Nucleic acid molecule, virus particle and preparation method and application thereof

Abstract

The invention relates to the field of bioengineering, in particular to a nucleic acid molecule, a virus particle and a preparation method and application thereof. The invention provides nucleic acid molecules which comprise one or more of nucleic acid molecules 1-nucleic acid molecules 4. The length of the recombinant promoter provided by the invention is about 260 bp, so that the recombinant promoter is suitable for the requirement of expressing a relatively large exogenous gene in an AAV vector, and is relatively wide in application range. Meanwhile, the recombinant promoters have different degrees of expression intensities in PR cells, and are also applicable to some scenes with higher requirements on the expression quantity of target genes.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering, and in particular to nucleic acid molecules, virus particles, and preparation methods and applications thereof. Background Art

[0002] Photoreceptor cells are a special type of neuroepithelial cells with phototransduction capabilities. Photoreceptor cells can absorb photons from the visual field, and then transmit this information in the form of changes in membrane potential through a series of special and complex biochemical pathways. Finally, the visual system processes these signal information to present a complete visual world. When there is a problem with the photoreceptor cells, such as abnormal development of rod cells resulting in fewer rods than normal people, or lack of vitamin A and inability to synthesize rhodopsin normally, the corresponding dark adaptation will decrease, and the amplitude of the ERG a wave will decrease, which will make it difficult for people to see objects in the dark. Although the rod cells can rely on cone cells to re-establish connections with the synapses of horizontal cells and bipolar cells to transmit signals to the nerves after they are damaged, the amplitude of the ERG a wave of the dark vision curve is reduced compared to when the rod cells are normal, so it is also difficult to see objects clearly in low light.

[0003] At present, many hereditary ophthalmic diseases have been reported, most of which are related to different gene mutations related to retinal pathology. Once these genes cannot be expressed correctly, they will lead to progressive cell death and blindness. Therefore, gene therapy is a promising treatment method to introduce exogenous normal genes into target cells to correct or compensate for diseases caused by gene defects and abnormalities.

[0004] Specific promoters often drive gene expression only in specific tissue cells, which can avoid the side effects caused by the continuous expression of exogenous genes in non-specific tissue cells in experimental animals, and can also enhance the expression effect of exogenous genes in specific cells. For gene therapy, the use of specific promoters in conjunction with tissue-specific AAV serotypes can greatly improve the specificity of treatment, avoid effects on other organs, and reduce side effects.

[0005] AAV has attracted much attention for its safety, but due to its very small vector capacity, when carrying large functional proteins, such as Cas9 protein, it is often easy to exceed its vector capacity, resulting in a significant drop in viral titer or truncation of the genome sequence. Therefore, obtaining a promoter with a relatively small length but retaining the ability to express downstream genes in specific tissues or cell types can solve this problem to a certain extent, which can not only ensure the specific expression of the target gene, but also ensure that the vector length does not exceed the capacity limit of the AAV genome. Summary of the invention

[0006] In view of this, the present invention provides nucleic acid molecules, virus particles, and preparation methods and applications thereof. The length of the recombinant promoter provided by the present invention is about 260 bp, which is suitable for expressing larger exogenous genes in AAV vectors and has a wide range of applications. At the same time, the expression intensity of the recombinant promoter in PR cells is very high, and it is also applicable in certain scenarios where the expression amount of the target gene is required to be high.

[0007] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0008] The present invention provides a nucleic acid molecule, comprising: one or more of nucleic acid molecules 1 to 4;

[0009] The nucleic acid molecule 1 comprises at least one of (1) to (4):

[0010] (1) A nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 1;

[0011] (2) A nucleic acid in which one or more nucleotides are replaced, deleted or added in the fragment described in (1);

[0012] (3) a nucleotide sequence that is at least 70% identical to the nucleotide sequence of (1) or (2); preferably, the sequence identity is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%;

[0013] (4) a nucleic acid that is partially complementary or completely complementary to any one of (1), (2) or (3); and / or

[0014] The nucleic acid molecule 2 comprises at least one of (5) to (8):

[0015] (5) A nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 2;

