Genetically engineered bacterium for producing lactose-N-neotetraose as well as construction method and application of genetically engineered bacterium

Abstract

The invention provides a genetically engineered bacterium for producing lactose-N-neotetraose as well as a construction method and application of the genetically engineered bacterium. The genetically engineered bacterium meets the following conditions: (1) exogenous expression of an MFS transport protein, beta-1, 3-N-acetylglucosamine transferase and beta-1, 4-galactosyl transferase is carried out; and (2) over-expression of a galactoside osmose enzyme and a UDP-galactose-4-epimerase is carried out. According to the genetically engineered bacterium disclosed by the invention, the MFS transporter, the beta-1, 3-N-acetylglucosamine transferase and the beta-1, 4-galactosyl transferase are exogenously introduced, and the expression quantity of galactosidase and UDP-galactose-4-epimerase in a genome is enhanced, so that the residual quantity of LNT II in an LNnT synthesis route can be effectively reduced, and the fermentation yield of the LNnT is increased.

Description

Technical Field

[0001] The present application relates to the field of biotechnology, and in particular to a genetically engineered bacterium for producing lactose-N-neotetraose and a construction method and application thereof. Background Art

[0002] Lactose-N-neotetraose (LNnT) is one of the most abundant human milk oligosaccharides (HMOs) in breast milk and is a representative of neutral HMOs. Currently, the commercial synthesis methods of lactose-N-neotetraose include chemical synthesis and biosynthesis; the chemical synthesis pathway involves a variety of toxic chemicals, which may threaten the safety of the synthetic products.

[0003] Lactose-N-triose II (LNTⅡ) is an important intermediate in the biosynthesis pathway of lactose-N-neotetraose. In the traditional production method of lactose-N-neotetraose, while increasing the yield of lactose-N-neotetraose, the residual amount of lactose-N-triose II also increases, but lactose-N-triose II is difficult to separate from the target product in the purification step. Therefore, it is very necessary to reduce or eliminate the residual amount of lactose-N-triose II in the final product. Summary of the invention

[0004] Based on this, one or more embodiments of the present application provide a genetically engineered bacterium with high LNnT production and low LNTⅡ overflow, and a construction method and application thereof. The technical solution includes:

[0005] According to a first aspect of an embodiment of the present application, a genetically engineered bacterium for producing lactose-N-neotetraose is provided, wherein the genetically engineered bacterium satisfies the following conditions:

[0006] (1) exogenously expressing the MFS transporter, β-1,3-N-acetylglucosamine transferase, and β-1,4-galactosyltransferase; and

[0007] (2) Overexpression of galactoside permease and UDP-galactose-4-isomerase.

[0008] In one embodiment, the MFS transporter protein includes one or more of bad protein, fred protein, nec protein, marc protein and vag protein.

[0009] In one embodiment, the genetically engineered bacteria satisfies at least one of the following conditions (1) to (5):

[0010] (1) The nucleotide sequence encoding the vag protein is shown in SEQ ID NO: 1;

[0011] (2) The nucleotide sequence encoding the β-1,3-N-acetylglucosamine transferase is shown in SEQ ID NO: 2;

[0012] (3) The nucleotide sequence encoding the β-1,4-galactosyltransferase is shown in SEQ ID NO: 3;

[0013] (4) the gene encoding the galactoside permease is the lacY gene, and the nucleotide sequence encoding the galactoside permease is shown in SEQ ID NO: 4; and

[0014] (5) The gene encoding the UDP-galactose-4-epimerase is the galE gene, and the nucleotide sequence encoding the UDP-galactose-4-epimerase is shown in SEQ ID NO:5.

[0015] In one embodiment, the genetically engineered bacteria include bacteria;

[0016] Optionally, the bacteria include one or more of Escherichia coli and Bacillus subtilis;

[0017] Further optionally, the Escherichia coli includes Escherichia coli BL21 (DE3).

[0018] In one embodiment, the genome of the genetically engineered bacteria comprises one or more of the wcaJ gene, lacZ gene, fucIK gene, nagB gene and wecB gene missing or inactivated.

[0019] In one embodiment, the genetically engineered bacteria satisfies at least one of the following conditions (1) to (2):

[0020] (1) the genome of the genetically engineered bacteria contains deletion or inactivation of the wcaJ gene, lacZ gene and fucIK gene; and

[0021] (2) The genome of the genetically engineered bacteria comprises a deletion or inactivation of the nagB gene, the wecB gene and the lacZ gene.

[0022] In one embodiment, the insertion sites of the MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyl transferase are yjiP, hlyE, wecB, nagB, lacZ, setA, gloA, ugd or IS186.

[0023] According to the second aspect of the embodiment of the present application, a method for constructing a genetically engineered bacterium for producing lactose-N-neotetraose as described above is provided, comprising the following steps:

[0024] Introducing an integration vector expressing the MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyl transferase into the genetically engineered bacteria to be transformed; and

[0025] The recombinant vector over-expressing galactoside permease and UDP-galactose-4-epimerase is introduced into the genetic engineering bacteria to be transformed to construct the genetic engineering bacteria producing lactose-N-neotetraose.

[0026] According to a third aspect of the embodiments of the present application, a method for preparing lactose-N-neotetraose is provided, comprising the following steps:

[0027] The genetically engineered bacteria are fermented and cultured to prepare lactose-N-neotetraose.

[0028] According to a fourth aspect of the embodiments of the present application, a method for producing a dairy product is provided, comprising the following steps:

[0029] preparing lactose-N-neotetraose by the above-mentioned preparation method; and

[0030] A dairy product is prepared using the lactose-N-neotetraose.

[0031] Compared with the traditional technology, this application has the following beneficial effects:

[0032] The genetically engineered bacteria of the present application, by exogenously introducing MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyl transferase, and enhancing the expression of galactoside permease and UDP-galactose-4-epimerase in the genome, can effectively reduce the residual amount of LNT II in the LNnT synthesis pathway and increase the fermentation yield of LNnT. DETAILED DESCRIPTION

[0033] In order to make the above-mentioned purposes, features and advantages of the present application more obvious and easy to understand, the specific implementation methods of the present application are described in detail. In the following description, many specific details are set forth to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present application, so the present application is not limited by the specific embodiments disclosed below.

[0034] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those generally understood by those skilled in the art of the present application. The terms used herein in the specification of the present application are only for the purpose of describing specific embodiments and are not intended to limit the present application. Unless otherwise specifically stated, various raw materials, reagents, instruments and equipment used in the present application, etc. can be purchased from the market or can be prepared by existing methods.

[0035] In the present application, "plurality", "multiple", "multiple times", "multiples", etc., unless otherwise specified, refer to a number greater than 2 or equal to 2. For example, "one or more" means one or greater than or equal to two.

