KASP primer composition, reaction system and application in detecting rs671 polymorphic site of ALDH2 gene

Abstract

The invention discloses a KASP primer composition, a reaction system and application of the KASP primer composition in detection of an ALDH2 gene rs671 polymorphic site, and relates to the technical field of biology. According to the invention, a KASP typing technology which is more popular in recent years is adopted, a universal probe is used in the KASP technology and is located in a reaction system, and detection can be carried out only by synthesizing a common amplification primer during detection. Two pairs of universal probes are respectively complementary with a first tag sequence and a second tag sequence, so that amplification products of different genotypes are subjected to fluorophore labeling, and different SNPs correspond to different fluorescence signals. And a typing result can be obtained by collecting and analyzing a fluorescence signal. The primer composition and the kit provided by the invention can realize accurate, rapid, simple and convenient detection of the SNP at the rs671 site of the ALDH2 gene, have the advantages of high sensitivity, strong specificity, simple operation procedure, short detection time and the like, and have wide application prospects.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a KASP primer composition, a reaction system and an application thereof in detecting the rs671 polymorphic site of an ALDH2 gene. Background Art

[0002] Acetaldehyde dehydrogenase, abbreviated as ALDH, is a type of aldehyde dehydrogenase, responsible for catalyzing the oxidation of acetaldehyde to acetic acid. Alcohol dehydrogenase in the liver is responsible for oxidizing ethanol (a component of wine) to acetaldehyde. The generated acetaldehyde is further converted into harmless acetic acid (a component of vinegar) as a substrate under the catalysis of acetaldehyde dehydrogenase.

[0003] ALDH2 gene, full name: acetaldehyde dehydrogenase 2, acetaldehyde dehydrogenase 2, is located on human chromosome 12. ALDH2 has both acetaldehyde dehydrogenase and esterase activities and is involved in the metabolism of drugs such as ethanol and nitroglycerin. ALDH2 metabolizes and activates nitroglycerin into its active metabolite nitric oxide. ALDH2*2 (Glu504Lys, rs671) polymorphism causes the glutamic acid at position 504 of the encoded protein to be replaced by lysine, and the ALDH2 enzyme activity of individuals carrying the mutant allele (ALDH2*2) decreases. ALDH2 is the key enzyme for the decomposition of acetaldehyde in the body. The frequency of acetaldehyde dehydrogenase 2 (ALDH2*2) is highest in Asian populations.

[0004] After ALDH2 mutation, the enzyme activity is lost, resulting in a large accumulation of acetaldehyde in the liver, causing discomfort such as blushing after drinking. The ALDH2 genotype directly affects the clearance rate of acetaldehyde in the body. People with normal ALDH2 genes can decompose acetaldehyde into water and carbon dioxide in time; people with abnormal ALDH2 genes cannot quickly complete the alcohol metabolism process, resulting in acetaldehyde accumulation in the body. Drinking a small amount of alcohol will cause discomfort such as blushing and accelerated heartbeat, which is easy to cause damage to the liver, kidneys, heart, and brain. Therefore, people with ALDH2 gene mutations are a high-risk group for many clinical diseases.

[0005] When the ALDH2 gene is normal (GG), it can metabolize acetaldehyde normally; when the gene is completely mutated (AA), it basically loses the ability to metabolize acetaldehyde, and the risk of alcohol-related colon cancer, esophageal cancer, etc. is higher than that of people with normal genes. Therefore, it is particularly important to establish an accurate, flexible, rapid and economical method for genotyping the rs671 locus of the ALDH2 gene.

[0006] Currently, the main methods for SNP typing detection are Taqman probe method and first-generation sequencing. Taqman probe method is fast and accurate, but the cost of a single synthetic probe is expensive; while first-generation sequencing technology is the gold standard, but it also has the disadvantages of being expensive and having a slightly longer detection cycle.

[0007] In view of this, the present invention is proposed. Summary of the invention

[0008] The purpose of the present invention is to provide a KASP primer composition, a reaction system and an application in detecting the rs671 polymorphic site of the ALDH2 gene to solve the above technical problems.

[0009] The present invention is achieved in that:

[0010] In a first aspect, the present invention provides a KASP primer composition for detecting the rs671 polymorphic site of the ALDH2 gene, comprising: 2 forward primers and 1 reverse primer, wherein the sequence of one forward primer comprises: 5'-first tag sequence-(N)nG-3', and the sequence of the other forward primer comprises: 5'-second tag sequence-(N)nA, the first tag sequence and the second tag sequence are respectively complementary to two pairs of universal probes with fluorescent groups, N is selected from at least one of A, T, C and G, n is 15-35, and the reverse primer sequence is shown in SEQ ID NO: 3.