[0016] (6) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (5);

[0017] (7) a nucleotide sequence that is at least 70% identical to the nucleotide sequence of (5) or (6); preferably, the sequence identity is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%;

[0018] (8) a nucleic acid that is partially complementary or completely complementary to any one of (5), (6) or (7); and / or

[0019] The nucleic acid molecule 3 comprises at least one of (9) to (12):

[0020] (9) A nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 3;

[0021] (10) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (9);

[0022] (11) a nucleotide sequence that is at least 70% identical to the nucleotide sequence of (9) or (10); preferably, the sequence identity is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%;

[0023] (12) a nucleic acid that is partially complementary or completely complementary to any one of (9), (10) or (11); and / or

[0024] The nucleic acid molecule 4 comprises at least one of (13) to (16):

[0025] (13) A nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 4;

[0026] (14) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (13);

[0027] (15) a nucleotide sequence that is at least 70% identical to the nucleotide sequence shown in (13) or (14); preferably, the sequence identity is at least 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%;

[0028] (16) A nucleic acid that is partially complementary or completely complementary to any one of (13), (14) or (15).

[0029] In some embodiments of the invention, the sequence of SEQ ID NO: 1 is: TCTCTGTTCCCTTCCCTGGGCTTTCATTGGGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGAAAAGTGAGGCGGCCCCTTGGCCCTAGCTCTGGCCTACCTCCTCAGGGAAAAGTGAGGCGGCCCTGCTGGACCCCCACTTCATAGGGCAATTCGTCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCATTCTGCCC (RCB8 promoter (289 bp)).

[0030] In some embodiments of the invention, the sequence of SEQ ID NO: 2 is: TCTCTATTGCTGGTCCCCCCTGGGATTTCATTGGCCCAGAAGCCTGGTGGAGATTCTCGTGAAAAGTGAGGCGGCCCCTTGGCCCTAGCTCTGGCCTACCTCCTCAGGGAAAAGTGAGGCGGCCCTGCTGGACCCCCACTTCATAGGGCAATTCGTCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGTTGACCTGACAGTGGCAAGAAGGTTTTGACGGCGACAATCCCCTGAGCTGCTTGGAATCCGATTAGAATGAGGCTGCCC (RCB8V1 promoter (286 bp)).

[0031] In some embodiments of the invention, the sequence of SEQ ID NO: 3 is: TGGACGTTCCCTGTAAGCTGGGTTGGAATTGGGTGGCGGCAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGAAAAGTGAGGCGGCCCCTTGGCCCTAGCTCTGGCCTACCTCCTCAGGGAAAAGTGAGGCGGCCCTGACCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGACAATCCCCTGAACGCCTTAGGACGAATCCGATTAGATCTA (RCB8V2 promoter (262 bp)).

[0032] In some embodiments of the invention, the sequence of SEQ ID NO: 4 is: GAAGGGAACAGAGACCTGGGCTTTCATTGGGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGGCCGCCTCACTTTTCCCTTGGATGAGGCGGAAAAGTGAGGCGGCCCTGCTGGACCCCCACTTCATAGGGCAATTCGTCCGGGGCTGACACAGCACCAGGCTAAATCCCAGCCGGGGTCACGGAGGACGCTTAGGAGTGGCAAGAAGGTGCTAGAAAAAGAGTCCAGTC (RCB8V3 promoter (236 bp)).

[0033] In some embodiments of the present invention, the sequence of SEQ ID NO: 5 is: TAGAAAAAGACAATCCCCTGAGCTGCTTGAGGGCTAACAGAAGATCAAGTCCCATTTTAGCCTCCCTAGCTCTGGCCTACCTCCTCAGTTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTAGATCCCTGGCTCATCTCTCAGGATGCCTATCTTGTCCTTAGCACGATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGGCTAGAAAAAGACAATCCCCGCCTGGCCCGGATCACTTATCCGTTGCCTTTGTGTATTTGGAGGCTGGGAGGCCAGCTGCCCCAGAAGCCTGGTGGTTGTTTGTCCTTCTCAGGGGATGCTAGAAAAAGACAATCCCCTGAGCTGCTTGGAATCCGATTA (comparative example promoter (373 bp)).

