Rebuilt tobacco mosaic virus replicon for transient high-efficiency expression of exogenous gene and application of rebuilt tobacco mosaic virus replicon

Abstract

The invention discloses a reconstructed tobacco mosaic virus replicon for transient high-efficiency expression of exogenous genes and application of the reconstructed tobacco mosaic virus replicon. According to the invention, the expression mode of MP in a TMV virus genome is optimized, so that the MP is separated from the regulation and limitation of an original virus genome, and the expression vector of pAT-transMP is established by complementally expressing MP at the downstream of the TMV virus genome in the same T-DNA region. Experiments prove that the expression vector established by the invention obviously enhances the accumulation amount of transient expression of the foreign protein in tobacco. Furthermore, the action effect of transMP expression on plant virus expression vectors except for TMV is detected, and it is found that the motion protein with 78% or above of identity with TMV-MP has the similar synergistic effect with TMV-MP. In addition, the invention also discovers that the transMP expression mode also has an obvious synergistic effect on the foreign protein expression quantity of the plant binary expression vector.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a reconstructed tobacco mosaic virus replicon for transiently and efficiently expressing foreign genes and an application thereof. Background Art

[0002] In plant biotechnology, plant viral vectors often use the efficient replication and transcriptional regulation mechanism of viruses in plants to express the desired target molecules / proteins. Due to the advantages of being fast, efficient, and low-cost, they are expected to be widely used in the production of exogenous proteins in plants, such as medical proteins, metabolic-related products, subunit vaccines, etc. In addition, the use of viral vectors to transiently express or knock out target genes can effectively overcome the shortcomings of traditional lethal genes and plant regeneration difficulties and time-consuming, and also provide a favorable tool for the early trait screening of molecular breeding. However, in the application process of plant viral expression vectors, it was found that virus-derived expression vectors often have a bottleneck of low expression, which seriously limits their application in large-scale production. In order to overcome the above shortcomings and adapt to the large-scale production needs of medical proteins, a variety of strategies for optimizing viral vectors have emerged one after another, such as the development of new plant viral expression vectors and the recombination and replacement of different viral sequences.

[0003] With the in-depth analysis of viral genomes, more and more infectious clones of viruses and their derived vectors have been gradually developed, such as Cowpea mosaic virus (CPMV), Beet yellows virus (BYV), Bamboo mosaic virus (BaMV), Zucchini yellow mosaic virus among (+)ssRNA viruses; Bean yellow dwarf virus (BeYDV) among ssDNA geminiviruses; Strawberry vein banding virus (SVBV) among dsDNA cauliflower virus Caulimoviruses, and (-)ssRNA virus Sonchus yellow netrhabdovirus (SYNV), etc. The diversity of these viral infectious clones and / or expression vectors will provide rich vector resources for the industrial production of plant-derived target proteins.

[0004] The optimization and modification of viral vectors rely on the understanding of the viral genome structure and the function of viral encoded proteins, as well as the in-depth analysis of the interaction mechanism between viruses and host plants. Therefore, the most widely used viral expression vectors are still mainly Tobacco mosaic virus (TMV) and Potato virus X (PVX) derived vectors, which have relatively in-depth basic research. Although various optimizations have been made to TMV and PVX, such as the use of different 3'UTRs and subgenomic promoters, the defects of the above-mentioned viral vectors, namely the difficulty in meeting the expression level required for large-scale production, still need to be overcome. Summary of the invention

[0005] The technical problem to be solved by the present invention is how to increase the expression level of foreign proteins in plants.

[0006] In a first aspect, the present invention provides a vector for expressing foreign proteins.

[0007] The vector for foreign protein expression provided by the present invention is a vector obtained by connecting the coding gene or expression cassette of the motor protein MP to a plant expression vector, and in the plant expression vector, the coding gene of the motor protein MP and the coding gene of the foreign protein are separately driven to express by their respective promoters;

[0008] The motor protein MP is any one of the following (a1)-(a3):

[0009] (a1) the protein shown in SEQ ID No.5, SEQ ID No.9 or SEQ ID No.11;

[0010] (a2) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No.5 or SEQ ID No.9 or SEQ ID No.11;

[0011] (a3) A protein having 78% or more identity with SEQ ID No. 5, SEQ ID No. 9 or SEQ ID No. 11 and having the same function.

[0012] In the protein described in (a2) above, the substitution and / or deletion and / or addition of one or several amino acid residues is substitution and / or deletion and / or addition of no more than 10 amino acid residues, or substitution and / or deletion and / or addition of no more than 9 amino acid residues, or substitution and / or deletion and / or addition of no more than 8 amino acid residues, or substitution and / or deletion and / or addition of no more than 7 amino acid residues, or substitution and / or deletion and / or addition of no more than 6 amino acid residues, or substitution and / or deletion and / or addition of no more than 5 amino acid residues, or substitution and / or deletion and / or addition of no more than 4 amino acid residues, or substitution and / or deletion and / or addition of no more than 3 amino acid residues, or substitution and / or deletion and / or addition of no more than 2 amino acid residues, or substitution and / or deletion and / or addition of no more than 1 amino acid residue.

[0013] In the protein described in (a3) ​​above, the identity refers to the identity of the amino acid sequence. The identity of the amino acid sequence can be determined using an identity search site on the Internet, such as the BLAST page on the NCBI homepage website. For example, in Advanced BLAST 2.1, by using blastp as a program, setting the Expect value to 10, setting all filters to OFF, using BLOSUM62 as a matrix, setting the Gap existence cost, Per residue gap cost and Lambda ratio to 11, 1 and 0.85 (default values) respectively, and searching for the identity of a pair of amino acid sequences, the identity value (%) can be calculated.

[0014] In the above vector, the expression cassette of the motor protein MP includes a gene encoding the motor protein MP and a promoter for driving the expression of the gene encoding the motor protein MP.

[0015] The method of connecting the coding gene or expression cassette of the movement protein MP includes directly inserting the coding gene or expression cassette of the movement protein MP into the plant expression vector, or replacing part of the DNA fragment in the plant expression vector with the coding gene or expression cassette of the movement protein MP.

[0016] In the plant expression vector, the promoter used to drive the expression of the gene encoding the movement protein MP and the promoter used to drive the expression of the gene encoding the foreign protein may be the same as or different from each other.

[0017] In one embodiment of the present invention, the plant expression vector is a plant virus expression vector, including but not limited to a plant virus expression vector of the genus Tobamovirus, a plant virus expression vector of the genus Tobravirus and a plant virus expression vector of the genus Potexvirus.

[0018] The Tobamovirus plant virus expression vector is preferably a tobacco mosaic virus expression vector, a rehmannia mosaic virus expression vector or a tomato brown wrinkled fruit virus expression vector.

[0019] The Tobravirus plant virus expression vector is preferably a tobacco rattle virus expression vector.

[0020] The Potexvirus plant virus expression vector is preferably a potato virus X expression vector.