[0011] In a second aspect, the present invention provides a reaction system for detecting the rs671 polymorphic site of the ALDH2 gene, which comprises the above-mentioned KASP primer composition and an amplification reaction premix.

[0012] In a third aspect, the present invention provides a kit or a gene chip, which comprises the above-mentioned KASP primer composition or the above-mentioned reaction system.

[0013] In a fourth aspect, the present invention provides an application of a KASP primer composition or the above-mentioned reaction system in preparing a kit or a gene chip for detecting the rs671 polymorphic site of the ALDH2 gene, the application comprising the following steps: mixing a sample to be tested with the KASP primer composition, performing an amplification reaction, the amplification reaction being a conventional PCR or a touchdown PCR, collecting a fluorescent signal, and obtaining a typing result.

[0014] The present invention has the following beneficial effects:

[0015] The present invention adopts the KASP (Kompetitive Allele-Specific PCR) typing technology which has been popular in recent years, namely competitive allele-specific PCR. This method is similar to the Taqman probe method and also uses dual fluorescent labeling, but the KASP technology uses universal probes, which are located in the reaction mixture (i.e., the reaction system). During detection, only ordinary amplification primers need to be synthesized for detection. KASP is based on the reading judgment of the terminal fluorescence signal. Each well reaction uses dual-color fluorescence to detect two genotypes of a SNP site. Two pairs of universal probes are complementary to the first label sequence and the second label sequence respectively, so that the amplified products of different genotypes are labeled with fluorescent groups, so that different SNPs correspond to different fluorescent signals. By collecting and analyzing the fluorescent signals, the typing results can be obtained.

[0016] The primer combination and kit provided by the present invention can realize accurate, rapid and convenient detection of SNP at the rs671 site of the ALDH2 gene, and have the advantages of high sensitivity, strong specificity, simple operation procedure, short detection time, etc., and have broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0018] Figure 1 The test results of three typing standards detected by the kit in Example 2 of the present invention (two replicates for each standard);

[0019] Figure 2 The results of the sensitivity test of three typing standards detected by the kit in Example 3 of the present invention (two replicates for each standard);

[0020] Figure 3 This is a graph showing the test results of 15 oral swab samples from the kit in Example 4 of the present invention;

[0021] Figure 4 The test results of the three typing standards detected by the kit in Example 5 (two replicates for each standard);

[0022] Figure 5 The results of the detection of three typing standards when the molar ratio of two forward primers and reverse primer for amplifying the ALDH2 gene fragment was 1:1:1. DETAILED DESCRIPTION

[0023] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0024] In a first aspect, the present invention provides a KASP primer composition for detecting the rs671 polymorphic site of the ALDH2 gene, comprising: 2 forward primers and 1 reverse primer, wherein the sequence of one forward primer comprises: 5'-first tag sequence-(N)nG-3', and the sequence of the other forward primer comprises: 5'-second tag sequence-(N)nA, the first tag sequence and the second tag sequence are respectively complementary to two pairs of universal probes with fluorescent groups, N is selected from at least one of A, T, C and G, n is 15-35, and the reverse primer sequence is shown in SEQ ID NO: 3.

[0025] The forward primer sequence having the following sequence can bind to the template DNA of rs671 genotype GG or GA: 5'-first tag sequence-(N)nG-3';

[0026] The forward primer sequence with the following sequence can bind to the template DNA of rs671 genotype AA or GA: 5'-second label sequence-(N)nA. When the rs671 genotype of the template DNA is AA, only one pair of universal probes can complement the first label sequence of the template DNA, thereby stimulating the fluorescence signal on the universal probe. When the rs671 genotype of the template DNA is GG, only the other pair of universal probes can complement the second label sequence of the template DNA, thereby stimulating the fluorescence signal on the universal probe. When the rs671 genotype of the template DNA is GA, both forward primers can competitively complement the template DNA, and accordingly, both pairs of universal probes can complement the label sequences on the two forward primers, thereby stimulating the fluorescence signal on the universal probe. By detecting the intensity of the fluorescence signal, the rs671 genotype of the template DNA can be typed.

[0027] The upstream sequence of the universal probe carries a fluorescent reporter group, and the downstream sequence carries a corresponding fluorescent quencher group. When no amplification occurs, the universal probe is affected by the quencher group and does not emit a fluorescent signal.

[0028] The last nucleotide at the 3' end of the forward primer is the SNP site. As long as the SNP site can be covered, the length of the forward primer can be adjusted as needed.

[0029] The (N)n of the two forward primers is the same, and their length can be 15nt, 16nt, 17nt, 18nt, 19nt, 20nt, 21nt, 22nt, 23nt, 24nt, 25nt, 26nt, 27nt, 28nt, 29nt, 30nt, 31nt, 32nt, 33nt, 34nt or 35nt.