[0034] In some embodiments of the present invention, the term "nucleic acid" is a polymer composed of individual nucleotides, i.e., a polynucleotide. It refers to a naturally occurring, or partially or completely non-naturally occurring nucleic acid, which, for example, encodes a polypeptide that can be recombinantly produced. The nucleic acid can be composed of DNA fragments separated or synthesized by chemical means. The nucleic acid can be integrated into another nucleic acid, for example, into an expression plasmid or the genome / chromosome of a host cell. Plasmids include shuttle and expression vectors. Typically, the plasmid will also include a prokaryotic proliferation unit, which includes a replication initiation region (e.g., a replication initiation region of ColE1) and a selective marker (e.g., a penicillin or tetracycline resistance gene) for vector replication and selection in bacteria, respectively.

[0035] The present invention also provides the use of the nucleic acid molecule as a promoter.

[0036] In some embodiments of the invention, the term "promoter" refers to a nucleic acid, i.e., a polynucleotide sequence, which controls the transcription of an operably linked nucleic acid. A promoter may include signals for RNA polymerase binding and transcription initiation. The one or more promoters used will be functional in the cell type of the host cell in which expression of the operably linked nucleic acid is involved. A large number of promoters, including constitutive, inducible, and repressible promoters from a variety of different sources are well known in the art (and identified in databases such as GenBank).

[0037] The present invention also provides an expression cassette, comprising: the above nucleic acid molecule.

[0038] In some embodiments of the present invention, the term "expression cassette" refers to a nucleic acid that contains at least the elements required for expression and secretion of a structural gene contained in a host cell. A nucleic acid is also characterized by its sequence consisting of a single nucleotide, or an amino acid sequence encoded by a nucleic acid molecule.

[0039] The present invention also provides an expression vector, comprising: the above nucleic acid molecule and / or the above expression box and a target gene.

[0040] In some embodiments of the present invention, the above-mentioned expression vector further comprises: a fluorescent protein.

[0041] In some embodiments of the present invention, in the above expression vector, the fluorescent protein includes: nuclear-importing red fluorescent protein.

[0042] The present invention also provides virus particles for transforming and / or transfecting the above expression vector.

[0043] In some embodiments of the present invention, the AAV (adeno-associated virus) three-plasmid packaging system is a commonly used gene transfer tool, mainly used to transfer genes in cells and animal models, study gene function or develop gene therapy programs. The AAV three-plasmid packaging system usually includes the following three plasmids:

[0044] Transfer plasmid: contains the target gene sequence (i.e. the gene you want to transfer into the cell) and the inverted terminal repeats (ITRs) of AAV. ITRs are the sequences at both ends of the AAV genome and are responsible for packaging and integration. AAV does not have its own replication protein, so the presence of ITRs allows the target gene to be recognized and embedded in the virus particles during virus packaging.

[0045] Packaging plasmid: Contains the main structural protein genes of AAV virus, such as Rep and Cap. Rep protein is the replication protein of AAV, responsible for the replication and packaging of AAV genome; Cap protein is the capsid protein of AAV, used for the assembly of virus particles. The expression of these genes allows cells to produce the necessary proteins to assemble and package virus particles, but they are not included in the final packaged AAV genome.

[0046] Helper plasmid: contains certain key genes of adenovirus, such as E1A, E1B, E2A, E4 and VA genes, which provide additional auxiliary factors to help AAV replication and packaging. These genes come from adenovirus, but do not lead to the generation of complete adenovirus, but only to support the AAV production process.

[0047] The present invention also provides a method for preparing the above-mentioned virus particles, which comprises taking the expression vector for virus packaging, collecting the virus, purifying the virus, and obtaining the virus particles.

[0048] In some embodiments of the present invention, when the above three plasmids are co-transfected into packaging cells (such as HEK293 cells), each expresses the corresponding protein and gene elements to achieve the packaging of AAV virus. The target gene on the vector plasmid forms a complete AAV genome with the help of ITRs, and the cap and rep genes in the packaging plasmid express the corresponding AAV proteins. The rep protein is responsible for replicating the AAV genome, while the cap protein forms the capsid of AAV. The adenovirus auxiliary gene in the auxiliary plasmid provides the support required for packaging, thereby enhancing the replication and packaging efficiency of AAV.

