950s, there have been reports of chemical synthesis of UDCA. With the development of biotechnology, the synthesis of UDCA using biocatalytic technology and combined with chemical methods has received great attention due to its mild reaction conditions, high selectivity, and green environmental protection. Using bile acid (CA) or chenodeoxycholic acid (CDCA) that can be obtained in large quantities from the bile of farmed poultry and livestock as substrates, using enzymatic methods or chemical-enzymatic methods combined to artificially synthesize UDCA with high value, reduce the demand for natural bear bile, and conform to the concept of contemporary sustainable development.

[0004] At present, the industry adopts the traditional seven-step synthesis method to produce UDCA, using bile acid (CA) in cattle and sheep bile as raw materials, carboxyl methyl esterification under acidic conditions, and then pyridine / glacial acetic acid for diacetylation at positions 3 and 7 to protect the hydroxyl group, 12 hydroxyl group oxidation with chromium oxide, followed by Wolff-Kishner-Huang Minglong reduction, and then hydrolysis to obtain CDCA, further oxidation to generate 7-carbonyl lithocholic acid (7-KLCA), and finally reduction with alkali metal sodium in n-propanol to obtain UDCA. This method has cumbersome steps, long synthesis route, violent reaction, poor operation safety, low total yield (27%-32%), and serious environmental pollution.

[0005] In 2009, Riva et al. reported a method for biocatalytic conversion of CA to 12-carbonyl ursodeoxycholic acid, and then using chemical catalytic reduction to prepare UDCA (Adv Synth Catal, 2009, 351: 1303-1311). Three enzymes were used in the bioconversion reaction. First, 7α-hydroxysterol dehydrogenase (7α-HSDH) and 12α-hydroxysterol dehydrogenase (12α-HSDH) were used to catalyze the oxidation of CA to 7,12-dicarbonyl lithocholic acid, and then 7β-hydroxysterol dehydrogenase (7β-HSDH) was used to catalyze the reduction of 7,12-dicarbonyl lithocholic acid to 12-carbonyl ursodeoxycholic acid, and then UDCA was generated through the Wolff-Kishner-Huang Minglong reduction reaction. Due to the poor specificity of the enzyme that catalyzes the recycling of the coenzyme in the enzymatic oxidation-reduction process, the conversion was incomplete, so the purity of the final product UDCA was not high.

[0006] In 2011, Rolf D. Schmid and German Cell Pharmaceutical Company expressed the 7β-HSDH gene in Escherichia coli, identified the enzymatic properties and used it to reduce 7,12-diketo-LCA or 7-KLCA to obtain 12-keto-UDCA or UDCA (Appl Microbiol Biotechnol, 2011, 90: 127-135). The enzyme showed high selectivity and did not form by-products. After further optimization, mutants with improved activity and removal of substrate inhibition were obtained (CN201080062617, CN201180067680). The high conversion rate and high specificity of the recombinant enzyme made large-scale enzymatic production of UDCA possible. In addition, Xu Jianhe from East China University of Science and Technology cloned and expressed the 7β-HSDH gene from Ruminococcus torques ATCC35915. This enzyme also has a high conversion rate and high specificity for the substrate 7-KLCA, similar to the 7β-HSDH from Collins aerogenes. Nevertheless, the synthesis of UDCA catalyzed by 7β-HSDH from different sources above uses a low substrate concentration (4-40g / L), and the conversion rate is only 90% at a substrate concentration of 40g / L, and the product yield is only 71%.

[0007] In 2015, Li Chunxiu and others from East China University of Science and Technology cloned a new 7β-hydroxysteroid dehydrogenase (7β-HSDHRt) from Ruminococcus torques. Through evolutionary modification, they obtained a mutant with a 5.5-fold increase in activity, a 3-fold increase in half-life at 40°C, and an optimal pH shift from weak acidity to weak alkalinity. CDCA was efficiently converted into UDCA through a two-step enzymatic cascade reaction. When the substrate concentration was 100 mM, the final conversion rate was higher than 99% (Process Biochem, 2015, 50: 598-604; JAgric Food Chem, 2017, 65: 1178-1185; CN107099516A).