[0021] In a specific embodiment of the present invention, the vector is a vector obtained by connecting the expression cassette of the movement protein MP to the viral genome upstream or downstream of the same T-DNA region of a non-Tobamovirus plant virus expression vector.

[0022] In another specific embodiment of the present invention, the vector is a vector obtained by deleting the gene encoding the movement protein MP that regulates expression in the viral genome of a Tobamovirus plant virus expression vector, and connecting the expression cassette of the movement protein MP upstream or downstream of the viral genome in the same T-DNA region of the Tobamovirus plant virus expression vector.

[0023] Preferably, the vector is a vector obtained by deleting the movement protein MP encoding gene that regulates expression in the TMV genome of the tobacco mosaic virus expression vector, and connecting the movement protein MP expression cassette downstream of the TMV genome in the same T-DNA region of the tobacco mosaic virus expression vector.

[0024] More preferably, the tobacco mosaic virus expression vector is a pAT vector, which includes the following main elements in sequence: 35S promoter, RdRp gene of TMV, MP gene of TMV, GFP reporter gene, 3'UTR segment of TMV, and 35S terminator.

[0025] In another embodiment of the present invention, the plant expression vector is a plant binary expression vector. The plant binary expression vector includes any plant binary expression vector with a T-DNA region commonly used in the art, such as pBI121, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pCAMBIA1391-Xa, pCAMBIA1391-Xb, etc.

[0026] In a specific embodiment of the present invention, the vector is a vector obtained by connecting the expression cassette of the movement protein MP upstream or downstream of the expression cassette of the foreign protein in the same T-DNA region of the plant binary expression vector.

[0027] Preferably, the vector is a vector obtained by connecting the expression cassette of the movement protein MP downstream of the expression cassette of the foreign protein in the same T-DNA region of the plant binary expression vector.

[0028] More preferably, the plant binary expression vector is a p130-GFP vector, wherein the p130-GFP vector contains an expression cassette of a foreign protein, and the expression cassette of the foreign protein sequentially includes a 35S promoter, a coding gene of a Flag-HA-GFP fusion protein, and a Tnos terminator.

[0029] Any of the above-mentioned expression cassettes of the motor protein MP comprises a promoter for initiating the expression of the gene encoding the motor protein MP, the gene encoding the motor protein MP, and a terminator for terminating the expression of the gene encoding the motor protein MP.

[0030] Preferably, the promoter used to initiate the expression of the gene encoding the motor protein MP is the DNA molecule shown in positions 7-313 of SEQ ID No.4.

[0031] Preferably, the gene encoding the motor protein MP is a DNA molecule as described in any one of the following (A1) or (A2): (A1) a DNA molecule as shown in SEQ ID No.6 or SEQ ID No.10 or SEQ ID No.12; (A2) a DNA molecule encoding the motor protein MP having 70% or more identity with SEQ ID No.6 or SEQ ID No.10 or SEQ ID No.12. Wherein, the identity refers to sequence similarity with a natural nucleic acid sequence, including a nucleotide sequence having 75% or more, or 80% or more, or 85% or more, or 90% or more, or 95% or more identity with the nucleotide sequence of the present invention encoding a protein consisting of the amino acid sequence shown in SEQ ID No.5.

[0032] Preferably, the terminator used to terminate the expression of the gene encoding the motor protein MP is the DNA molecule shown in positions 2312-2575 of SEQ ID No.4.

[0033] In a second aspect, the present invention provides a set of vectors for expressing foreign proteins.

[0034] The vector set provided by the present invention comprises a plant expression vector for expressing the above-mentioned movement protein MP and a bipartite plant virus expression system for expressing foreign protein.

[0035] In the above-mentioned complete set of vectors, the bipartite plant virus expression system includes bipartite plant virus expression systems commonly used in the technical field, such as the TRV vector system.

[0036] In a preferred embodiment of the present invention, the bipartite plant virus expression system is a TRV vector system; the TRV vector system includes a TRV1 vector and a TRV2 vector. The T-DNA region of the TRV1 vector includes the following main elements in sequence: a 2ⅹ35S promoter, a sequence encoding TRV-134K, 194K, MP, and 16K proteins, a sequence encoding RZ ribozyme, and a Tnos terminator; the T-DNA region of the TRV2 vector includes the following main elements in sequence: a 2ⅹ35S promoter, a sequence encoding TRV-CP-GFP fusion protein, an MCS multiple cloning site, a sequence encoding RZ ribozyme, and a Tnos terminator.

[0037] In the above-mentioned set of vectors, the plant expression vector for expressing the movement protein MP includes any plant expression vector capable of expressing the movement protein MP.

[0038] In a preferred embodiment of the present invention, the plant expression vector for expressing the movement protein MP is a vector obtained by replacing the DNA fragment between the XbaI and SacI restriction sites of the plant expression vector pCAMBIA-1300-SGN with the gene encoding the movement protein MP.

[0039] In a third aspect, the present invention provides a new use of the above-mentioned vector for expressing foreign proteins or the above-mentioned set of vectors for expressing foreign proteins.

[0040] The present invention provides the use of the above-mentioned vector for foreign protein expression or the above-mentioned set of vectors for foreign protein expression in any of the following 1)-7):

[0041] 1) Expression of foreign proteins;

[0042] 2) Preparation of products expressing foreign proteins;

[0043] 3) Preparation of exogenous proteins;

[0044] 4) Increase the expression of exogenous proteins;

[0045] 5) Products that increase the expression of exogenous proteins;

[0046] 6) Study protein or gene function;

[0047] 7) Prepare products for studying protein or gene functions.

[0048] In a fourth aspect, the present invention provides any one of the following methods b1) to b3):

[0049] b1) A method for increasing the expression level of a foreign protein, comprising the following steps: introducing a coding gene of the foreign protein into a host cell via a plant expression vector, so that the host cell expresses the motor protein MP or increases the expression level of the motor protein MP in the host cell;

[0050] b2) A method for increasing the expression level of an exogenous protein, comprising the following steps: introducing a coding gene of the exogenous protein into a host cell via the above-mentioned vector for exogenous protein expression or the above-mentioned set of vectors for exogenous protein expression, thereby increasing the expression level of the exogenous protein.

[0051] b3) A method for expressing or preparing foreign protein, comprising the following steps: introducing the coding gene of the foreign protein into a host cell through the above-mentioned vector for expressing foreign protein or the above-mentioned set of vectors for expressing foreign protein to achieve the expression or preparation of the foreign protein.

[0052] In b1), in one embodiment of the present invention, the plant expression vector is a plant virus expression vector. The plant virus expression vector includes but is not limited to a Tobamovirus plant virus expression vector, a Tobravirus plant virus expression vector and a Potexvirus plant virus expression vector. The Tobamovirus plant virus expression vector is preferably a tobacco mosaic virus expression vector, a Rehmannia mosaic virus expression vector or a tomato brown wrinkled fruit virus expression vector. The Tobravirus plant virus expression vector is preferably a tobacco rattle virus expression vector. The Potexvirus plant virus expression vector is preferably a potato virus X expression vector.