[0049] In this system, the AAV genome is encapsidated in a capsid formed by the cap protein to form the complete AAV particle.

[0050] The final AAV particles contain only the sequence of the target gene, without other genes in the packaging plasmid and auxiliary plasmid, so AAV particles have high safety and stability. These AAV particles can infect target cells and transfer the target gene, but because AAV is a replication-deficient virus, it usually does not cause pathogenicity.

[0051] The present invention also provides the use of the above nucleic acid molecule, the above expression cassette, the above expression vector, the above virus particle and / or the virus particle obtained by the above preparation method in preparing a product of cells specifically expressing retinal structures.

[0052] In some embodiments of the present invention, in the above application, the retinal structure includes: photoreceptors.

[0053] The present invention also provides the use of the above nucleic acid molecule, the above expression cassette, the above expression vector, the above virus particle and / or the virus particle obtained by the above preparation method in preparing products for treating and / or preventing retinal diseases.

[0054] The present invention also provides a product, comprising: the above nucleic acid molecule, the above expression cassette, the above expression vector, the above virus particle and / or the virus particle obtained by the above preparation method.

[0055] The length of the recombinant promoter provided by the present invention is about 260 bp, which is suitable for expressing large exogenous genes in AAV vectors and has a wide range of applications. In addition, the recombinant promoter provided by the present invention has a very high expression intensity in PR cells and is also applicable in certain scenarios where the expression amount of the target gene is required to be high. BRIEF DESCRIPTION OF THE DRAWINGS

[0056] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art are briefly introduced below.

[0057] Figure 1 The schematic diagram of the expression vector structure used for virus packaging is shown, which is mainly composed of an upstream promoter and a downstream red fluorescent protein gene;

[0058] Figure 2 The first picture on the left is a red fluorescence picture taken at 40x magnification and 1000ms exposure time, the second picture is a merged picture of two pictures taken after red fluorescence and immunofluorescence staining (the exposure time of each channel was adjusted); the third picture is a merged picture of three pictures taken after red fluorescence, immunofluorescence staining and DAPI staining (the exposure time of each channel was adjusted);

[0059] Figure 3 The figure shows a bar graph obtained by plotting the semi-quantitative data of the fluorescence brightness of the slices;

[0060] Figure 4 The eye sections corresponding to the RCB8 promoter mutants RCB8V1, RCB8V2 and RCB8V3 are shown; the first one on the left is a red fluorescence photo taken at 100x magnification and 500ms exposure time, and the second one is a merged image of the two photos taken after red fluorescence and DAPI staining (the exposure time of each channel was adjusted). DETAILED DESCRIPTION

[0061] The invention discloses nucleic acid molecules, virus particles and preparation methods and applications thereof.

[0062] It should be understood that the expression "one or more of..." includes each of the items recited after the expression individually and in various different combinations of two or more of the recited items, unless otherwise understood from the context and usage. The expression "and / or" in combination with three or more recited items should be understood to have the same meaning, unless otherwise understood from the context.

[0063] The use of the terms "comprising", "having" or "containing", including their grammatical synonyms, should generally be understood as open and non-restrictive, for example not excluding other unrecited elements or steps, unless otherwise specifically stated or otherwise understood from the context.

[0064] It should be understood that the order of steps or the order in which certain actions are performed is not important as long as the present invention remains operable. In addition, two or more steps or actions may be performed simultaneously.

[0065] The use of any and all examples or exemplary language, such as "for example" or "including", herein is intended only to better illustrate the invention and does not limit the scope of the invention unless otherwise claimed. No language in this specification should be construed as indicating that any non-claimed element is essential to the practice of the invention.