[0036] In the present application, "further", "further", "particularly" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of the present application.

[0037] In this application, "optionally", "optional", and "optional" mean optional or dispensable, that is, any one of the two parallel schemes of "yes" or "no". If multiple "options" appear in a technical solution, unless otherwise specified and there is no contradiction or mutual restriction, each "optional" is independent.

[0038] In the present application, the technical features described in an open manner include closed technical solutions composed of the listed features, and also include open technical solutions containing the listed features.

[0039] In the present application, when it comes to numerical intervals (i.e., numerical ranges), unless otherwise specified, the optional numerical distribution is considered continuous within the above numerical interval, and includes the two numerical endpoints (i.e., the minimum and maximum values) of the numerical range, and each numerical value between the two numerical endpoints. Unless otherwise specified, when the numerical interval only refers to the integers within the numerical interval, it includes the two endpoint integers of the numerical range, and each integer between the two endpoints. In this article, it is equivalent to directly listing each integer, such as t is an integer selected from 1-10, indicating that t is any integer selected from the integer group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10. In addition, when multiple ranges are provided to describe features or characteristics, these ranges can be combined. In other words, unless otherwise specified, the ranges disclosed herein should be understood to include any and all sub-ranges included therein.

[0040] In the present application, the terms "first", "second", "third", "fourth", etc. in "the first aspect", "the second aspect", "the third aspect", "the fourth aspect", etc. are used only for descriptive purposes and cannot be understood as indicating or implying relative importance or quantity, nor can they be understood as implicitly indicating the importance or quantity of the indicated technical features. Moreover, "first", "second", "third", "fourth", etc. only serve the purpose of non-exhaustive enumeration and description, and it should be understood that they do not constitute a closed limitation on quantity.

[0041] The temperature parameters in this application, unless otherwise specified, are allowed to be either constant temperature treatment or to vary within a certain temperature range. It should be understood that the constant temperature treatment allows the temperature to fluctuate within the accuracy range controlled by the instrument. Fluctuations within the range of ±5°C, ±4°C, ±3°C, ±2°C, and ±1°C are allowed.

[0042] All documents mentioned in this application are cited as references in this application, just as each document is cited as reference separately. Unless they conflict with the invention purpose and / or technical solution of this application, the cited documents involved in this application are cited with all contents and all purposes. When the cited documents are involved in this application, the definitions of relevant technical features, terms, nouns, phrases, etc. in the cited documents are also cited. When the cited documents are involved in this application, the examples and preferred methods of the cited relevant technical features can also be incorporated into this application as references, but are limited to the implementation of this application. It should be understood that when the cited content conflicts with the description in this application, the present application shall prevail or be modified adaptively according to the description of this application.

[0043] In this application, "homology" and "identity" and "similarity" are used interchangeably. "Homology", "identity" and "similarity" refer to the fact that two or more sequences have the same base or amino acid residue at a specific percentage of corresponding positions when the pairwise relationship is maximized in comparison and alignment. The identity of nucleotide sequences can be determined using homology search sites on the Internet, such as the BLAST page on the NCBI homepage website. The alignment percentage homology or identity can be determined using any suitable software program known in the art, for example, as described in Current Protocols in Molecular Biology (FM Ausubel, et al, (eds) 1987 Supplement 30 section 7.7.18). Optional programs include the GCG Pileup program, such as FASTA (Pearson, et al, 1988 Proc. Natl. Acad. Sci. USA 85: 2444-2448) and BLAST (BLASTanual, Altschul et al. Natl. Cent Biotechnol. linf.. NatLib Med. (NCIBNLM NIH), Bethesda, Md.. and Altschul et al, 1997 NAR 25: 3389-3402). Another optional alignment program is ALIGN Plus (Scientific and Educational Software, PA), which preferably uses basic parameters. Another optional sequence software program that can be used here is the TFASTA data search program used in the sequence software package Sequence Software Package version 6.0 (Genetics Computer Group, University of Wisconsin, Madison W). Examples of commonly used sequence alignment algorithms include, but are not limited to, CLUSTAL Omega, EMBOSS Needle, MAFFT or MUSCLE.

[0044] In a first aspect of the present application, a genetically engineered bacterium for producing lactose-N-neotetraose is provided, which satisfies the following conditions:

[0045] (1) exogenously expressing the MFS transporter, β-1,3-N-acetylglucosamine transferase, and β-1,4-galactosyltransferase; and

[0046] (2) Overexpression of galactoside permease and UDP-galactose-4-isomerase.

[0047] In the present application, "MFS protein" refers to a major facilitator superfamily protein that can facilitate the transport of substances such as human milk oligosaccharides (HMOs) including lactose-N-neotetraose through the cell membrane.

[0048] In the present application, "overexpression" refers to the expression level of a protein being higher than the natural expression level of a genetically engineered bacterium.

[0049] In some of the embodiments, the genetically engineered bacteria may also contain overexpressed β-1,4-galactosyltransferase.

[0050] In some embodiments, the gene encoding β-1,3-N-acetylglucosamine transferase is the lgtA gene; optionally, the nucleotide sequence encoding β-1,3-N-acetylglucosamine transferase is shown in SEQ ID NO:2.

[0051] In some other examples, the nucleotide sequence encoding β-1,3-N-acetylglucosamine transferase has at least 80% homology to SEQ ID NO: 2. For example, it has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology.

[0052] In some embodiments, the gene encoding β-1,4-galactosyltransferase is the lgtB gene; optionally, the nucleotide sequence encoding β-1,4-galactosyltransferase is shown in SEQ ID NO:3.

[0053] In some embodiments, the nucleotide sequence encoding the beta-1,4-galactosyltransferase has at least 80% homology to SEQ ID NO: 3. For example, it has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology.

[0054] β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyl transferase are two key glycosyltransferases in the synthesis pathway of lactose-N-neotetraose. β-1,3-N-acetylglucosamine transferase can catalyze the transfer of N-acetylglucosamine (GlcNAc) derived from uridine-5'-diphospho-GlcNAc (UDP-GlcNAc) to the 3'-OH position at the end of N-acetyllactosamine derivatives to form N-acetyllactosaminoglycan chains, and synthesize LNT II using lactose as an acceptor and GlcNAc as a donor. β-1,4-galactosyl transferase (β-1,4-GalT) can catalyze the transfer of galactosyl groups from lactose to LNT II, ​​and synthesize lactose-N-neotetraose using UDP-galactose and LNT II as substrates.

[0055] In some embodiments, the amino acid sequence of the galactoside permease is registered at NCBI (National Center for Biotechnology Information) as NP_414877.1. Understandably, the galactoside permease can specifically catalyze the decomposition of lactose into galactose and glucose, thereby providing sufficient reaction substrates for the synthesis pathway of lactose-N-neotetraose.