[0008] Generally speaking, the enzyme conversion process uses 80g / L or higher substrate concentration, and the conversion rate is close to 100%, which is considered to have the significance of industrial production. The original 7β-hydroxysteroid dehydrogenase is difficult to meet the needs of industrial production. The feed amount is low, and the conversion rate is only 90% at a substrate concentration of 40g / L, and the product yield is only 71%. The enzyme has poor stability, and the newly produced enzyme needs to be used as soon as possible. After long-term storage, the enzyme activity decreases sharply, and the storage of the enzyme requires higher requirements, which is not conducive to industrial production. Therefore, it shows that this enzymatic reaction is still a long way from industrial large-scale production. Summary of the invention

[0009] The purpose of the present invention is to overcome the shortcomings of the above-mentioned prior art and provide a 7β-hydroxysteroid dehydrogenase mutant and a construction method thereof, wherein the enzyme is used to catalyze 80 g / L of L7-KLCA to produce UDCA with a conversion rate of more than 99%, which basically meets the requirements of industrial production.

[0010] The technical solution of the present invention is achieved in this way:

[0011] A 7β-hydroxysteroid dehydrogenase mutant, the amino acid sequence of the 7β-hydroxysteroid dehydrogenase mutant is as follows:

[0012] Met Asn Leu Arg Glu Lys Tyr Gly Glu Trp Gly Ile Ile Leu Gly Ala ThrGlu Gly Val Gly Lys Ala

[0013] Phe Ala Glu Lys Ile Ala Ser Glu Gly Met Ser Val Val Leu Val Gly ArgArg Glu Glu Lys Leu Gln

[0014] Glu Leu Gly Lys Ser Ile Ser Glu Thr Tyr Gly Val Asp His Met Val IleArg Ala Asp Phe Ala Gln

[0015] Ser Asp Cys Thr Asp Lys Ile Phe Glu Ala Thr Lys Asp Leu Asp Met GlyPhe Met Ser Tyr Val Ala

[0016] Cys Phe His Thr Phe Gly Lys Leu Gln Asp Thr Pro Trp Glu Lys His GluGln Met Ile Asn Val Asn

[0017] Val Met Thr Phe Leu Lys Cys Phe Tyr His Tyr Met Gly Ile Phe Ala LysGln Asp Arg Gly Ala Val

[0018] Ile Asn Val Ser Ser Leu Thr Ala Ile Lys Ser Ser Pro Tyr Asn Ala GlnTyr Gly Ala Gly Lys Ser Tyr

[0019] Ile Lys Lys Leu Thr Glu Ala Val Ala Ala Glu Cys Glu Ser Thr Asn ValAsp Val Glu Val Ile Thr

[0020] Leu Gly Thr Val Ile Thr Pro Ser Leu Leu Ser Asn Leu Pro Gly Gly ProAla Gly Glu Ala Met Met

[0021] Lys Thr Ala Met Thr Pro Glu Ala Cys Val Glu Glu Ala Phe Asp Asn LeuGly Lys Ser Leu Ser Val

[0022] Ile Ala Gly Glu His Asn Lys Ala Asn Val His Asn Trp Gln Ala Asn LysThr Asp Asp Glu Tyr Ile

[0023] Arg Tyr Met Gly Ser Phe Tyr Ser Asn Asn

[0024] As a scheme, the 7β-hydroxysteroid dehydrogenase mutant is obtained by mutating the threonine at position 189 to valine, the valine at position 207 to methionine, and the serine at position 148 to lysine in the amino acid sequence of the wild-type 7β-hydroxysteroid dehydrogenase SEQ ID NO.2.