[0066] In addition, the numerical ranges and parameters used to define the present invention are approximate values, and the relevant values ​​in the specific embodiments have been presented as accurately as possible. However, any numerical value inherently inevitably contains standard deviations due to individual test methods. Therefore, unless otherwise expressly stated, it should be understood that all ranges, quantities, values ​​and percentages used in this disclosure are modified by "about". Here, "about" generally means that the actual value is within plus or minus 10%, 5%, 1% or 0.5% of a specific value or range.

[0067] In Examples 1 and 2 of the present invention, all the raw materials and reagents used can be purchased from the market.

[0068] The present invention will be further described below in conjunction with embodiments:

[0069] Example 1 Expression vector construction and promoter activity verification

[0070] 1. The RCB8 promoter sequence was obtained by artificial recombination, based on the VB900129-0788gfe vector (built in-house, see https: / / en.vectorbuilder.com / vector / VB900129-0788gfe.html, such as Figure 1 The CAG promoter was replaced with RCB8 and the comparative promoter (as shown in SEQ ID NO: 5) by conventional restriction enzyme ligation methods, and an expression vector with RCB8 and the comparative promoter in the upstream and NLS-mCherry gene in the downstream was constructed. The vector framework is as shown in Figure 1 shown.

[0071] 2. According to the conventional virus packaging method, the expression vectors containing the RCB8 and control promoters were mixed with the other two auxiliary vector plasmids of AAV packaging (carrying Rep\Capsid gene and E2\E4\VA gene, respectively) and transfected into 293T cells for virus packaging. After the virus was harvested, it was purified by cesium chloride to finally obtain virus particles (AAV8 type) for animal in vivo verification experiments.

[0072] 3. The virus was injected into the subretinal cavity of mice (C57BL / 6J, 6-8 weeks old, purchased from Guangdong Medical Experimental Animal Center) at a virus injection dose of 1E+10GC / eye. Two weeks after the injection, the samples were sliced ​​and immunofluorescently stained: The primary antibody used in the immunofluorescence process was a rabbit anti-mouse polyclonal anti-Arrestin C antibody (purchased from Sigma-Aldrich, catalog number AB15282), which can specifically bind to the cone cell surface protein in the photoreceptor cell (PR) layer, thereby marking the photoreceptor cell layer where the cone cells are located. The secondary antibody used was a goat anti-rabbit IgG with green fluorescence (purchased from Thermofisher, catalog number A-11008). At the same time, DAPI was used to stain the nuclei of cells in each layer, and the image was blue.

[0073] 4. Take photos of the slices and finally obtain the expression slice diagrams of RCB8 and the control promoter, such as Figure 2 As shown; Slice result description: Shows photos taken at 40x magnification and 1000ms exposure time. Each result has three pictures from left to right. The first picture on the left is a film taken at 1000ms exposure time, which is mainly used to observe the expression of red fluorescence alone; the second picture is a merged picture of two pictures taken after cell expression of fluorescence and immunofluorescence staining (the exposure time of each channel has been adjusted); the third picture is a merged picture of three pictures taken after cell expression of fluorescence, immunofluorescence staining, and DAPI staining (the exposure time of each channel has been adjusted).

[0074] Combining the slice results of each recombinant promoter, after virus injection, the RCB8 recombinant promoter only expressed red fluorescence in the photoreceptor cell layer under the mouse retina, and no fluorescence expression was observed in other cell layers, indicating its high expression specificity.

[0075] 5. Use Image J software to semi-quantitate the brightness of each group of slices and draw a graph as shown in the figure. Figure 3 As shown in the figure above, the brightness trend of the red fluorescent protein expressed by the RCB8 promoter is consistent with the corresponding slice results. As shown in Table 1, the expression intensity of the RCB8 promoter is significantly better than that of the comparative promoter, and both show very strong PR cell expression specificity. Based on all the slice results, the RCB8 promoter shows stronger expression activity than the earlier comparative promoter, and the promoter has high expression specificity, and different recombinant promoters can be selected according to different application requirements.