[0056] In some embodiments, the gene encoding the galactoside permease is the lacY gene; alternatively, the nucleotide sequence encoding the galactoside permease is shown in SEQ ID NO:4.

[0057] In some embodiments, the nucleotide sequence encoding the galactoside permease has at least 80% homology to SEQ ID NO: 4. For example, it has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology.

[0058] In some embodiments, the amino acid sequence of UDP-galactose-4-epimerase is registered at NCBI (National Center for Biotechnology Information) with the accession number NP_415280.3. Understandably, UDP-galactose-4-epimerase can catalyze the epimerization of UDP-glucose to UDP-galactose, so overexpression of UDP-galactose-4-epimerase in genetically engineered bacteria can increase the accumulation of UDP-galactose. Under the action of β-1,3-N-acetylglucosamine transferase, UDP-galactose and the intermediate lactose-N-triose II are used as substrates to generate lactose-N-neotetraose; thereby increasing the consumption of lactose-N-triose II, reducing its residual amount, and increasing the yield of lactose-N-neotetraose.

[0059] In some embodiments, the gene encoding UDP-galactose-4-epimerase is a galE gene; alternatively, the nucleotide sequence encoding UDP-galactose-4-epimerase is shown in SEQ ID NO:5.

[0060] In some embodiments, the nucleotide sequence encoding UDP-galactose-4-epimerase has at least 80% homology to SEQ ID NO: 5. For example, it has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology.

[0061] In some embodiments, the MFS transporter protein includes one or more of bad protein, fred protein, nec protein, marc protein and vag protein.

[0062] In some embodiments, the amino acid sequence of the vag protein has an accession number of WP_048785139.1 in NCBI (National Center for Biotechnology Information).

[0063] In some embodiments, the nucleotide sequence encoding the vag protein is shown in SEQ ID NO: 1. In other examples, the nucleotide sequence encoding the vag protein has at least 80% homology to SEQ ID NO: 1. For example, it has 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homology.

[0064] It is understandable that the types of integration vectors and expression vectors may also be other integration vectors and expression vectors commonly used in the art, and are not particularly limited in this application.

[0065] As an example, the integration vectors for the MFS transporter, β-1,3-N-acetylglucosaminyltransferase and β-1,4-galactosyltransferase can be selected from pSPIN.

[0066] As an example, the expression vectors for galactoside permease and UDP-galactose-4-epimerase can be selected from pETDuet-1, pCDFDuet-1 or pRSFDuet-1.

[0067] The genetically engineered bacteria of the present application may be any host cell commonly used in the art, and are not particularly limited. Host cells include prokaryotic cells and / or eukaryotic cells, and in some optional examples, may be bacteria or yeast cells, such as Escherichia coli, Bacillus subtilis, etc.; in some optional examples, may be eukaryotic cells, such as yeast cells, plant cells, insect cells, and animal cells such as mammalian cells (e.g., mouse cells, human cells, etc.). For bacterial host cells, there are no restrictions in principle; they may be true bacteria (Gram-positive bacteria or Gram-negative bacteria) or archaea, as long as they allow the insertion of genetic modification of the gene of interest and can be cultured on a production scale.

[0068] By way of example, the bacteria may be Escherichia coli, Klebsiella oxytoca, Anaerobiospirillum succiniciproducens, Actinobacillus succinogenes, Mannheimia succiniciproducens, Rhizobium etli, Bacillus subtilis, Bacillus methanolicus, Corynebacterium glutamicum, Gluconobacter oxydans, Zymomonas mobilis, Lactococcus lactis, Lactobacillus plantarum, Streptomyces coelicolor, coelicolor, Clostridium acetobutylicum, Pseudomonas fluorescens or Pseudomonas putida. The yeast or fungus may be Saccharomyces cerevisiae, Schizosaccharomyces pombe, Kluyveromyces lactis, Kluyveromyces marxianus, Aspergillus terreus, Aspergillus niger, Pichia pastoris, Rhizopus arrhizus or Yarrowia lipolytica, etc.

[0069] In some embodiments, the genetically engineered bacteria is Escherichia coli, which may be Escherichia coli BL21 (DE3), or may be Escherichia coli BL21 star (DE3).

[0070] The genetically engineered bacteria of the present application can adapt to a variety of chassis cells, and the transformation of chassis cells tends to be simplified, so that the strain can have good stability during subsequent passage and application.

[0071] In some embodiments, one or more of the wcaJ gene, lacZ gene, fucIK gene, nagB gene and wecB gene in the genome of the genetically engineered bacteria are deleted or inactivated. For example, the genome of the genetically engineered bacteria may include one, two, three, four or five inactivated or deleted genes among the wcaJ gene, lacZ gene, fucIK gene, nagB gene and wecB gene.

[0072] Optionally, the genome of the genetically engineered bacteria comprises a deletion or inactivation of the wcaJ gene, the lacZ gene and the fucIK gene.

[0073] Optionally, the genome of the genetically engineered bacteria comprises deletion or inactivation of the nagB gene, the wecB gene and the lacZ gene.

[0074] Understandably, the genome of the genetically engineered bacteria may also contain other gene deletions or inactivations, and may also contain other gene overexpressions.

[0075] It can be understood that "inactivation" in this application means that the relevant gene is not expressed or the expression activity is reduced; "deletion" means that all or part of the coding fragment of the relevant gene is missing; this application does not specifically limit the method of gene inactivation and gene deletion, which can be any method commonly used in the art.

[0076] By further modifying the chassis cells, the synthesis rate of lactose-N-neotetraose and the final fermentation yield can be effectively improved.

[0077] It is understandable that the genetically engineered bacteria of the present application can be either modified chassis cells or unmodified chassis cells, as long as the technical effects of the present application can be achieved. For example, the genetically engineered bacteria of the present application can be selected from various chassis cells that have been modified in traditional technologies.

[0078] In some embodiments, the genome of the genetically engineered bacteria may also include expression regulatory elements such as promoters, enhancers, and terminators to achieve the purpose of improving the expression amount, expression efficiency, product activity, and other aspects of the gene performance; any known promoter, enhancer, and terminator in the art may be applicable to the genetically engineered bacteria of the present application, as long as the technical effects of the present application can be achieved. As an example, the promoter may be a T7 promoter.

[0079] In some embodiments, the genome of the genetically engineered bacteria also includes endogenous nucleic acid fragments, including nucleic acid molecules that have been modified but not removed from the strain; the modification methods include but are not limited to gene replacement, site-specific mutation, etc.

[0080] In some of these embodiments, the insertion sites of the MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyl transferase are yjiP, hlyE, wecB, nagB, lacZ, setA, gloA, ugd or IS186.

[0081] The second aspect of the present application provides a method for constructing a genetically engineered bacterium for producing lactose-N-neotetraose according to the first aspect, comprising step S10 and step S20.