[0025] The amino acid sequence of wild-type 7β-hydroxysteroid dehydrogenase, SEQ ID NO.2, is as follows: Met Asn Leu Arg Glu Lys Tyr Gly Glu Trp Gly Ile Ile Leu Gly Ala Thr Glu Gly Val Gly Lys Ala Phe Ala Glu Lys Ile Ala Ser Glu Gly Met Ser Val Val Leu Val Gly Arg Arg Glu Glu Lys Leu Gln Glu Leu Gly Lys Ser Ile Ser Glu Thr Tyr Gly Val Asp His Met Val Ile Arg Ala Asp Phe Ala Gln Ser Asp Cys Thr Asp Lys Ile Phe Glu Ala Thr Lys Asp Leu Asp Met Gly Phe Met Ser Tyr Val Ala Cys Phe His Thr Phe Gly Lys Leu Gln Asp Thr Pro Trp Glu Lys His Glu Gln Met Ile Asn Val Asn Val Met Thr Phe Leu Lys Cys Phe Tyr His Tyr Met Gly Ile Phe Ala Lys Gln Asp Arg Gly Ala Val Ile Asn Val Ser Ser Leu Thr Ala Ile Ser Ser Ser Pro Tyr Asn Ala Gln Tyr Gly Ala Gly Lys Ser Tyr Ile Lys Lys Leu Thr Glu Ala Val Ala Ala Glu Cys Glu Ser Thr Asn Val Asp Val Glu Val Ile Thr Leu Gly Thr Thr Ile Thr Pro Ser Leu Leu Ser Asn Leu Pro Gly Gly Pro Ala Gly Glu Ala Val Met Lys Thr Ala Met Thr Pro Glu Ala Cys Val Glu Glu Ala Phe Asp Asn Leu Gly Lys Ser Leu Ser Val Ile Ala Gly Glu His Asn Lys Ala Asn Val His Asn Trp Gln Ala AsnLys ThrAsp Asp Glu Tyr IleArg Tyr Met Gly Ser Phe Tyr Ser Asn Asn

[0026] As another embodiment, the 7β-hydroxysteroid dehydrogenase mutant is obtained by mutating the serine at position 148 in the amino acid sequence SEQ ID NO. 3 of the 7β-hydroxysteroid dehydrogenase T189V / V207M double mutant to lysine.

[0027] The amino acid sequence of the 7β-hydroxysteroid dehydrogenase T189V / V207M double mutant is as follows:

[0028] Met Asn Leu Arg Glu Lys Tyr Gly Glu Trp Gly Ile Ile Leu Gly Ala ThrGlu Gly Val Gly Lys Ala

[0029] Phe Ala Glu Lys Ile Ala Ser Glu Gly Met Ser Val Val Leu Val Gly ArgArg Glu Glu Lys Leu Gln

[0030] Glu Leu Gly Lys Ser Ile Ser Glu Thr Tyr Gly Val Asp His Met Val IleArg Ala Asp Phe Ala Gln

[0031] Ser Asp Cys Thr Asp Lys Ile Phe Glu Ala Thr Lys Asp Leu Asp Met GlyPhe Met Ser Tyr Val Ala

[0032] Cys Phe His Thr Phe Gly Lys Leu Gln Asp Thr Pro Trp Glu Lys His GluGln Met Ile Asn Val Asn

[0033] Val Met Thr Phe Leu Lys Cys Phe Tyr His Tyr Met Gly Ile Phe Ala LysGln Asp Arg Gly Ala Val

[0034] Ile Asn Val Ser Ser Leu Thr Ala Ile Ser Ser Ser Pro Tyr Asn Ala GlnTyr Gly Ala Gly Lys Ser Tyr

[0035] Ile Lys Lys Leu Thr Glu Ala Val Ala Ala Glu Cys Glu Ser Thr Asn ValAsp Val Glu Val Ile Thr

[0036] Leu Gly Thr Val Ile Thr Pro Ser Leu Leu Ser Asn Leu Pro Gly Gly ProAla Gly Glu Ala Met Met

[0037] Lys Thr Ala Met Thr Pro Glu Ala Cys Val Glu Glu Ala Phe Asp Asn LeuGly Lys Ser Leu Ser Val

[0038] Ile Ala Gly Glu His Asn Lys Ala Asn Val His Asn Trp Gln Ala Asn LysThr Asp Asp Glu Tyr Ile