[0053] Furthermore, the method increases the expression level of the movement protein MP in the host cell by connecting the expression cassette of the movement protein MP mentioned above to the upstream or downstream of the viral genome in the same T-DNA region of a non-Tobamovirus plant virus expression vector, or the method increases the expression level of the movement protein MP in the host cell by deleting the movement protein MP encoding gene that regulates expression in the viral genome of a Tobamovirus plant virus expression vector, and connecting the expression cassette of the movement protein MP mentioned above to the upstream or downstream of the viral genome in the same T-DNA region of the Tobamovirus plant virus expression vector.

[0054] Furthermore, the method increases the expression level of the movement protein MP in the host cell by deleting the movement protein MP encoding gene regulated in the TMV genome of the tobacco mosaic virus expression vector, and connecting the movement protein MP expression cassette upstream or downstream of the TMV genome in the same T-DNA region of the tobacco mosaic virus expression vector. Preferably, the method increases the expression level of the movement protein MP in the host cell by deleting the movement protein MP encoding gene in the TMV genome of the tobacco mosaic virus expression vector, and connecting the movement protein MP expression cassette downstream of the TMV genome in the same T-DNA region of the tobacco mosaic virus expression vector.

[0055] Furthermore, the tobacco mosaic virus expression vector is a pAT vector, which includes the following main elements in sequence: 35S promoter, RdRp gene of TMV, MP gene of TMV, GFP reporter gene, 3'UTR segment of TMV, and 35S terminator.

[0056] In a specific embodiment of the present invention, the method includes the following steps: deleting the movement protein MP encoding gene in the TMV genome of a tobacco mosaic virus expression vector (such as a pAT vector), and connecting the expression cassette of the movement protein MP in the downstream of the TMV genome in the same T-DNA region of the tobacco mosaic virus expression vector to obtain a recombinant tobacco mosaic virus expression vector; then connecting the exogenous protein encoding gene to the recombinant tobacco mosaic virus expression vector to obtain an exogenous protein expression vector (in which the movement protein MP and the exogenous protein are separately driven to express by their respective promoters); introducing the exogenous protein expression vector into a host cell to increase the expression amount of the exogenous protein.

[0057] In another embodiment of the present invention, the plant expression vector is a plant binary expression vector. The plant binary expression vector includes any plant binary expression vector with a T-DNA region commonly used in the art, such as pBI121, pCAMBIA1302, pCAMBIA2301, pCAMBIA1301, pCAMBIA1300, pCAMBIA1391-Xa, pCAMBIA1391-Xb, etc.

[0058] Furthermore, the method can express the movement protein MP in the host cell by connecting the expression cassette of the movement protein MP upstream or downstream of the expression cassette of the foreign protein in the same T-DNA region of the plant expression vector.

[0059] Furthermore, the method allows the host cell to express the movement protein MP by connecting the expression cassette of the movement protein MP downstream of the expression cassette of the foreign protein in the same T-DNA region of the plant binary expression vector.

[0060] Furthermore, the plant binary expression vector is a p130-GFP vector, which contains an expression cassette of a foreign protein, which sequentially includes a 35S promoter, a coding gene of a Flag-HA-GFP fusion protein, and an expression cassette of a Tnos terminator.

[0061] In a specific embodiment of the present invention, the method comprises the following steps: connecting the expression cassette of the above-mentioned movement protein MP into a plant expression vector (such as a p130-GFP vector) containing an exogenous protein expression cassette to obtain an exogenous protein expression vector (in which the movement protein MP and the exogenous protein are separately driven to express by their respective promoters); introducing the exogenous protein expression vector into a host cell to increase the expression amount of the exogenous protein.

[0062] In another embodiment of the present invention, the plant expression vector is a bipartite plant virus expression system, which includes bipartite plant virus expression systems commonly used in the art, such as a TRV vector system.

[0063] Furthermore, the method can increase the expression level of the movement protein MP in the host cell by introducing a plant expression vector for expressing the movement protein MP and a bipartite plant virus expression system for expressing foreign proteins into the host cell.

[0064] Furthermore, the plant expression vector for expressing the movement protein MP includes any plant expression vector capable of expressing the movement protein MP. Preferably, the plant expression vector for expressing the movement protein MP is a vector obtained by replacing the DNA fragment between the XbaI and SacI restriction sites of the plant expression vector pCAMBIA-1300-SGN with the gene encoding the movement protein MP.

[0065] The bipartite plant virus expression system for expressing foreign proteins is preferably a TRV vector system for expressing foreign proteins.

[0066] Furthermore, the TRV vector system includes a TRV1 vector and a TRV2 vector. The T-DNA region of the TRV1 vector includes the following main elements in sequence: a 2ⅹ35S promoter, a sequence encoding TRV-134K, 194K, MP, 16K proteins, a sequence encoding RZ ribozyme, and a Tnos terminator; the T-DNA region of the TRV2 vector includes the following main elements in sequence: a 2ⅹ35S promoter, a sequence encoding TRV-CP-GFP fusion protein, an MCS multiple cloning site, a sequence encoding RZ ribozyme, and a Tnos terminator.

[0067] In a specific embodiment of the present invention, the method comprises the following steps: connecting the coding gene or expression cassette of the movement protein MP into a plant expression vector (such as pCAMBIA-1300-SGN) to obtain a plant expression vector for expressing the movement protein MP, and then introducing the plant expression vector for expressing the movement protein MP and a TRV vector system for expressing exogenous proteins (such as TRV1 vector and TRV2 vector) into a host cell to increase the expression amount of the exogenous protein.

[0068] Any of the above host cells can be a plant cell. The plant can be tobacco; and the tobacco can specifically be Nicotiana benthamiana.

[0069] Any of the above-mentioned expressions is transient expression.

[0070] Any of the above-mentioned exogenous proteins can be any kind of exogenous protein.

[0071] In a specific embodiment of the present invention, the exogenous protein is a GUS protein or a GUS fusion protein with a tag (such as a 6xHis tag).

[0072] In another specific embodiment of the present invention, the exogenous protein is GFP protein or GFP fusion protein with tags (such as 3xFlag and 3xHA tags).