[0082] Step S10: Introducing the integration vector expressing the MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyl transferase into the genetically engineered bacteria to be transformed.

[0083] Step S20: introducing the recombinant vector overexpressing galactoside permease and UDP-galactose-4-epimerase into the genetically engineered bacteria to be transformed, so as to construct a genetically engineered bacteria producing lactose-N-neotetraose.

[0084] The present application does not specifically limit the execution order of step S10 and step S20, as long as the purpose of the present application can be achieved.

[0085] It is understandable that the MFS transporter, β-1,3-N-acetylglucosamine transferase, β-1,4-galactosyl transferase, galactoside permease and UDP-galactose-4-epimerase are defined as in the first aspect of the present application.

[0086] The present application does not specifically limit the construction method of the expression vector method, which can be any method commonly used in the art, such as double enzyme digestion or homologous recombination. In the present application, the method for transforming the expression vector into the chassis cell is not specifically limited, as long as it can transform the recombinant expression vector into the chassis cell, and the transformation method includes but is not limited to heat shock method, electroporation method, calcium ion method and spheroplast method, etc.

[0087] The third aspect of the present application provides a method for preparing lactose-N-neotetraose, comprising the following steps:

[0088] The genetically engineered bacteria of the first aspect are fermented and cultured to prepare lactose-N-neotetraose.

[0089] It is understandable that the present application does not impose any particular limitation on the method of fermentation culture and the type of culture medium used for fermentation culture, and any method and culture medium commonly used in the art may be used.

[0090] In some embodiments, the components of the fermentation medium include peptone, yeast extract, (NH4)2SO4, K2HPO4, KH2PO4, glycerol, citric acid, defoaming agent, glucose, MgSO4·7H2O, anhydrous CaCl2, 1000× vitamin B1 and nitrilotriacetic acid.

[0091] The fourth aspect of the present application provides a method for producing a dairy product, comprising the following steps:

[0092] preparing lactose-N-neotetraose by the preparation method of the third aspect; and

[0093] Preparation of dairy products using lactose-N-neotetraose.

[0094] It is understandable that the method for preparing dairy products using lactose-N-neotetraose can be any method commonly used in the art, and the present application does not make any particular limitation.

[0095] The present application will be further described below in conjunction with specific examples and comparative examples, but they should not be construed as limiting the scope of protection of the present application. The raw materials involved in the following specific examples, unless otherwise specified, can all be sourced from commercial sources, the instruments used, unless otherwise specified, can all be sourced from commercial sources, and the processes involved, unless otherwise specified, are all conventionally selected by those skilled in the art.

[0096] Embodiment 1:

[0097] (1) Transformation of chassis strains

[0098] Escherichia coli BL21 star (DE3) was selected as the recipient strain, and the lacZ gene, fucIK gene and wcaJ gene in Escherichia coli BL21 star (DE3) were knocked out to obtain the chassis strain BL21 star (DE3) ΔlacZ ΔfucIK ΔwcaJ.

[0099] The detailed steps for knocking out the lacZ gene are as follows:

[0100] (a) A 20 bp sequence with NGG (N is any nucleotide) at the 3' end was selected from the lacZ gene of the Escherichia coli genome as the target site N20 for CRISPR-Cas9 knockout.

[0101] (b) The N20 fragment was inserted into the pGRB linearized vector to obtain the plasmid pGRB-lacZ.

[0102] (c) The recombinant plasmid pGRB-lacZ was transformed into Escherichia coli DH5α by the calcium chloride chemical transformation method, and then spread on LB plates containing ampicillin for screening and culture. After static culture at 37°C overnight, single colonies were picked for colony PCR. Positive clones were expanded by LB liquid culture, plasmids were extracted and sequenced, and the recombinant expression vector with correct sequencing results was named recombinant plasmid pGRB-lacZ.

[0103] (d) Sequences of about 300 bp to 500 bp upstream and downstream of the lacZ gene were taken as knockout homology arms, and after PCR amplification, the upstream homology arm lacZ-UP (amplified using primers with nucleotide sequences such as SEQ ID NOs: 6 to 7) and the downstream homology arm lacZ-DOWN (amplified using primers with nucleotide sequences such as SEQ ID NOs: 8 to 9) were cleanly recovered.

[0104] SEQ ID NO: 6 (lacZ-UP-F): gcccgagtttgtcagaaagc.

[0105] SEQ ID NO: 7 (lacZ-UP-R): atactgtcgttcaacatcagccgctacagt.

[0106] SEQ ID NO: 8 (lacZ-DOWN-F): ctgatgttgaacgacagtatcggcctcagg.

[0107] SEQ ID NO: 9 (lacZ-DOWN-R): cccaatacgcaaaccgcctc.

[0108] (e) The upstream homology arm lacZ-UP and the downstream homology arm lacZ-DOWN are fused by overlap to obtain the homologous repair template Homo-lacZ.

[0109] (f) Preparation of knockout chassis electroporation competent cells: The pREDCas9 plasmid was introduced into the chassis cells BL21 star (DE3) to obtain BL21 star (DE3)-Cas9 cells, and the BL21 star (DE3)-Cas9 cells were inoculated into 5 mL of LB liquid culture medium containing streptomycin resistance, and cultured at 30°C and 200 rpm for 16 h. BL21 star (DE3)-Cas9 cells were inoculated into 200 mL of LB liquid culture medium containing streptomycin resistance at a ratio of 1% (v / v) and cultured until OD 600 When the OD reaches 0.1, add 1 mM IPTG and continue to culture until the OD 600=0.4. The cultured bacterial solution was quickly placed in an ice bath for 15 min, and the cells were collected by centrifugation at 5000 rpm for 10 min in a precooled centrifuge at 4°C. The cells were washed with sterile water and resuspended with 2 mL of precooled 10% glycerol to obtain BL21star(DE3)-Cas9 competent cells.

[0110] (g) Chassis strain lacZ gene knockout: The homologous repair template Homo-lacZ and the recombinant plasmid pGRB-lacZ were introduced into BL21 star(DE3)-Cas9 competent cells, and single clones were screened using a plate containing streptomycin and ampicillin. Positive clones were screened by colony PCR and verified using the primer pair with nucleotide sequences as shown in SEQ ID NO:10-11.

[0111] SEQ ID NO: 10 (lacZ-yz-F): aacggcgcaaacatcactaac.

[0112] SEQ ID NO: 11 (lacZ-yz-R): gctgttgcccgtctcactgg.

[0113] The fucIK gene and wcaJ gene were knocked out using the same method as the lacZ gene knockout to construct a chassis strain with lacZ gene, fucIK gene and wcaJ gene knockout. The specific primer pairs and DNA sequence information used are as follows.