[0039] Arg Tyr Met Gly Ser Phe Tyr Ser Asn Asn

[0040] The nucleotide sequence SEQ ID of the wild-type 7β-hydroxysteroid dehydrogenase NO.1 is as follows: ATGAACCTGCGCGAAAAATATGGCGAATGGGGTATTATTCTGGGCGCCACCGAAGGCGTGGGTAAAGCCTTTGCAGAAAAAATTGCAAGCGAAGGTATGAGCGTTGTGCTGGTTGGCCGCCGGAAGAAAACTGCAGGAACTGGGCAAAAGTATTAGCGAAACCTATGGCGTTGATCATATGGTGATTCGC GCCGATTTTGCACAGAGTGATTGTACCGATAAAATTTTTGAAGCCACCAAAGATCTGGATATGGGCTTTATGAGTTATGTTGCCTGCTTTCATACCTTTGGTAAACTGCAGGATACCCCGTGGGAAAAACATGAACAGATGATTAATGTGAACGTTATGACCTTTCTGAAATGTTTTTTACCATTACATGGGTATTTTCGC AAAACAGGATCGCGGCGCCGTGATTAATGTTAGCAGCCTGACCGCCATTAGTAGTAGTCCGTATAATGCCCAGTATGGCGCAGGCAAAAGCTATATTAAAAAAACTGACCGAAGCCGTTGCAGCCGAATGTGAAAGTACCAATGTTGATGTGGAAGTGATTACCCTGGGTACCACCATTACCCCGAGTCTGCTGAGCAATC TGCCGGGCGGCCCGGCTGGTGAAGCAGTTATGAAAACCGCCATGACCCCGGAAGCCTGTGTTGAAGAAGCCTTTGATAATCTGGGTAAAAGCCTGAGCGTTATTGCAGGTGAACATAATAAAAGCCAATGTTCATAATTGGCAGGCCAATAAAACCGATGATGAATATATTCGCTACATGGGTAGCTTTTATAGTAATAAT

[0041] The present invention also provides a gene encoding any one of the above-mentioned 7β-hydroxysteroid dehydrogenase mutants.

[0042] The present invention also provides a recombinant expression plasmid comprising the above coding gene.

[0043] The present invention also provides a recombinant expression transformant, comprising the above coding gene or the above recombinant expression plasmid.

[0044] The present invention also provides the use of the 7β-hydroxysteroid dehydrogenase mutant in the preparation of UDCA. The 7β-hydroxysteroid dehydrogenase mutant is coupled with glucose dehydrogenase to achieve the cyclic regeneration of the coenzyme NADPH. The amino acid sequence of glucose dehydrogenase SEQ ID NO.5 is as follows: Met Met Thr Glu Gln Lys Ala Ile Val Thr AspAla Pro Lys Gly Gly Val Lys Tyr Thr Thr Ile AspMet Pro Glu Pro Glu His TyrAsp Ala Lys Leu Ser Pro Val Tyr Ile Gly Ile Cys Gly Thr Asp ArgGly Glu ValAla Gly Ala Leu Ser Phe Thr Tyr Asn Pro Glu Gly Glu Asn Phe Leu Val Leu GlyHisGlu Ala Leu Leu Arg Val Asp Asp Ala Arg Asp Asn Gly Tyr Ile Lys Lys GlyAsp Leu Val Val ProLeu Val Arg Arg Pro Gly Lys Cys Ile Asn Cys Arg Ile GlyArg Gln Asp Asn Cys Ser Ile Gly AspPro Asp Lys His Glu Ala Gly Ile Thr GlyLeu His Gly Phe Met Arg Asp Val Ile Tyr Asp Asp IleGlu Tyr Leu Val Lys ValGlu Asp Pro Glu Leu Gly Arg Ile Ala Val Leu Thr Glu Pro Leu Lys AsnVal MetLys Ala Phe Glu Val Phe Asp Val Val Ser Lys Arg Ser Ile Phe Phe Gly Asp AspSer ThrLeu Ile Gly Lys Arg Met Val Ile Ile Gly Ser Gly Ser Glu Ala Phe LeuTyr Ser Phe Ala Gly Val AspArg Gly Phe Asp Val Thr Met Val Asn Arg His AspGlu Thr Glu Asn Lys Leu Lys Ile MetAspGlu Phe Gly Val Lys Phe Ala Asn TyrLeu Lys Asp Met Pro Glu Lys Ile Asp Leu Leu Val Asp ThrSer Gly Asp Pro ThrThr Thr Phe Lys Phe Leu Arg Lys Val Asn Asn Asn Gly Val Val Ile Leu PheGlyThr Asn Gly Lys Ala Pro Gly Tyr Pro Val Asp Gly Glu Asp Ile Asp Tyr Ile ValGlu Arg AsnIle Thr Ile Ala Gly Ser Val Asp Ala Ala Lys Ile His Tyr Val GlnAla Leu Gln Ser Leu Ser Asn TrpAsn Arg Arg His Pro Asp Ala Met Lys Ser IleIle Thr Tyr Glu Ala Lys Pro Ser Glu Thr Asn Ile PhePhe Gln Lys Pro His GlyGlu Ile Lys Thr Val Ile Lys Trp Gln Leu Glu