[0030] The nucleotide sequence in the primer composition provided by the present invention may or may not have nucleic acid modification.

[0031] In a preferred embodiment of the present invention, the first tag sequence is GAAGGTGACCAAGTTCATGCT, and the second tag sequence is GAAGGTCGGAGTCAACGGATT.

[0032] In a preferred embodiment of the present invention, one forward primer sequence is shown as SEQ ID NO: 1, and the other forward primer sequence is shown as SEQ ID NO: 2.

[0033] In order to achieve the best differentiation effect of SNP typing, the inventor optimized the primer design. After creative work, the present invention screened and obtained the above-mentioned amplification primer pair that can specifically amplify and avoid interference from other primers. Compared with existing technology platforms, such as fluorescent quantitative PCR technology or first-generation sequencing technology, these technology platforms have the disadvantage of high cost, and the present invention has lower detection cost.

[0034] In a preferred embodiment of the present invention, the molar ratio of two forward primers to one reverse primer in the KASP primer composition is (0.5-1):(0.5-1):(1-2.5). In order to achieve the best differentiation effect for SNP typing, the inventors optimized the reaction conditions, and achieved a better typing effect under the above mixing molar ratio.

[0035] The molar ratio of two forward primers to one reverse primer in the KASP primer composition is, for example, 0.5:0.5:1, or 0.6:0.6:1, or 0.6:0.6:2, or 0.8:0.8:2.5, or 1:1:2.5, or 1:1:2.2, or 0.5:1:2.5.

[0036] In a second aspect, the present invention provides a reaction system for detecting the rs671 polymorphic site of the ALDH2 gene, which comprises the above-mentioned KASP primer composition and an amplification reaction premix.

[0037] In a preferred embodiment of the present invention, the final concentrations of the two forward primers and one reverse primer in the reaction system are 40-100 nM, for example, 40-90 nM, 50-80 nM, or 60-100 nM.

[0038] In a preferred embodiment of the present invention, the amplification reaction premix includes: DNA polymerase, dNTPs, Mg 2+ and reaction buffer.

[0039] In a preferred embodiment of the present invention, the reaction system further comprises a standard substance, which comprises a plasmid of the GG genotype of rs671, a plasmid of the AG genotype, and a plasmid of the AA genotype. The sequences of the plasmid of the GG genotype of rs671, the plasmid of the AG genotype, and the plasmid of the AA genotype are respectively as follows.

[0040] GG genotype plasmid sequence SEQ ID NO: 8:

[0041] AAGTTAAAAATAAAATAAAGACTTTGGGGCAATACAGGGGGTCCTGGGAGTGTAACCCATAACCCCCAAGAGTGATTTCTGCAATCTCGTTTCAAATTACAGGGTCAACTGCTATGATGTGTTTGGAGC CCAGTCACCCTTTGGTGGCTACAAGATGTCGGGGAGTGGCCGGGAGTTGGGCGAGTACGGGCTGCAGGCATACACTGAAGTGAAAACTGTGAGTGTGGGACCTGCTGGGGGCTCAGGGCCTGTTGGGGC TTGAGGGTCTGCTGGTGGCTCGGAGCCTGCTGGGGGATTGGGGTCTGTTGGGGGCTCGGGGCCTGCCAGAGGTTCAGGACCTGCCGGGGACTCAGGGCCTGCTGGAAGTTCAGGACCTGCTGGGGATCA GGGCCTGCCAGGGATTTAGGGTCTGCTGGGCGGGCCACCTTTTGGCCTCTCCCTCATGCTTGAGGCCATCAGTGTTTCCTACTAATTTCCCATTTTAAGCCTGAGAAGTGACAAGAGAGGGTAAAGAC.

[0042] AA genotype plasmid sequence SEQ ID NO: 9:

[0043] AAGTTAAAAATAAAATAAAGACTTTGGGGCAATACAGGGGGTCCTGGGAGTGTAACCCATAACCCCCAAGAGTGATTTCTGCAATCTCGTTTCAAATTACAGGGTCAACTGCTATGATGTGTTTGGAGC CCAGTCACCCTTTGGTGGCTACAAGATGTCGGGGAGTGGCCGGGAGTTGGGCGAGTACGGGCTGCAGGCATACACTAAAGTGAAAACTGTGAGTGTGGGACCTGCTGGGGGCTCAGGGCCTGTTGGGGC TTGAGGGTCTGCTGGTGGCTCGGAGCCTGCTGGGGGATTGGGGTCTGTTGGGGGCTCGGGGCCTGCCAGAGGTTCAGGACCTGCCGGGGACTCAGGGCCTGCTGGAAGTTCAGGACCTGCTGGGGATCA GGGCCTGCCAGGGATTTAGGGTCTGCTGGGCGGGCCACCTTTTGGCCTCTCCCTCATGCTTGAGGCCATCAGTGTTTCCTACTAATTTCCCATTTTAAGCCTGAGAAGTGACAAGAGAGGGTAAAGAC.