[0114] SEQ ID NO: 12 (fucIK-UP-F): tgtttcggacattgcagctttc.

[0115] SEQ ID NO: 13 (fucIK-UP-R): gtcagttcactcatcaggattcctcatctc.

[0116] SEQ ID NO: 14 (fucIK-DOWN-F): atcctgatgagtgaactgactgaatgccac.

[0117] SEQ ID NO: 15 (fucIK-DOWN-R): gcgctgttctgtagcgtacc.

[0118] SEQ ID NO: 16 (fucIK-yz-F): cacgtcattaagcgccaacactcc.

[0119] SEQ ID NO: 17 (fucIK-yz-R): cggtatgccaacgggtaagc.

[0120] SEQ ID NO: 18 (wcaJ-UP-F): acctgttggtggcgctgattac.

[0121] SEQ ID NO: 19 (wcaJ-UP-R): gaactcgacgctcgaccagttgttgcagattg.

[0122] SEQ ID NO: 20 (wcaJ-DOWN-F): actggtcgagcgtcgagttcgaccttgagt.

[0123] SEQ ID NO: 21 (wcaJ-DOWN-R): ggatcaccacaaacgccagc.

[0124] SEQ ID NO: 22 (wcaJ-yz-F): ccggactatggctggtttgc.

[0125] SEQ ID NO: 23 (wcaJ-yz-R): ccgcgctggtttcgatcatg.

[0126] (2) Transposition integration of lgtA2-lgtB2-vag

[0127] (a) A sequence with a 5' end of CC and a length of 32 bp (N32) at the yjiP target site on the Escherichia coli genome was selected as sgRNA, and the sgRNA was cloned into the BsaI restriction site of the pSPIN vector to obtain pSPIN-N32.

[0128] (b) The artificially synthesized lgtA2-lgtB2-vag fragment (i.e., the fragment obtained by sequentially connecting the fragments with nucleotide sequences as shown in SEQ ID NO: 2, 3, and 1) was cloned into the XhoI / PstI site of pSPIN-N32 by restriction digestion and ligation to obtain the transposition integration plasmid pSPIN-N32-lgtA2-lgtB2-vag.

[0129] SEQ ID NO:1 (vag):

[0130] atgaagagcctgctgacccgtaaacgtcgcattaatccggtgtttctggcctttatggcagcaagctttatgattggcgttgcaggcgcactgcag

[0131] gcaccgaccctgagcctgtttctgacccgtgaagtgcaggcccgtccgctgtgggttggcctgttttttaccgtgaatgccattgcaggtattgtgg

[0132] tgagcatgctggttgccaaacgcagcgatagccgcggcgatcgtcgtaccctgattctgttttgctgcgcaatggcattttgcaatgcactgctgtt

[0133] tgcatttacccgccattatctgaccctgattaccctgggcgtgctgctgagcgcactggcaagcgttagcatgccgcagatttttgccctggcacg

[0134] cgaatatgcagatcagagcgcccgcgaagcagttatgtttagcagtgtgatgcgcgcacagctgagcctggcctgggtgattggtccgccgct

[0135] gagctttgcactggcactgaattttggttttgttaccctgtttctggtggcagcagcactgtttctggtttgcattctgctgattaaatttaccctgccga

[0136] gcgtgccgcgcgccgaacctttaatgcgtagcggcggcatgccgctgagcggctggagagatcgtgatgttcgtctgctgtttattgccagtgtt

[0137] accatgtggacctgcaataccatgtatattattgatatgccgctgtatatcagtgtgaccctgggcctgccggaaaaactggcaggcctgctgatg

[0138] ggcaccgcagccggtctggaaattccggtgatgctgctggcaggtcattatgcaaaacgtgtgggcaaacgtaatctgatgctgattgccgtgg

[0139] cagccggtgttctgttttatgccggcctggccatgtttgccagccagaccgccctgatggccctgcagctgtttaatgcagtgtttattggcattattg

[0140] ccggtattggcatgctgtggtttcaggatctgatgccgggtcgcccgggtgcagccacaaccatgtttaccaatagcattagtaccggtatgattct

[0141] ggcaggcgttattcagggtaccctgagcgaacgctttggtcatattgccgtgtattggctggccctgggtctggcagttgccgcatttgccatgagcgcacgtgttaaaaatgtttaa。

[0142] SEQ ID NO:2(lgtA2):

[0143] atgggcagcagccatcaccatcatcaccacagccaggatccgatgccgagcgaagcctttcgtcgtcatcgtgcatatcgcgaaaataaactgc

[0144] agccgctggtgagcgtgctgatttgtgcatataatgtggaaaaatacttcgcccagagtctggccgccgttgtgaatcagacctggcgtaatctgg

[0145] atattctgattgttgatgatggtagtaccgatggcaccctggccattgcccagcgttttcaggaacaggatggccgtattcgcattctggcacagcc

[0146] gcgtaatagcggtctgattccgagtctgaatattggtctggatgaactggccaaaagcggtggcggcggtgaatatattgcacgcaccgatgcc

[0147] gatgatattgccgccccggattggattgaaaaaattgttggtgaaatggaaaaggatcgtagcattattgccatggggcgcctggctggaagttctg

[0148] agcgaagaaaaagatggtaatcgtctggcccgccatcatgaacatggcaaaatttggaaaaaaccgacccgtcatgaagatattgccgattttttt

[0149] ccgtttggtaatccgattcataataataccatgattatgcgtcgcagcgtgattgatggcggtctgcgctataataccgaacgtgattgggccgaag

[0150] attatcagttttggtatgatgttagcaaactgggtcgcctggcatattatccggaagcactggtgaaatatcgcctgcatgcaaatcaggttagtagt

[0151] aaatatagcattcgtcagcatgaaattgcacagggcattcagaaaaccgcccgcaatgattttctgcagagtatgggctttaaaaacccgctttgata

[0152] gcctggaatatcgccagattaaagccgtggcctatgaactgctggaaaaacatctgccggaaagattttgaacgtgcacgccgttttctgtatc

[0153] agtgctttaaacgtaccgataccctgccggccggcgcctggttagattttgcagcagatggccgtatgcgtcgtctgttttaccctgcgccagtattttggcattctgcatcgcctgctgaaaaaatcgctaa。

[0154] SEQ ID NO:3(lgtB2):

[0155] atgcgtgtttttatcatcagcctgaatcagaaagtttgcgatacctttggcctggtgtttcgcgataccaccaccctgctgaataatattaatgccacc

[0156] catcatcaggcacagatttttgatgcaatttatagtaagaccttcgaaggtggtctgcatccgctggtgaaaaaacatctgcatccgtattttattacc

[0157] cagaatattaaggatatgggcattaccaccaatctgattagtgaagttagcaaattttactacgcactgaaatatcatgcaaaatttatgagtctggg

[0158] cgaactgggttgttatgccagccattatagcctgtgggaaaaatgtattgaactgaatgaagccatttgtattctggaagatgatattaccctgaaag

[0159] aagattttaaggaaggcctggattttctggaaaaacatattcaggaactgggctatgtgcgtctgatgcatctgctgtatgatccgaatgttaaaagt

[0160] gaaccgctgaatcataaaaatcatgaaattcaggagcgcgttggcattattaaagcatatagccatggtgttggcacccagggttatgttattaccc

[0161] cgaaaattgcaaaagtttttaagaaacacagccgcaaatgggtggtgccggttgataccattatggatgccacctttattcatggcgttaaaaatct

[0162] ggtgctgcagccgtttgtgattgcagatgatgaacagattagcaccattgcacgtaaagaagaaccgtatagcccgaaaattgccctgatgcgtgaactgcattttaaatatctgaaatactggcagttcgtgtaa.