[0045] The cyclic regeneration of the coenzyme NADPH can effectively, efficiently and specifically convert 7-KLCA into UDCA, thereby realizing the industrial production of enzymatic UDCA synthesis.

[0046] Compared with the prior art, the present invention has the following beneficial effects:

[0047] 1. The present invention uses homology modeling and amino acid sequence alignment of the three-dimensional structure of Ruminococcus torques 7β-hydroxysteroid dehydrogenase (PDB: 5FYD), uses site-directed mutagenesis technology to molecularly transform the existing 7β-hydroxysteroid dehydrogenase, and screens out 7β-hydroxysteroid dehydrogenase with higher thermal stability.

[0048] 2. The S148K / T189V / V207M triple mutant obtained by screening is based on the original T189V / V207M double mutant SEQID NO.3, in which the S148 residue is changed to the K148 residue, forming a hydrogen bond with P199, thereby enhancing the stability of the dimer.

[0049] 3. The original 7β-hydroxysteroid dehydrogenase is difficult to meet the needs of industrial production. The feed amount is low, the conversion rate is only 90% at a substrate concentration of 40g / L, and the product yield is only 71%; the enzyme stability is poor, the newly produced enzyme needs to be used as soon as possible, and the enzyme activity decreases sharply after long-term storage. The preservation of the enzyme requires higher requirements, which is not conducive to industrial production. The triple mutant enzyme (7β-HSDH-3M mutant enzyme) of the present invention retains 91.5% of the original activity after incubation at 50°C for 4h, while the original double mutant (7β-HSDH-2M mutant enzyme) retains 15.6%, and the wild type (7β-HSDH-WT wild type enzyme) only retains 8.8%. The triple mutant enzyme has significantly improved thermal stability at 50°C. The enzyme is used to catalyze 80g / L of L7-KLCA to generate UDCA, and the conversion rate exceeds 99%. The high conversion rate of 7β-HSDH realizes the complete conversion of the product substrate (>99%), and the high conversion rate realizes the singularity of the product in the system, which is convenient for the separation and purification of the product. BRIEF DESCRIPTION OF THE DRAWINGS

[0050] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0051] Figure 1 It is the dimer structure of T189V / V207M double mutant 7β-HSDH-2M (SEQ ID NO.3);

[0052] Figure 2 It is the dimer structure of the S148K / T189V / V207M triple mutant 7β-HSDH-3M (SEQ ID NO. 4);

[0053] Figure 3 The SDS-PAGE images of 7β-HSDH wild-type and mutant protein expressions;

[0054] Figure 4 It is the HPLC chromatogram of substrate 7-KLCA (80 g / L);

[0055] Figure 5 The high performance liquid chromatogram is the conversion of 7-KLCA (80 g / L) using 7β-HSDH-3M (SEQ ID NO. 4) and glucose dehydrogenase SEQ ID NO. 5 in combination. DETAILED DESCRIPTION

[0056] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0057] Example 1: Site-directed mutagenesis of 7β-HSDH

[0058] 7β-Hydroxysteroid dehydrogenase needs to form a dimer to exert its catalytic activity. The monomer has no catalytic activity. Therefore, the stability of the dimer largely determines the stability of 7β-dehydrogenase.