[0076] Table 1

[0077]

[0078] Example 2 Functional variants of the RCB8 promoter

[0079] After confirming the expression specificity of the RCB8 promoter, random mutation and deletion substitution were performed on the RCB8 promoter to construct RCB8 promoter variant sequences RCB8V1, RCB8V2 and RCB8V3 for experiments. The sequence identities of RCB8 and its variants are shown in Table 2:

[0080] Table 2

[0081]

[0082] According to the method of Example 1, the upstream promoters were variant promoters RCB8V1, RCB8V2 and RCB8V3, and the downstream was an expression vector of the nuclear red fluorescent protein (NLS-mCherry) gene, and the virus was packaged and purified. The promoter activity was verified in mice, and finally the expression section diagram of the promoter was obtained, as shown in FIG. Figure 4 shown.

[0083] Slice image result description: It shows photos taken at 100x magnification and 500ms exposure time. Each result has two pictures from left to right. The first picture on the left is a film taken at the annotated exposure time (500ms), which is mainly used to observe the expression of red fluorescence alone; the second picture is a merged picture of two pictures taken after cells express red fluorescence and DAPI staining (the exposure time of each channel has been adjusted).

[0084] It can be seen from the slice results that variant promoters with a certain homology can all continue to drive expression in photoreceptor cells. Although the ability of individual variants to drive expression is weaker than that of the promoter before mutation, they all retain their basic expression specificity and expression ability.

[0085] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A nucleic acid molecule, characterized in that include: One or more of nucleic acid molecules 1 to 4; The nucleic acid molecule 1 comprises at least one of (1) to (4): (1) A nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 1; (2) A nucleic acid in which one or more nucleotides are replaced, deleted or added in the fragment described in (1); (3) a nucleotide sequence that is at least 70% identical to the nucleotide sequence shown in (1) or (2); (4) a nucleic acid that is partially complementary or completely complementary to any one of (1), (2) or (3); and / or The nucleic acid molecule 2 comprises at least one of (5) to (8): (5) A nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 2; (6) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (5); (7) a nucleotide sequence that is at least 70% identical to the nucleotide sequence shown in (5) or (6); (8) a nucleic acid that is partially complementary or completely complementary to any one of (5), (6) or (7); and / or The nucleic acid molecule 3 comprises at least one of (9) to (12): (9) A nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 3; (10) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (9); (11) a nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (9) or (10); (12) a nucleic acid that is partially complementary or completely complementary to any one of (9), (10) or (11); and / or The nucleic acid molecule 4 comprises at least one of (13) to (16): (13) A nucleic acid having a nucleotide sequence as shown in SEQ ID NO: 4; (14) A nucleic acid in which one or more nucleotides are substituted, deleted or added in the fragment described in (13); (15) a nucleotide sequence having at least 70% identity with the nucleotide sequence shown in (13) or (14); (16) A nucleic acid that is partially complementary or completely complementary to any one of (13), (14) or (15).

2. Use of the nucleic acid molecule as claimed in claim 1 as a promoter.

3. An expression cassette, characterized in that include: The nucleic acid molecule according to claim 1.

4. An expression vector, characterized in that include: The nucleic acid molecule according to claim 1 and / or the expression cassette and target gene according to claim 3.

5. A virus particle, characterized in that Transformation and / or transfection with the expression vector according to claim 4.

6. The method for preparing virus particles according to claim 5, characterized in that: The expression vector is taken for virus packaging, and then the virus is collected and purified to obtain the virus particles.

7. Use of the nucleic acid molecule according to claim 1, the expression cassette according to claim 3, the expression vector according to claim 4, the viral particle according to claim 5 and / or the viral particle obtained by the preparation method according to claim 6 in the preparation of a product specifically expressing cells of retinal structures.

8. The use according to claim 7, characterized in that The retinal structure includes: photoreceptors.

9. Use of the nucleic acid molecule according to claim 1, the expression cassette according to claim 3, the expression vector according to claim 4, the virus particle according to claim 5 and / or the virus particle obtained by the preparation method according to claim 6 in the preparation of a product for treating and / or preventing retinal diseases.

10. A product, characterized in that include: The nucleic acid molecule according to claim 1, the expression cassette according to claim 3, the expression vector according to claim 4, the virus particle according to claim 5 and / or the virus particle obtained by the preparation method according to claim 6.

Images