[0163] (c) Transposition integration: The transposition integration plasmid pSPIN-N32-lgtA2-lgtB2-vag was transformed into the chassis cells obtained in step (1) by electroporation, spread on LB plates containing kanamycin, and cultured at 37°C overnight; transformants were randomly picked for colony PCR verification, and homozygous genotype strains with only integration bands were screened for sequencing verification, and the loss of the transposition plasmid was verified using resistance culture medium.

[0164] (3) Construction of lacY and galE overexpression plasmids

[0165] (a) Using the genome of Escherichia coli BL21 (DE3) as a template, the lacY gene was amplified by PCR (the amplification primers are shown in SEQ ID NOs: 24-25), and the nucleotide sequence of the amplified lacY gene fragment is shown in SEQ ID NO: 4; the lacY gene fragment was cloned into the NcoI and HindIII sites of the vector pETDuet-1 to obtain the recombinant expression vector pET-lacY.

[0166] SEQ ID NO:4 (lacY gene fragment)

[0167] ctttaagaaggagatataccatggatgtattacctaaaaaacacaaatttttggatgttcggcttgttcttctttttctacttctttatcatgggcgcgtact

[0168] tcccgtttttcccgatttggctgcatgatattaaccacatttccaaatcggacaccggtattatttttgcggcaattagcctcttcagcttgctgttccaa

[0169] ccgctgtttggcctgctgagtgataaactgggcttgcgcaaatatctcctttggattatcaccggtatgctggtgatgttcgctccgttctttatcttcat

[0170] ctttggtccgctgctgcaatataacattctggtaggcagcattgttggtggtatttatttaggtttttgcttcaacgctggtgctccggcggtggaagc

[0171] ctttatcgaaaaagttagccgtagaagcaatttcgagttcggccgtgcgcgtatgttcggctgcgtgggctgggcactgtgtgcatccatcgtggg

[0172] tatcatgttcaccataaacaaccagtttgtcttctggctgggttccgggtgcgcacttatcttggcggtgctgctgtttttcgctaaaaccgacgcacc

[0173] gagcagcgcgacggttgcgaatgctgtgggtgcgaatcatagcgcgttttcccttaagttggcgttggagctcttccgccaaccgaagttatggtt

[0174] tctctctctgtacgtgatcggtgtttcttgtacctacgacgtttttgatcagcaatttgcgaacttttttacttccttcttcgccaccggcgagcagggtac

[0175] gcgtgtttttggctatgttaccaccatgggcgaactgttgaatgcgagcatcatgtttttcgcgcctctgatcatcaaccgtattggcggtaaaaacg

[0176] ccttgctgttggcgggtacgatcatgtccgtgcgcatcatcggctcgagctttgcgacttctgcgcttgaggtagttatcctcaagaccctgcacat

[0177] gttcgaggttccgttcctgttggttggttgctttaagtacattacctcgcaatttgaggtgcgttttagtgccacgatttacttggtctgtttctgcttcttc

[0178] aagcagctggctatgattttcatgagcgttctggctggtaacatgtatgaatctattggctttcagggcgcgtacctggtgctgggcttagtggcact

[0179] gggtttcaccctgatcagcgtctttaccctgagcggtccgggtccactgagcctgctgcgtcgccaggttaatgaagtggcctaaaagcttgcggccgcataatg.

[0180] SEQ ID NO: 24 (lacY-cz-F): ctttaagaaggagatataccatggatgtattacctaaaaaacac.

[0181] SEQ ID NO: 25 (lacY-cz-R): cattatgcggccgcaagcttttaggccacttcattaacctgg.

[0182] (b) using the artificially synthesized galE gene fragment (nucleotide sequence as shown in SEQ ID NO: 5) as a template, using the primer pair shown in SEQ ID NO: 26-27 to amplify and obtain the galE fragment; cloning the galE fragment into the NdeI and AvrⅡ sites of the pET-lacY vector to obtain the recombinant expression vector pET-lacY-galE, and introducing the recombinant expression vector pET-lacY-galE into the chassis cells constructed in step (2).

[0183] SEQ ID NO:5 (artificially synthesized galE gene fragment)

[0184] gaaggagatatacatatgaacatcctggtgaccggtggcaccggttttattggcagccataccgtggtgagtctgctgaaaagtggccatcaggt

[0185] tgttatctggataatctgtgcaatagcagcattaatattctgccgcgtctgaaaaccattaccggtcaggaaattccgttttatcagggtgatattcgt

[0186] gatcgcgaaattctgcgtcgtatttttgcagaaaatcgcattgatagcgttattcattttgcaggtctgaaagccgtgggcgaaagtgttgccgaacc

[0187] gattaaatattatgataataacgtgagcggcagcctggtgctggcagaagaaatggcccgcgcaggtgtgtttagcattgtgtttagtagtagtgc

[0188] aaccgtgtatggcgatccgggtaaagttccgtataccgaagatatgccgccgggcgataccaccagcccgtatggtgccagcaaaagcatggt

[0189] tgaacgcattctgaccgatattcagaaagcagatccgcgctggagcatgattctgctgcgttattttaatccgattggcgcccatgaaagcggtctg

[0190] attggtgaacagccgaatggcattccgaataatctgctgccgtatatttgccaggttgcagcaggcaaactgccgcagctggcagtttttggtgat

[0191] gattatccgaccccggatggcaccggtatgcgtgattatattcatgtgatggatctggccgaaggccatgttgccgcaatgcaggccaaaagtaa

[0192] tgttgcaggtacccatctgctgaatctgggtagtggtcgcgccagcagtgttctggaaattattcgtgcatttgaagcagccagcggcctgaccatt

[0193] ccgtttgaaattaaaccgcgccgcgccggcgatctggcctgtttttatgccgatccgagttataccaaagcacagattggttggcagacccagcgtgatctgacccagatgatggaagatagttggcgctgggttagcaatcatccgaatggttatgatgattaacctaggctgctgccaccg.