[0059] (1) Homology modeling and site inference:

[0060] Based on 7β-hydroxysteroid dehydrogenase (PDB: 5FYD), homology modeling analysis was performed using Uniprot and NCBI BLAST. In the three-dimensional structure of 7β-HSDH with an amino acid sequence as shown in the sequence table SEQ ID No. 2, it is speculated that serine at position 148 and proline at position 199 are key residues for connecting dimers. Site-directed mutagenesis based on SEQ ID No. 2 can form a hydrogen bond between lysine at position 148 and proline at position 199. In addition, positions 189 to 210 belong to a conserved sequence, and two sites at positions 203 and 210 are selected for site-directed mutagenesis.

[0061] The theoretical spatial distance between Serine 148 and Proline 199 before mutation is ( Figure 1 ); Sequence SEQ ID No.4 is mutated with S148K based on SEQ ID No.3, and the spatial distance theoretically becomes ( Figure 2 ).

[0062] (2) Primer design

[0063] Four pairs of mutation primers were designed, one pair was used to construct the nucleotide sequence of the T189V / V207M double mutant 7β-HSDH-2M enzyme from the nucleotide sequence of the wild-type 7β-HSDH enzyme; the other three pairs were used to construct the nucleotide sequence of the S148K / T189V / V207M triple mutant 7β-HSDH-3M enzyme from the nucleotide sequence of the T189V / V207M double mutant 7β-HSDH-2M enzyme, the nucleotide sequence of the S148K / A203QV207M triple mutant 7β-HSDH-3M1 enzyme from the nucleotide sequence of the T189V / V207M double mutant 7β-HSDH-2M enzyme, and the nucleotide sequence of the S148K / V207M / T210A triple mutant 7β-HSDH-3M2 enzyme from the nucleotide sequence of the T189V / V207M double mutant 7β-HSDH-2M enzyme.

[0064] V207M-F:

[0065] GCAATCTGCCGGGCGGCCCGGCTGGTGAAGCAATGATGAAAACCGCCAT GACCC (SEQ ID NO. 6);

[0066] T189V-R:

[0067] GGCCGCCCGGCAGATTGCTCAGCAGGCTCGGGGTAATCACGGTGCCCAG GGTAAT(SEQ IDNO.7);

[0068] S148K-F: ACCGCAATTAAAAGCAGCCCGTATAATGCAC (SEQ ID NO. 8); S148K-R: ATACGGGCTGCTTTTTAATTGCGGTCAGACTACTAACAT (SEQ ID NO. 9);

[0069] A203Q-F: CGGCCCGCAGGGTGAAGCAATGATGAA (SEQ ID NO.10)

[0070] A203Q-R:TTCACCCTGCGGGCCGCCCGG(SEQ ID NO.11)

[0071] T210A-F: ATGAAAGCCGCCATGACCCCGGAA (SEQ ID NO.12)

[0072] T210A-R: GGTCATGGCGGCTTTCATCATTGCTTCACC (SEQ ID NO.13)

[0073] (3) Construction of mutant plasmid pET28a-7βHSDH-2M

[0074] The whole plasmid PCR was performed using the recombinant plasmid pET28a-7βHSDH-WT containing SEQ ID No.2 as a template to obtain the corresponding mutant plasmid pET28a-7βHSDH-2M containing SEQ ID No.3. After gel recovery, the mutant gene was linearized and incubated in an ice bath with T5Exonuclease for 5 minutes. The pET28a plasmid containing the mutant gene was transformed into E.coli TOP10 competent cells. The transformed E.coli TOP10 was evenly spread on an LB agar plate containing 50 μg / ml kanamycin, placed at 37°C for overnight inversion culture, and the linearized plasmid was recircularized with the help of the E. coli plasmid repair mechanism. Then, a single colony was picked and cultured in LB containing 50 μg / ml kanamycin. The plasmid was extracted and sent to Wuhan Jinkairui Bioengineering Co., Ltd. for sequencing. The plasmid whose sequencing results met the requirements was named pET28a-7βHSDH-2M, and the double mutant 7βHSDH sequence contained was SEQ ID No. 3, the corresponding expressed 7β-hydroxysteroid dehydrogenase is named as 7βHSDH-2M mutant enzyme.