[0073] The present invention transforms the vector based on the TMV viral genome expression vector pAT as the backbone, first constructs the pAT-ΔMP vector in which the MP encoding gene is deleted from the TMV genome, and then creates the MP trans-expression vector ( trans MP expression) pAT- trans MP efficient expression vector was established by optimizing the MP expression mode in the TMV viral genome to free it from the regulatory restrictions of the original viral genome, and by supplementing the expression in series with the TMV-MP deletion vector in the same T-DNA region. trans MP expression vector. Experiments have shown that: the application of pAT- transThe MP vector transiently expresses the target protein in tobacco (N. benthamiana), which not only makes up for the missing MP, but also significantly enhances the accumulation of exogenous proteins (such as GFP reporter protein, GUS reporter protein). In addition, the present invention also detects trans MP expression has a significant synergistic effect on plant virus expression systems other than TMV (such as Tobacco rattle virus, TRV) and plant binary expression systems. The movement proteins of 10 viruses of the genus Tobamovirus (including 8 movement proteins with high identity (57-85.8%) and 2 movement proteins with low identity (18.6-20.1%) with TMV-MP) were screened and compared. The results showed that only the two movement proteins with more than 78% identity with TMV-MP had a similar synergistic effect with TMV-MP.

[0074] The present invention breaks the traditional way of optimizing viral expression vectors (such as the use of regulatory elements and introns, fusion / separation with CP coat protein, etc.), and finds that MP protein is stably expressed ( trans MP expression) contributes significantly to the production of exogenous proteins, thereby creating pAT- trans MP high-efficiency expression virus vector. The present invention also found trans MP expression has similar synergistic effects on plant virus vectors other than TMV and plant binary vector expression systems, further broadening the scope of trans The application scope of MP expression. The present invention will provide carrier support for the large-scale production of target proteins, and has important theoretical significance and application potential.

[0075] The beneficial effects of the present invention are as follows:

[0076] 1. The present invention first discovered trans The MP expression method has the function of significantly increasing the expression amount of foreign proteins. The present invention optimizes the expression vector based on the plant tobacco mosaic virus (TMV) genome, and dissociates the TMV movement protein (MP) from the expression regulation of the TMV genome through a trans-expression method, thereby significantly increasing the accumulation amount of foreign proteins (such as GFP reporter protein and GUS reporter protein).

[0077] 2. The present invention is based on the pAT- trans MP vector lacks viral coat protein (CP), eliminating the potential safety hazards of traditional viral vector systems and the ecological risks associated with release into the environment. transMP high-efficiency expression vector will have potential application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0078] Figure 1 Figure 2 is a schematic diagram of the vector structure. In the pAT vector, the CP gene in the TMV genome is replaced with the GFP gene and the CaMV 35S promoter (P 35S ) driven by GFP in plants; pAT-ΔMP: an expression vector after the MP gene in the pAT vector is deleted; pAT- trans MP: The MP expression cassette is supplemented in the pAT-ΔMP vector by trans expression, where “P NOS -MP-T NOS ” is the MP expression frame.

[0079] Figure 2 For pAT- trans The expression of GFP exogenous protein in MP vector was significantly increased. A is the comparison of GFP fluorescence signal emitted from tobacco leaves at 3 dpi. B is the detection of GFP protein expression by Western blot using GFP antibody. C is the detection of TMV-MP protein expression by Western blot using MP antibody.

[0080] Figure 3 The expression of GUS protein was detected by Western blot using His antibody.

[0081] Figure 4 The results show that 10 viral MPs other than TMV of the genus Tobamovirus can promote the expression of GFP protein. A shows the fluorescence signals of GFP expressed by different vectors in the same leaf. B shows the expression of GFP protein detected by Western blot using GFP antibody.

[0082] Figure 5 for trans MP promotes the expression of GFP exogenous protein in plant virus TRV vector. A is the comparison of fluorescence signals of GFP expressed by different vectors in the same leaf. B is the detection of GFP protein expression by Western blot using GFP antibody.

[0083] Figure 6 for trans MP promotes the expression of GFP exogenous protein in plant binary expression vector. A is a schematic diagram of the vector structure. B is a comparison of the fluorescence signals of GFP expressed by different vectors in the same leaf. C is a Western blot using GFP antibody to detect the expression of GFP protein. For the convenience of comparison, the p130-GFP- trans The protein samples of MP were diluted 20-fold. DETAILED DESCRIPTION

[0084] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0085] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0086] The construction method of the TMV virus expression vector pAT in the following embodiment is as follows:

[0087] (1) Artificially synthesizing a double-stranded DNA molecule shown in SEQ ID No. 1; in the double-stranded DNA molecule, nucleotides 3-8 constitute an Xho I restriction enzyme recognition sequence, nucleotides 24-227 constitute a 3'UTR segment of TMV, and nucleotides 228-233 constitute a Kpn I restriction enzyme recognition sequence.

[0088] (2) Double-digest the double-stranded DNA molecules obtained in step (1) with restriction endonucleases Xho I and Kpn I, and recover the digestion products.

[0089] (3) The p35S-30B plasmid was double-digested with restriction endonucleases Xho I and Kpn I to recover the vector backbone with a size of 13605 bp.

[0090] (4) Connecting the digestion product obtained in step (2) and the vector backbone obtained in step (3) to obtain pAT 0 Vector. pAT 0 The vector includes the following main elements in sequence: 35S promoter, RdRp gene of TMV, MP gene of TMV, multiple cloning site sequence, 3'UTR segment of TMV, and 35S terminator.

[0091] (5) Insert the GFP reporter gene shown in SEQ ID No.2 into pAT 0 The pAT vector was obtained between the Pac I and Xho I restriction sites of the vector. The pAT vector includes the following main elements in sequence: 35S promoter, RdRp gene of TMV, MP gene of TMV, GFP reporter gene, 3'UTR segment of TMV, and 35S terminator.

[0092] The above-mentioned p35S-30B plasmid (plasmid p35S-30B) is described in the following document: Jia HG, Pang YQ and Fang RX (2003) Agroinoculation as a simple way to deliver a Tobacco mosaicvirus-based expression vector. Acta Botanica Sinica, 45 (7): 770-773. The specific construction method is as follows: firstly, a functional segment (including the RdRp gene of TMV, the MP gene of TMV and the CP gene of TMGMV) is obtained from the 30B vector, and then the functional segment is inserted between the 35S promoter and the 35S terminator of the pCassKS vector through the multiple cloning site to obtain a vector containing the functional segment expression cassette, and then an expression cassette having the 35S promoter, the functional segment and the 35S terminator is obtained from the vector containing the functional segment expression cassette, and finally the expression cassette is cloned into the pCAMBIA1300 vector to obtain the p35S-30B plasmid. Among them, the 30B vector is recorded in the following literature: Shivprasad, S., Pogue, GP, Lewandowski, DJ, Hidalgo, J., Donson, J., Grill, LK, and Dawson, WO (1999) Heterologous sequences greatly affect foreign gene expression in Tobacco mosaic virus-based vectors. Virology, 255: 312-323.