[0194] SEQ ID NO: 26 (galE-cz-F): gaaggagatatacatatgaacatcctggtgaccggtg.

[0195] SEQ ID NO: 27 (galE-cz-R): cggtggcagcagcctaggttaatcatcataaccattcgg.

[0196] The genetically engineered bacteria finally constructed in this example contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector and the pET-lacY-galE expression vector, and the lacZ gene, the fucIK gene and the wcaJ gene in the chassis strain are knocked out.

[0197] (4) Fermentation yield verification

[0198] (a) The constructed genetically engineered bacteria are inoculated into LB medium for activation culture to obtain seed liquid.

[0199] (b) The seed solution obtained in step (a) is transferred into a fermentation tank containing a fermentation medium, with an initial culture temperature of 37° C., a rotation speed of 250 rpm, a ventilation volume of 35 NL / min, a tank pressure of 0.06 MPa, and the dissolved oxygen content is controlled to be greater than 2 mg / L.

[0200] The formula of the fermentation medium includes: 150g peptone, 50g yeast extract powder, 100g (NH4)2SO4, 230g K2HPO4, 205g KH2PO4, 250g glycerol, 7.5g citric acid, 5mL defoamer, 250g glucose, 50g MgSO4·7H2O, 0.5g anhydrous CaCl2, 25mL 1000× vitamin B1, 250mL nitrilotriacetic acid, ddH2O fixed to 20L; pH value is 6.8.

[0201] (c) When the initial glycerol in the fermentation culture was completely consumed, glycerol was added to the fermenter at a rate of 3.4 g / L / h. The culture temperature was 30°C.

[0202] (d) After the carbon source in the base material is consumed and the dissolved oxygen rises, the carbon source is supplemented. Four hours after the carbon source is supplemented, the inducer IPTG is added, and lactose is supplemented. The lactose content and consumption are monitored to control the lactose content in the fermentation broth to 10 g / L to 20 g / L.

[0203] (e) The production of LNnT and the residual amount of LNT II in the fermenter after 112 h of cultivation were detected by HPLC. The results are shown in Table 1. The specific detection parameters and methods are as follows.

[0204] Reagents: sulfuric acid (chromatographic grade), pure water.

[0205] Instrument: High performance liquid chromatography with differential detection (HPLC-RID).

[0206] Liquid phase conditions: Bio-Rad column ( HPX-87H chromatographic column, 4.6×250mm, 5-Micron), column temperature of 60°C, 5mmol sulfuric acid aqueous solution as mobile phase for isocratic elution, running for 20min, flow rate of 0.5mL / min, detector temperature of 40°C, injection volume of 20μL.

[0207] Preparation of standard solution: Accurately weigh 50 mg (accurate to 0.1 mg) of LNnT / LNTⅡ standard into a 50 mL volumetric flask, dilute with pure water, and shake well. Use a pipette to draw 4 μL, 20 μL, 100 μL, 500 μL, and 1000 μL of the standard into a 1.5 mL injection vial, and then add 996 μL, 980 μL, 900 μL, 500 μL, and 0 μL of pure water to the corresponding injection vials, respectively, mix well, and load onto the instrument. The corresponding standard curve range is 4 μg / mL to 1000 μg / mL.

[0208] Preparation of sample solution: Take 10 ml of fermentation liquid and centrifuge at 12000r / min for 15min, take the supernatant, dilute the supernatant with pure water to the range of the standard curve, and pass the mixed sample through a 0.22 micron water filter membrane for testing.

[0209] Embodiment 2:

[0210] Compared with the genetically engineered bacteria constructed in Example 1, the genetically engineered bacteria constructed in this example further comprise an lgtB overexpression vector. The construction method and introduction method of the lgtB overexpression vector are as follows:

[0211] The artificially synthesized lgtB gene fragment (shown in SEQ ID NO:3) was used as a template and the primer pair shown in SEQ ID NO:28-29 was used to amplify to obtain the lgtB fragment; the lgtB fragment was cloned into the NcoI and AvrⅡ sites of the vector pCDFDuet-1 to obtain the recombinant expression vector pCDFDuet-lgtB.

[0212] SEQ ID NO: 28 (lgtB-cz-F): ctttaataaggagatataccatgcgtgtttttatcatcagcc.

[0213] SEQ ID NO: 29 (lgtB-cz-R): cggtggcagcagcctaggttacacgaactgccagtatttc.

[0214] The genetically engineered bacteria finally constructed in this example contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector, the pET-lacY-galE expression vector and the lgtB overexpression vector, and the lacZ gene, the fucIK gene and the wcaJ gene in the chassis strain are knocked out.

[0215] Embodiment 3:

[0216] Compared with the genetically engineered bacteria constructed in Example 1, the only difference is that the chassis cells are different. Specifically, the chassis cells used in this example are BL21 star (DE3) ΔnagB ΔwecB ΔlacZ. The modification method of BL21 star (DE3) ΔnagB ΔwecB ΔlacZ refers to step (1) of the example, wherein the knockout steps of the nagB gene and the wecB gene refer to the lacZ gene. The specific primer pairs and DNA sequence information used are as follows.

[0217] SEQ ID NO: 30 (nagB-UP-F): accatgatcgcttttggatgctgaacgcattgatacgattg.

[0218] SEQ ID NO: 31 (nagB-UP-R):cctgggcaataaacgcaac.

[0219] SEQ ID NO: 32 (nagB-DOWN-F): gcctgattcggatgttttgc.

[0220] SEQ ID NO: 33 (nagB-DOWN-R): caatcgtatcaatgcgttcagcatccaaaagcgatcatggt.

[0221] SEQ ID NO: 34 (nagB-yz-F): cggaccaacggttataggct.

[0222] SEQ ID NO: 35 (nagB-yz-R): gccagggtcactttggtaatg.

[0223] SEQ ID NO: 36 (wecB-UP-F): cctgaccatcaccatacgggcccttccagaatccgacag.

[0224] SEQ ID NO: 37 (wecB-UP-R): gtccaatgctccaggctcg.

[0225] SEQ ID NO: 38 (wecB-DOWN-F): cggcgtcataccaccaatc.

[0226] SEQ ID NO: 39 (wecB-DOWN-R): ctgtcggattctggaagggcccgtatggtgatggtcagg.

[0227] SEQ ID NO: 40 (wecB-yz-F): ccgccggatgaacagtattg.

[0228] SEQ ID NO: 41 (wecB-yz-R): aggcgaatcagttcccagac.

[0229] The genetically engineered bacteria finally constructed in this example contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector and the pET-lacY-galE expression vector, and the lacZ gene, nagB gene and wecB gene in the chassis strain are knocked out.