[0075] (4) Construction of mutant plasmids pET28a-7βHSDH-3M, pET28a-7βHSDH-3M1, and pET28a-7βHSDH-3M2

[0076] The whole plasmid PCR was performed using the plasmid pET28a-7βHSDH-2M as a template to obtain the corresponding linearized plasmid pET28a-7βHSDH-3M containing the mutant of SEQ ID No. 4. The above operation was repeated to obtain the plasmid pET28a-7βHSDH-3M containing the mutant of SEQ ID No. 4. The corresponding expressed 7β-hydroxysteroid dehydrogenase was named 7βHSDH-3M mutant enzyme.

[0077] The mutant plasmids pET28a-7βHSDH-3M1 and pET28a-7βHSDH-3M2 were constructed in the same way and named as 7βHSDH-3M1 mutant enzyme and 7βHSDH-3M2 mutant enzyme, respectively.

[0078] (5) Protein expression of mutant enzymes

[0079] The constructed plasmid was transformed into E.coli BL21 (DE3) competent cells and evenly spread on LB agar plates containing 50μg / ml kanamycin, placed in a 37℃ incubator for static culture for about 12h, single colonies were picked and cultured in LB containing 50μg / ml kanamycin, and then transferred to LB containing 50μg / ml kanamycin for culture and expansion. When OD600 was about 0.8, IPTG with a final concentration of 0.8mM was added for induction at 18℃ for 18h at a speed of 220rpm. After induction, the cells were collected by centrifugation, and a small amount of cells were taken for ultrasonic disruption to prepare protein samples. The SDS-PAGE graph showed that the expression and solubility of the three proteins were good ( Figure 3 ).

[0080] Example 2: 7β-HSDH enzyme thermal stability test

[0081] The expression cells of 7β-HSDH-WT, 7β-HSDH-2M, 7β-HSDH-3M, 7βHSDH-3M1 and 7βHSDH-3M2 were weighed respectively, resuspended with an appropriate amount of 50mM phosphate buffer (pH 8.0), ultrasonically disrupted and centrifuged at 12000rpm for 30min, and the centrifugal supernatant was taken to obtain a crude enzyme solution sample. The crude enzyme solution samples to be tested were incubated in a 50℃ water bath for 0, 0.5, 1, 2h, and 4h, respectively. After the incubation was completed, the enzyme solution was quickly cooled to 25℃ and the enzyme activity was detected.

[0082] 2.7 mL of 50 mM phosphate buffer (pH 8.0) warmed at 25°C, 0.2 mL of 7-ketolithocholic acid (7-KLCA) (2 mg / mL) (dissolved in buffer), and 0.05 mL of 7β-HSDH crude enzyme solution sample diluted a certain multiple of 50 mM phosphate buffer (pH 8.0) were mixed in a cuvette, placed in a UV spectrophotometer, and the absorbance value was returned to zero.

[0083] Take 0.05 ml NADPH (50 mg / mL) and add it to the cuvette, mix well and start timing for 2 minutes, read the absorption change value at a wavelength of 340 nm within 2 minutes, and calculate △OD / min.

[0084] Blank control: The operation process is the same as above, but the enzyme in the reaction system is replaced by an equal amount of Tris / HCl buffer, and the measured result is the negative control.