[0093] The construction method of the p130-GFP vector in the following embodiment is as follows: the 3FG-HA fragment encoding the Flag and HA double-tag fusion protein shown in SEQ ID No. 13 is connected to the XbaI and SmaI restriction sites of the pBI221-eGFP vector, so that the 3FG-HA fragment is located upstream of the GFP encoding gene sequence, and the p221-3FG-HA recombinant vector is obtained, and the p221-3FG-HA recombinant vector contains the encoding gene of the Flag-HA-GFP fusion protein. Then the encoding gene of the Flag-HA-GFP fusion protein is connected to the XbaI and SacI restriction sites of the plant expression vector pCAMBIA1300-SGN to obtain the p130-GFP recombinant vector, and the p130-GFP recombinant vector contains an expression cassette including the 35S promoter, the encoding gene of the Flag-HA-GFP fusion protein, and the Tnos terminator in sequence. The above pBI221-eGFP vector is documented in the literature: Hongyan Guo, Xiaoguang Song, Chuanmiao Xie, Yan Huo, Fujie Zhang, Xiaoying Chen, Yunfeng Geng, and RongxiangFang (2013) Rice yellow stunt rhabdovirus Protein 6Suppresses Systemic RNASilencing by Blocking RDR6-Mediated Secondary siRNA Synthesis.MPMI,26(8):927-936.

[0094] The 1300-intGUS plant expression vector in the following examples is recorded in the following document: Wang H, Zhang Y, Xiao N, Zhang G, Wang F, Chen X, and Fang R (2020) Rice GERMIN-LIKE PROTEIN 2-1 functions in seed dormancy under the control of abscisic acid and gibberellic acid signaling pathways. Plant Physiology, 183: 1157-1170.

[0095] pCAMBIA-1300-SGN (p130) in the following examples is described in the following document: Wang H, Zhang Y, Xiao N, Zhang G, Wang F, Chen X, and Fang R (2020) Rice GERMIN-LIKE PROTEIN 2-1 functions in seed dormancy under the control of abscisic acid and gibberellic acid signaling pathways. Plant Physiology, 183: 1157-1170.

[0096] The TRV1 vector and TRV2 vector in the following examples are both recorded in the following literature: Yu R, Xiong Z, Zhu X, Feng P, Hu Z, Fang R, Zhang Y, Liu Q (2023) RcSPL1-RcTAF15b regulates the flowering time of rose (Rosa chinensis). Horticulture Research, 10: uhad083.

[0097] The Western blot detection method in the following example includes the following steps: the tobacco leaf sample is fully ground into powder in a mortar precooled with liquid nitrogen, 2 ml of protein extraction buffer [50 mM Tris (pH 7.5), 150 mM NaCl, 10% glycerol, 1.0% Triton X-100, 5 mM β-mercaptoethanol, 20 mM Imidazole, 1× complete protease inhibitor cocktail] is added per gram of leaf, and the mixture is fully mixed and incubated at 4°C for 30 min. Then, the mixture is centrifuged at 4°C and 13,000 rpm for 15 min, the supernatant is taken, and the centrifugation is repeated 2-3 times. Finally, add an equal volume of 2×SDS loading buffer [100mM Tris-Cl (pH6.8), 4% (w / v) SDS, 0.2% (w / v) bromophenol blue, 20% (v / v) glycerol, 200mM DTT (dithiothreitol)] to the supernatant, mix thoroughly, boil in water for 15min, and centrifuge at 4℃ for 3min. Take the supernatant sample and separate the protein by SDS-PAGE and transfer to PVDF membrane for immunoblotting reaction. After blocking with skim milk powder, the primary antibody [1:5000 diluted GFP antibody (Bioss, Beijing, Cat no.bs-2194R or Beijing Ray Antibody Biotech Cat.RM1008); Anti-His Antibody, TIANGEN, Beijing, Cat no.AB102-02] was added and incubated at room temperature for 2 h, and the membrane was washed 3 times, 10 min / time, and the secondary antibody (rabbit secondary antibody, Promega, Madison, WIUSA, Cat no.W4028; mouse secondary antibody: Anti-Mouse IgG (H+L), HRP Conjugate, Promega, Madison, WIUSA, Cat no.W4021) was added and incubated at room temperature for 1 h, and the membrane was washed 3 times, and finally the color developing solution (Thermo Scientific TM , Rockford, USA, Cat no.34075) reaction, and the signal was detected using Azure c600 instrument.

[0098] The method for transiently expressing foreign proteins in tobacco using Agrobacterium in the following embodiment comprises the following steps: Agrobacterium GV3101 carrying the target vector is cultured in 4 ml LB liquid medium containing 25 mg / L kanamycin (Kanamycin, Kan) and 25 mg / L rifampin (Rif) at 28°C overnight, and then activated and cultured again in 20 ml LB liquid medium at a 1% (V / V) inoculum amount until the OD is 0. 600 =1.2, the bacteria were collected after centrifugation at 7000 rpm for 15 min and washed with MMA solution (10 mM MgCl 2 , 10 mM MES pH 5.6, 100 μM acetosyringone) were fully suspended (OD 600 =0.8) and then allowed to stand at room temperature for 1 h, and injected into 5-6 leaf-age tobacco leaves using a needleless syringe, with 3 fully expanded leaves injected per tobacco plant. The injected tobacco was cultured in a greenhouse (22°C, 16 h light / 8 h dark) for 3-7 days, and then the fluorescence signal was detected under a UV lamp at 507 nm or the protein expression level was detected by Western blot.

[0099] The 10 Tobamovirus viruses in the following embodiments: Bell pepper mottle virus, Tropical soda apple mosaic virus, Brugmansia mild mottle virus, Pepper mild mottle virus, Rehmannia mosaic virus, Cactus mild mottle virus, Clitoria yellow mottle virus, Tomato brown rugose fruitvirus, Tomato mosaic virus, and Tomato mottle mosaic virus are all published on the ICTV International Virus Classification official website (https: / / ictv.global / report / chapter / virgaviridae / virgaviridae / tobamovirus), and the genome sequence number corresponding to each virus on the website is shown in Table 1.

[0100] Example 1, pAT- trans Establishment of MP vector

[0101] In order to optimize the pAT expression vector based on the TMV genome, the MP gene in the TMV viral expression vector pAT was first deleted to construct the MP-deficient pAT-ΔMP expression vector. Then, the "P NOS -MP-T NOS "Expression box, using P NOS The promoter drives MP expression in trans expression mode to construct pAT- trans MP vector. pAT vector, pAT-ΔMP vector and pAT- trans The schematic diagram of the MP vector structure is shown in Figure 1 As shown. trans The specific construction method of MP vector is as follows:

[0102] 1. The TMV viral expression vector pAT was double-digested with ZraⅠ and AscⅠ to obtain a 13kb pAT vector after digestion.

[0103] 2. Using the puc57-ZrAsBq plasmid (synthesized by Beijing Qingke Biotechnology Co., Ltd., China) containing the DNA molecule shown in SEQ ID No. 3 (optimized ZrAsBq) as a template, PCR amplification was performed using primers DMZR-F and DMZR-R to obtain PCR products. The primer sequences are as follows:

[0104] DMZR-F: 5'-AGAAAGAGCGGGGACGTCACGACGTTCATTGGA-3';

[0105] DMZR-R: 5'-ACCATTAATGGCGCGCCGGATTGGAAGTAGAGG-3'.