[0230] Embodiment 4:

[0231] Compared with the genetically engineered bacteria constructed in Example 1, the only difference is that the chassis cells are different. Specifically, the chassis cells used in this example are unmodified BL21 star (DE3).

[0232] The genetically engineered bacteria finally constructed in this example contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector and the pET-lacY-galE expression vector.

[0233] Comparative Example 1:

[0234] In the genetically engineered bacteria constructed in this comparative example, the chassis cells are unmodified Escherichia coli BL21 star (DE3); and the genetically engineered bacteria with transposition integration of lgtA2-lgtB2 are constructed according to the method described in step (3) of Example 1.

[0235] Comparative Example 2:

[0236] In the genetically engineered bacteria constructed in this comparative example, the chassis cells are unmodified Escherichia coli BL21 star (DE3); the genetically engineered bacteria with transposon integration of lgtA2-lgtB2-vag are constructed by referring to the method described in step (3) of Example 1.

[0237] Comparative Example 3:

[0238] Compared with the genetically engineered bacteria constructed in Example 1, the only difference is that the pET-lacY-galE expression vector is replaced by the pET-lacY expression vector; the specific construction method refers to Example 1.

[0239] The genetically engineered bacteria finally constructed in this comparative example contain the pSPIN-N32-lgtA2-lgtB2-vag integration vector and the pET-lacY expression vector, and the lacZ gene, the fucIK gene and the wcaJ gene in the chassis strain are knocked out.

[0240] Comparative Example 4:

[0241] Compared with the genetically engineered bacteria constructed in Example 1, the difference is that the pSPIN-N32-lgtA2-lgtB2-vag integration vector is replaced by the pSPIN-N32-lgtA2-lgtB2 integration vector; the specific construction method refers to Example 1.

[0242] The genetically engineered bacteria finally constructed in this comparative example contain the pSPIN-N32-lgtA2-lgtB2 integration vector and the pET-lacY-galE expression vector, and the lacZ gene, the fucIK gene and the wcaJ gene in the chassis strain are knocked out.

[0243] The final product yield and the intermediate product residue of the genetically engineered bacteria constructed in Examples 1 to 4 and Comparative Examples 1 to 4 were detected according to the method described in step (4) of Example 1. The results are shown in Table 1.

[0244] Table 1

[0245]

[0246] As shown in Table 1 above, the genetically engineered bacteria constructed in Examples 1 to 4 of the present application can effectively increase the fermentation rate of LNnT production and reduce the residual amount of LNT II in the final system. However, the genetically engineered bacteria constructed in Comparative Examples 1 to 4 not only have high LNT II residual amount, but also low LNnT production.

[0247] The technical features of the above-described embodiments may be arbitrarily combined. To make the description concise, not all possible combinations of the technical features in the above-described embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0248] The above-mentioned embodiments only express several implementation methods of the present application, and the descriptions thereof are relatively specific and detailed, but they cannot be understood as limiting the scope of the invention patent. It should be pointed out that, for a person of ordinary skill in the art, several variations and improvements can be made without departing from the concept of the present application, and these all belong to the protection scope of the present application. Therefore, the protection scope of the present application shall be subject to the attached claims.

Claims

1. A genetically engineered bacterium for producing lactose-N-neotetraose, characterized in that: The genetically engineered bacteria meet the following conditions: (1) exogenously expressing the MFS transporter, β-1,3-N-acetylglucosamine transferase, and β-1,4-galactosyltransferase; and (2) Overexpression of galactoside permease and UDP-galactose-4-isomerase.

2. The genetically engineered bacteria for producing lactose-N-neotetraose according to claim 1, characterized in that: The MFS transporter protein includes one or more of bad protein, fred protein, nec protein, marc protein and vag protein.

3. The genetically engineered bacteria for producing lactose-N-neotetraose according to claim 2, characterized in that: The genetically engineered bacteria meets at least one of the following conditions (1) to (5): (1) The nucleotide sequence encoding the vag protein is shown in SEQ ID NO: 1; (2) The nucleotide sequence encoding the β-1,3-N-acetylglucosamine transferase is shown in SEQ ID NO: 2; (3) The nucleotide sequence encoding the β-1,4-galactosyltransferase is shown in SEQ ID NO: 3; (4) the gene encoding the galactoside permease is the lacY gene, and the nucleotide sequence encoding the galactoside permease is shown in SEQ ID NO: 4; and (5) The gene encoding the UDP-galactose-4-epimerase is the galE gene, and the nucleotide sequence encoding the UDP-galactose-4-epimerase is shown in SEQ ID NO:

5.

4. The genetically engineered bacteria for producing lactose-N-neotetraose according to any one of claims 1 to 3, characterized in that The genetically engineered bacteria include bacteria; Optionally, the bacteria include one or more of Escherichia coli and Bacillus subtilis; Further optionally, the Escherichia coli includes Escherichia coli BL21 (DE3).

5. The genetically engineered bacteria for producing lactose-N-neotetraose according to claim 4, characterized in that: The genome of the genetically engineered bacteria contains one or more of the wcaJ gene, lacZ gene, fucIK gene, nagB gene and wecB gene that are missing or inactivated.

6. The genetically engineered bacteria for producing lactose-N-neotetraose according to claim 5, characterized in that: The genetically engineered bacteria meets at least one of the following conditions (1) to (2): (1) the genome of the genetically engineered bacteria contains deletion or inactivation of the wcaJ gene, lacZ gene and fucIK gene; and (2) The genome of the genetically engineered bacteria comprises a deletion or inactivation of the nagB gene, the wecB gene and the lacZ gene.

7. The genetically engineered bacteria for producing lactose-N-neotetraose according to any one of claims 1 to 3, 5 and 6, characterized in that: The insertion sites of the MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyl transferase are yjiP, hlyE, wecB, nagB, lacZ, setA, gloA, ugd or IS186.

8. The method for constructing a genetically engineered bacterium for producing lactose-N-neotetraose according to any one of claims 1 to 7, characterized in that: The steps include: Introducing an integration vector expressing the MFS transporter, β-1,3-N-acetylglucosamine transferase and β-1,4-galactosyl transferase into the genetically engineered bacteria to be transformed; and The recombinant vector over-expressing galactoside permease and UDP-galactose-4-epimerase is introduced into the genetic engineering bacteria to be transformed to construct the genetic engineering bacteria producing lactose-N-neotetraose.

9. A method for preparing lactose-N-neotetraose, characterized in that: The steps include: The genetically engineered bacteria according to any one of claims 1 to 7 are fermented and cultured to prepare lactose-N-neotetraose.

10. A method for producing a dairy product, characterized in that: The steps include: Using the preparation method of claim 9 to prepare lactose-N-neotetraose; and A dairy product is prepared using the lactose-N-neotetraose.

Images