[0085] Enzyme activity unit definition:

[0086] Enzyme activity (U / mL) = △OD / min*Vt*df / (6.22*1.0*Vs)

[0087] Where Vt: total reaction volume 3.05mL; df: dilution factor;

[0088] 6.22: extinction coefficient of NADPH at 340nm wavelength; 1.0: measurement path length;

[0089] Vs: 7β-HSDH enzyme solution volume (0.05mL)

[0090] The enzyme activities of each enzyme after incubation in a 50°C water bath were measured using the above method and are shown in the following table:

[0091]

[0092] It can be seen that the activity of the 7β-HSDH-3M mutant enzyme retained 91.5% of the original after incubation at 50°C for 4 hours, while that of the 7β-HSDH-2M mutant enzyme was 15.6% and that of the 7β-HSDH-WT wild-type enzyme was only 8.8%. The stability of the 7β-HSDH-3M mutant enzyme after incubation at 50°C for 4 hours was 9.4 times that of the wild-type and 4.9 times that of the 7β-HSDH-2M mutant enzyme. The site-directed mutation of the 7β-HSDH-3M1 mutant enzyme based on the 7β-HSDH-2M mutant enzyme did not cause significant changes in activity and stability, while the activity and stability of the 7β-HSDH-3M2 mutant enzyme based on the 7β-HSDH-2M mutant enzyme were significantly decreased. Therefore, among the three triple-site mutants, the 7β-HSDH-3M mutant enzyme had the best mutation effect, and its thermal stability at 50°C was significantly improved.

[0093] Example 3: 7β-HSDH combined with SYGDH catalyzes 7-KLCA to produce UDCA

[0094] 2 g of 7β-HSDH bacterial sludge and 1 g of SYGDH bacterial sludge (glucose dehydrogenase expressing bacteria, E. coli BL21 (DE3)) were weighed and resuspended in 40 mL of 100 mmol / L potassium phosphate buffer (pH 8.0), and ultrasonically disrupted to prepare a crude enzyme solution.

[0095] Weigh 10g of crude 7-KLCA, 11.2g of glucose, 30mg of NADP+, and 20ml of n-hexanol, dilute to 125ml with 100mmol / L potassium phosphate buffer (pH 8.0), react at 35°C and 220rpm for 8h, control pH (7.9 to 8.1) during the reaction, and the conversion rate of catalyzed 7-KLCA (80g / L) after 4h of liquid phase detection is 99.21%, while the conversion rate of the original double mutant 7β-HSDH-2M mutant enzyme (SEQ ID NO.3) after 6h of reaction is only 95.71%. The HPLC chromatogram of substrate 7-KLCA (80g / L) is shown in Figure 1. Figure 4The HPLC chromatogram of the mutant 7β-HSDH-3M (SEQ ID NO.4) and glucose dehydrogenase (SEQ ID NO.5) used in combination to transform 7-KLCA (80 g / L) is shown in Figure 5 shown.

[0096] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A 7β-hydroxysteroid dehydrogenase mutant, characterized in that: The amino acid sequence of the 7β-hydroxysteroid dehydrogenase mutant is shown in SEQ ID NO.

4.

2. The 7β-hydroxysteroid dehydrogenase mutant according to claim 1, characterized in that The 7β-hydroxysteroid dehydrogenase mutant is obtained by mutating the threonine at position 189 to valine, the valine at position 207 to methionine, and the serine at position 148 to lysine in the amino acid sequence SEQ ID NO.2 of the wild-type 7β-hydroxysteroid dehydrogenase.

3. The 7β-hydroxysteroid dehydrogenase mutant according to claim 1, characterized in that The 7β-hydroxysteroid dehydrogenase mutant is obtained by mutating the serine at position 148 in the amino acid sequence SEQ ID NO. 3 of the 7β-hydroxysteroid dehydrogenase T189V / V207M double mutant to lysine.

4. A coding gene, characterized in that The coding gene encodes the 7β-hydroxysteroid dehydrogenase mutant according to any one of claims 1 to 3.

5. A recombinant expression plasmid, characterized in that: Comprising the coding gene according to claim 4.

6. A recombinant expression transformant, characterized in that: Comprising the coding gene according to claim 5 or the recombinant expression plasmid according to claim 3.

7. Use of the 7β-hydroxysteroid dehydrogenase mutant according to any one of claims 1 to 3 in the preparation of UDCA, characterized in that: The 7β-hydroxysteroid dehydrogenase mutant and glucose dehydrogenase are coupled to achieve the cyclic regeneration of the coenzyme NADPH.

Images