[0106] 3. Using recombinant enzyme (Trelief TM SoSoo Cloning Kit Ver.2, Cat no.TSV-S2, Beijing Qingke Biotechnology Co., Ltd., China) The PCR product in step 2 was recombined into the pAT vector after restriction digestion in step 1 to obtain the recombinant vector pAT-ΔMP for MP deletion expression.

[0107] 4. A polypeptide containing "P" shown in SEQ ID No.4 NOS Promoter-Luc gene (including intron)-T NOS terminator expression cassette (P NOS The nucleotide sequence of the promoter is shown in SEQ ID No. 4, positions 7-313. NOSThe nucleotide sequence of the terminator is shown in SEQ ID No. 4, positions 2312-2575) as a T-LucINT plasmid as a template, and primers Pnos-ΔM-F and ΔM-pnos-R were used for PCR amplification to obtain P NOS promoter fragment; then, using the T-LucINT plasmid as a template, PCR amplification was performed using primers ΔM-pnos-F and NOS-ΔM-R to obtain T NOS terminator fragment; then, using the pAT vector as a template, PCR amplification was performed on TMV-mp-F and TMV-mp-R using primers to obtain the MP-ORF gene fragment (the gene encoding the movement protein MP). The gene encoding the movement protein MP is shown in SEQ ID No.6, and the amino acid sequence of the movement protein MP encoded by it is shown in SEQ ID No.5. The primer sequences are as follows:

[0108] Pnos-ΔM-F: 5'-ttcctttaacaactagagccatggatccagatccggtgcaga-3';

[0109] ΔM-pnos-R: 5'-ctgtcaaacactgatagtttgaaccgcaacgttgaaggag-3';

[0110] ΔM-pnos-F: 5'- tcgtttcccgccttcagttt ccgatctagtaacatagatg-3';

[0111] NOS-ΔM-R: 5'- cgccgaatcggattcgttttaa gaatttccccgatcgttcaa-3';

[0112] TMV-mp-F: 5'-ttaaaacgaatccgattcggcg-3';

[0113] TMV-mp-R: 5'-atggctctagttgttaaaggaa-3'.

[0114] 5. Using recombinant enzyme (Trelief TM SoSoo Cloning Kit Ver.2, Cat no.TSV-S2, Beijing Qingke Biotechnology Co., Ltd., China) was used to clone the three fragments obtained in step 4. NOS Promoter fragment, T NOS The terminator fragment and MP-ORF gene fragment were integrated into the Pme I site of the recombinant vector pAT-ΔMP to obtain the recombinant vector pAT- trans MP. Recombinant vector pAT- transMP is a vector obtained by trans-expressing MP in the TMV viral expression vector pAT, that is, transferring the MP reading frame regulating expression in the TMV genome of the TMV viral expression vector pAT to the P located downstream of the TMV genome. NOS Promoter and T NOS terminator, forming an independent MP expression cassette. NOS -MP-T NOS expression cassette) includes P NOS promoter (shown in positions 7-313 of SEQ ID No.4), the gene encoding the motor protein MP (shown in SEQ ID No.6) and T NOS Terminator (shown in positions 2312-2575 of SEQ ID No. 4).

[0115] Example 2, pAT- trans Detection of GFP exogenous protein expression level in MP vector

[0116] 1. Separately transfer pAT, pAT-ΔMP and pAT- trans The three expression vectors of MP were transformed into Agrobacterium GV3101, and the transient expression system of Agrobacterium was injected into Nicotiana benthamiana leaves. pAT, pAT-ΔMP and pAT- trans The expression of GFP protein was compared with that of the three expression vectors (pAT, pAT-ΔMP and pAT- trans To avoid position effect, pAT, pAT-ΔMP, pAT- trans The injected tobacco leaves were cultured in a greenhouse (22°C, 16h light / 8h dark) for 3-7 days, and the GFP fluorescence signals of the injection sites of different vectors in the same leaf were detected under UV light at 507nm.

[0117] The results showed that in tobacco leaves cultured 3 days after injection (3 dpi), injection of pAT, pAT-ΔMP and pAT- trans The GFP fluorescence signals emitted by the three expression vectors of MP were significantly different ( Figure 2 A), compared with the GFP fluorescence signal from the control vector pAT before transformation, the fluorescence signal from the injection of pAT-ΔMP vector was significantly weakened, while the injection of pAT- trans The fluorescence signal emitted by MP vector was significantly enhanced, indicating that MP plays an important role in the expression of GFP and thattrans Changing the expression mode of MP in MP vector significantly promoted the expression of exogenous protein GFP.

[0118] 2. Separately transfer pAT, pAT-ΔMP and pAT- trans The three expression vectors of pAT, pAT-ΔMP and pAT-MP were transformed into Agrobacterium GV3101 and transiently expressed in Nicotiana benthamiana leaves by Agrobacterium injection. trans The protein expression of GFP and MP was analyzed for the three MP expression vectors, and the injection of MMA solution was used as a control (mock). Three tobacco plants were injected with each vector, and three leaves were injected into each plant. Each leaf was injected with only one vector. The injected tobacco was continued to be cultured in a greenhouse (22°C, 16h light / 8h dark), and Western blot was performed after 3-7 days of culture.

[0119] The results showed that pAT, pAT-ΔMP and pAT- trans The accumulation levels of GFP protein in the three expression vectors of MP corresponded to the fluorescence intensity of GFP, among which pAT- trans The GFP expression level in the MP vector was the highest, about 2.37 times that of the pAT vector ( Figure 2 B). At the same time, the expression of MP protein in these samples was detected, and as expected, low expression was detected in the pAT vector, no expression band was detected in the pAT-ΔMP vector, and no expression band was detected in the pAT- trans The expression level in MP was significantly increased ( Figure 2 C). Therefore, the accumulation of GFP exogenous protein is closely related to the expression level of TMV-MP protein.

[0120] Example 3, pAT- trans Application of MP vector in expressing foreign proteins

[0121] 1. Construction of recombinant vector

[0122] The GUS-6xHis fragment shown in SEQ ID No.7 was inserted into the vector pAT- trans MP Asc I and Xho I restriction sites to obtain the recombinant vector pAT- trans MP-GUS: The recombinant vector expresses the GUS protein with a His tag shown in SEQ ID No.8.

[0123] The GUS-6xHis fragment shown in SEQ ID No.7 was inserted between the Asc I and Xho I restriction sites of the pAT vector to obtain a recombinant vector pAT-GUS. The recombinant vector expressed the GUS protein with a His tag shown in SEQ ID No.8.

[0124] The GUS-6xHis fragment shown in SEQ ID No.7 was inserted between the XbaI and SacI restriction sites of the 1300-intGUS plant expression vector to obtain a recombinant vector 1300-GUS. The recombinant vector expressed the GUS protein with a His tag shown in SEQ ID No.8.

[0125] The nucleotide sequence of the GUS-6xHis fragment shown in SEQ ID No.7 is as follows: positions 1-66 are the coding sequence containing the fused Histag, positions 67-1875 are the coding gene sequence of the GUS protein, and positions 1875-1896 are the coding sequence containing the fused Histag.

[0126] In the amino acid sequence of the His-tagged GUS protein shown in SEQ ID No. 8, positions 1-22 are the amino acid sequence containing the fused His tag, positions 23-625 are the amino acid sequence of the GUS protein, and positions 626-631 are the amino acid sequence containing the fused His tag.

[0127] 2. Expression and analysis of exogenous proteins

[0128] The recombinant vectors constructed in step 1 were respectively transferred into Agrobacterium GV3101, and the exogenous protein was expressed by the Agrobacterium transient expression system in Nicotiana benthamiana leaves, and MMA buffer was used as a control (mock). The expression level of GUS exogenous protein was detected by Western blot, and the expression level of GUS exogenous protein was analyzed by Image J grayscale.

[0129] The results showed that for GUS protein, in pAT- trans In the MP-GUS vector, the expression and accumulation of GUS protein were significantly increased. trans The GUS protein expression level obtained by MP-GUS vector was 1300-GUS plant expression vector (by P 35S The GUS protein expression level obtained by driving GUS expression) was 6.5 times that obtained by the pAT-GUS vector, and 10.2 times that obtained by the pAT-GUS vector. trans Trans-expression of MP in MP vector significantly increased the expression of GUS protein ( Figure 3).

[0130] Example 4: Synergistic Effect of Homologous Proteins of TMV-MP in the Genus Tobamovirus

[0131] 1. Construction of recombinant vector

[0132] The gene sequences encoding the movement protein MP of the following 10 Tobamovirus viruses were synthesized and amplified respectively: Bell pepper mottle virus, Tropical soda apple mosaic virus, Brugmansia mild mottle virus, Pepper mild mottle virus, Rehmannia mosaic virus, Cactus mild mottle virus, Clitoria yellow mottle virus, Tomato brown rugosefruit virus, Tomato mosaic virus, and Tomato mottlemosaic virus. Then, the PCR products containing the gene sequences encoding the movement protein MP of the 10 Tobamovirus viruses were replaced with pAT- trans The MP encoding gene sequence of TMV virus in MP vector was used to obtain 10 recombinant vectors, which were named pAT- trans MP-3 to pAT- trans MP-12.

[0133] The relevant information of the above-mentioned 10 viruses of the genus Tobamovirus other than TMV and their MP amplification primer sequences are shown in Table 1.

[0134] Table 1. Names of 10 viruses other than TMV in the genus Tobamovirus and their MP amplification primer sequences

[0135]

[0136]

[0137] 2. Expression and analysis of exogenous proteins

[0138] The recombinant vectors constructed in step 1 were respectively transformed into Agrobacterium GV3101, and the recombinant vectors (pAT- trans MP-3 to pAT- trans MP-12) were used to compare the expression of GFP protein. trans MP was used as a positive control, and pAT-ΔMP was used as a negative control. Six leaves were repeated each time. The injected tobacco was cultured in a greenhouse (22°C, 16h light / 8h dark). After 3-7 days of culture, the GFP fluorescence signal of different vector injection sites in the same leaf was detected under ultraviolet light at 507nm and Western blot was performed.

[0139] The results showed that by detecting the fluorescence signal of GFP protein, it was found that the vector pAT- trans MP-7 (85.8%) (i.e., MP from Rehmannia mosaic virus) and pAT- trans MP-10 (78%) (i.e., MP from Tomato brown rugose fruit virus) and pAT- trans The synergistic effect of TMV-MP in MP carrier was similar ( Figure 4 A). Further Western Blot analysis also yielded similar results ( Figure 4 B). Therefore, in the genus Tobamovirus, the MPs of two viruses other than TMV-MP, Rehmannia mosaic virus and Tomato brown rugose fruit virus, are similar to TMV-MP and have the effect of enhancing the expression of GFP exogenous protein. Subsequent biological repeated experiments obtained similar results.

[0140] Embodiment 5, trans The synergistic effect of MP on other plant virus expression vectors

[0141] 1. Construction of recombinant vector

[0142] Using the pAT vector as a template, PCR amplification was performed using primers 130-GP4-F and 130-GP4-R to obtain a PCR product (i.e., TMV-MP fragment). The TMV-MP fragment was then connected between the XbaI and SacI restriction sites of the plant expression vector pCAMBIA-1300-SGN, so that the TMV-MP fragment was inserted and replaced the GUS gene between the CaMV 35S promoter and the Nos terminator in the plant expression vector pCAMBIA-1300-SGN, and the recombinant vector p130-MP was obtained. The primer sequences are as follows:

[0143] 130-GP4-F:5'-tggagagaacacgggggactatggctctagttgttaaagg-3':

[0144] 130-GP4-R: 5'-tgaacgatcggggaaattcgttaaaacgaatccgattcgg-3'.

[0145] The recombinant vector p130-MP is a vector obtained by replacing the GUS gene between the CaMV 35S promoter and the Nos terminator in the plant expression vector pCAMBIA-1300-SGN with the MP coding gene of TMV.

[0146] 2. Expression and analysis of exogenous proteins

[0147] The p130-MP recombinant vector, TRV1 vector (the T-DNA region of the TRV1 vector includes the following main elements in sequence: 2ⅹ35S promoter, sequences encoding TRV-134K, 194K, MP, 16K proteins, a sequence encoding RZ ribozyme and a Tnos terminator) and TRV2 vector (the T-DNA region of the TRV2 vector includes the following main elements in sequence: 2ⅹ35S promoter, a sequence encoding TRV-CP-GFP fusion protein, an MCS multiple cloning site, a sequence encoding RZ ribozyme and a Tnos terminator) were introduced into Agrobacterium GV3101, and the recombinant bacteria p130-MP / GV3101, TRV1 / GV3101 and TRV2 / GV3101 were obtained, respectively. Then the three recombinant bacteria were mixed in a volume ratio of 1:1:1 and co-injected into (TRV+p130-MP) Nicotiana benthamiana leaves. At the same time, pCAMBIA1300-SGN vector, TRV1 vector and TRV2 vector were co-injected (TRV+p130) as a negative control. The GFP protein expression of TRV+p130-MP and TRV+p130 was analyzed in the same tobacco leaves. The injected tobacco continued to be cultured in a greenhouse (22°C, 16h light / 8h dark). After 3-7 days of cultivation, the GFP fluorescence signal of the injection sites of different vectors in the same leaf was detected under the condition of 507nm ultraviolet light and Western blot detection was performed.

[0148] The results showed that in the TRV expression system, compared with the negative control group with pCAMBIA1300-SGN (p130 vector), the GFP fluorescence signal ( Figure 5 A) and the expression of GFP protein produced was significantly increased ( Figure 5 B) Therefore trans MP also has a significant synergistic effect on the expression of GFP exogenous genes in plant virus expression systems other than TMV of the Tobravirus genus (such as Tobacco rattle virus, TRV).

[0149] Embodiment 6, trans Synergistic Effect of MP on the Expression of Foreign Genes by Plant Binary Expression Vectors

[0150] 1. Construction of recombinant vector

[0151] pAT- trans MP vector was used as template, and PCR amplification was performed using primers nos-mp-F / Pnos-mp-R to obtain PCR products (i.e., P NOS -MP-T NOS expression cassette), and then the PNOS -MP-T NOS The expression cassette was inserted into the EcoRI restriction site of the p130-GFP vector to obtain the recombinant vector p130-GFP- trans MP (containing P in the same T-DNA region NOS -MP-T NOS expression cassette). p130-GFP- trans Schematic diagram of MP carrier structure Figure 6 a. The primer sequences are as follows:

[0152] nos-mp-F:5'-catctatgttatactagatcggccgatctagtaacatagatg-3';

[0153] Pnos-mp-R:5'-gctatgaccatgattacgaattcgaaccgcaacgttgaaggag-3'.

[0154] 2. Expression and analysis of exogenous proteins

[0155] The recombinant vector p130-GFP- trans MP was transformed into Agrobacterium GV3101, and the exogenous protein GFP was expressed by the Agrobacterium transient expression system in Nicotiana benthamiana leaves. At the same time, the p130-GFP vector was injected as a negative control. trans MP and control vector p130-GFP were used to analyze the expression of GFP protein. The injected tobacco was cultured in a greenhouse (22°C, 16h light / 8h dark). After 3-7 days of culture, the GFP fluorescence signal of the injection sites of different vectors in the same leaf was detected under UV light at 507nm and Western blot was performed.

[0156] The results showed that compared with the p130-GFP control vector, injection of p130-GFP- trans The GFP fluorescence signal emitted by the MP vector ( Figure 6 B) and the expression of GFP protein produced were significantly increased ( Figure 6 C), in which p130-GFP- trans The GFP protein expression level of MP vector is more than 20 times that of p130-GFP control vector. trans MP also significantly promoted the expression of foreign genes in plant binary vectors.

[0157] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A vector for expressing foreign proteins, wherein the vector is obtained by connecting a gene encoding a motor protein MP or an expression cassette to a plant expression vector, and in the plant expression vector, the gene encoding the motor protein MP and the gene encoding the foreign protein are separately driven to express by their respective promoters; The motor protein MP is any one of the following (a1)-(a3): (a1) the protein shown in SEQ ID No.5, SEQ ID No.9 or SEQ ID No.11; (a2) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No.5 or SEQ ID No.9 or SEQ ID No.11; (a3) A protein having 78% or more identity with SEQ ID No. 5, SEQ ID No. 9 or SEQ ID No. 11 and having the same function.

2. The carrier according to claim 1, characterized in that: The plant expression vector is a plant virus expression vector; Or, the plant virus expression vector includes a plant virus expression vector of the genus Tobamovirus, a plant virus expression vector of the genus Tobravirus and a plant virus expression vector of the genus Potexvirus; Or, the Tobamovirus plant virus expression vector includes a tobacco mosaic virus expression vector, a rehmannia mosaic virus expression vector or a tomato brown wrinkled fruit virus expression vector; Or, the Tobravirus plant virus expression vector includes a tobacco rattle virus expression vector; Alternatively, the Potexvirus plant virus expression vector comprises a potato virus X expression vector.

3. The carrier according to claim 1 or 2, characterized in that: The vector is a vector obtained by deleting the movement protein MP encoding gene that regulates expression in the viral genome of the Tobamovirus plant virus expression vector, and connecting the expression cassette of the movement protein MP upstream or downstream of the viral genome in the same T-DNA region of the Tobamovirus plant virus expression vector.

4. The carrier according to claim 1, characterized in that: The plant expression vector is a plant binary expression vector.

5. The carrier according to claim 4, characterized in that: The vector is a vector obtained by connecting the expression cassette of the movement protein MP to the upstream or downstream of the expression cassette of the foreign protein in the same T-DNA region of the plant binary expression vector.

6. The carrier according to any one of claims 1 to 5, characterized in that: The expression cassette of the motor protein MP comprises a promoter for initiating the expression of the gene encoding the motor protein MP, the gene encoding the motor protein MP, and a terminator for terminating the expression of the gene encoding the motor protein MP.

7. The carrier according to any one of claims 1 to 6, characterized in that: The promoter is the DNA molecule shown in positions 7-313 of SEQ ID No.4; The gene encoding the motor protein MP is a DNA molecule as described in any one of the following (A1) or (A2): (A1) a DNA molecule represented by SEQ ID No.6, SEQ ID No.10 or SEQ ID No.12; (A2) a DNA molecule having 70% or more identity with SEQ ID No.6 or SEQ ID No.10 or SEQ ID No.12 and encoding the motor protein MP; The terminator is the DNA molecule shown in positions 2312-2575 of SEQ ID No.

4.

8. A set of vectors for expressing foreign proteins, comprising a plant expression vector for expressing a movement protein MP and a bipartite plant virus expression system for expressing foreign proteins; the movement protein MP is any one of the following (a1)-(a3): (a1) the protein shown in SEQ ID No.5, SEQ ID No.9 or SEQ ID No.11; (a2) a protein having the same function obtained by replacing and / or deleting and / or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No.5 or SEQ ID No.9 or SEQ ID No.11; (a3) A protein having 78% or more identity with SEQ ID No. 5, SEQ ID No. 9 or SEQ ID No. 11 and having the same function.

9. Use of the vector according to any one of claims 1 to 7 or the set of vectors according to claim 8 in any one of the following 1) to 7): 1) Expression of foreign proteins; 2) Preparation of products expressing foreign proteins; 3) Preparation of exogenous proteins; 4) Increase the expression of exogenous proteins; 5) Products that increase the expression of exogenous proteins; 6) Study protein or gene function; 7) Prepare products for studying protein or gene functions.

10. Any of the following methods b1)-b3): b1) A method for increasing the expression of a foreign protein, comprising the following steps: introducing a gene encoding a foreign protein into a host cell via a plant expression vector, so that the host cell expresses the motor protein MP described in claim 1 or increases the expression level of the motor protein MP described in claim 1 in the host cell; b2) A method for increasing the expression of an exogenous protein, comprising the following steps: introducing a gene encoding an exogenous protein into a host cell via the vector described in any one of claims 1 to 7 or the set of vectors described in claim 8, thereby increasing the expression of the exogenous protein; b3) A method for expressing or preparing a foreign protein, comprising the following steps: introducing a gene encoding the foreign protein into a host cell via the vector described in any one of claims 1 to 7 or the set of vectors described in claim 8 to achieve expression or preparation of the foreign protein.

Images