[0044] AG plasmid is prepared by mixing AA genotype plasmid and GG genotype plasmid in equal proportions.

[0045] In a preferred embodiment of the present invention, the reaction system further comprises two pairs of universal probes, wherein the upstream sequence and the downstream sequence of one pair of universal probes are shown as SEQ ID NO: 4 and SEQ ID NO: 5, respectively, and the upstream sequence and the downstream sequence of the other pair of universal probes are shown as SEQ ID NO: 6 and SEQ ID NO: 7, respectively;

[0046] serial number sequence SEQ ID NO: 4 GAAGGTGACCAAGTTCATGCT SEQ ID NO: 5 AGCATGAACTTGGTCACCTTC SEQ ID NO: 6 GAAGGTCGGAGTCAACGGATT SEQ ID NO: 7 AATCCGTTGACTCCGACCTTC

[0047] In a preferred embodiment of the present invention, the final concentrations of the two pairs of universal probes in the reaction system are 150-200 nM respectively; the upstream sequences of the two pairs of universal probes are both provided with fluorescent reporter groups, and the downstream sequences are both provided with quencher groups. For example, the fluorescent reporter groups are selected from FAM, VIC, HEX, JOE, ROX, and Cy5, and the fluorescent quencher groups are selected from BHQ1, BHQ2, and TAMRA.

[0048] The final concentrations of the two pairs of universal probes in the reaction system were 150 nM, 160 nM, 170 nM, 180 nM, 190 nM or 200 nM, respectively.

[0049] In a preferred embodiment of the present invention, the reaction system further comprises template DNA.

[0050] In a third aspect, the present invention provides a kit or a gene chip, which includes the above-mentioned KASP primer composition or the above-mentioned reaction system. For example, the above-mentioned KASP primer composition is embedded in a chip for typing detection.

[0051] In a fourth aspect, the present invention provides an application of a KASP primer composition or the above-mentioned reaction system in preparing a kit or a gene chip for detecting the rs671 polymorphic site of the ALDH2 gene, the application comprising the following steps: mixing a sample to be tested with the KASP primer composition, performing an amplification reaction, the amplification reaction being a conventional PCR or a touchdown PCR, collecting a fluorescent signal, and obtaining a typing result.

[0052] In a preferred embodiment of the present invention, when the amplification reaction is touchdown PCR, the amplification reaction conditions include:

[0053] At 95°C, 2-5 minutes; touchdown amplification program: denaturation at 95°C for 5-10 seconds, annealing and extension at 61°C-55°C (-0.6°C / cycle) for 30 seconds, 10 cycles; denaturation at 95°C for 5-10 seconds, annealing and extension at 55°C for 30 seconds, 26 cycles; fluorescence signal detection based on fluorescence quantitative PCR instrument, and analysis of typing;

[0054] In a preferred embodiment of the present invention, if the typing is insufficient, the number of cycles is increased, the annealing extension temperature of the additional cycle is 57°C, and the fluorescence signal detection is performed after every 3 additional cycles;

[0055] In a preferred embodiment of the present invention, cluster analysis is performed on the fluorescence signal (based on the analysis software provided by the fluorescence quantitative PCR instrument) to obtain the typing results.

[0056] When the amplification reaction is a common PCR, the following amplification program is set: at 95°C for 2 to 5 minutes; amplification program: 95°C denaturation for 5 to 10 seconds, 61°C to 55°C annealing and extension for 30 seconds, 10 cycles; 95°C denaturation for 5 to 10 seconds, 55°C annealing and extension for 30 seconds, 26 cycles. Fluorescence signals are detected based on a fluorescence quantitative PCR instrument or a fluorescence reader, and the typing is analyzed.

[0057] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0058] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0059] Example 1

[0060] This embodiment provides a primer combination for detecting SNP typing at the rs671 site of the ALDH2 gene, and a kit based on the primer combination.

[0061] (1) Design of forward primers and reverse primers: First, the genomic sequence of ALDH2 was downloaded from the genbank database, and primers were designed near the SNP site. In this embodiment, the designed primer sequences are shown in Table 1. The tilted sequence in F1 is the first tag sequence, and the tilted sequence in F2 is the second tag sequence.

[0062] Table 1. Specific sequence list of forward primer and reverse probe in primer-probe combination

[0063] Primer or probe name Primer or probe sequence (5'-3') F1 GAAGGTGACCAAGTTCATGCTGAGTACGGGCTGCAGGCATCACTG SEQ ID NO: 1 F2 GAAGGTCGGAGTCAACGGATTGAGTACGGGCTGCAGGCATACACTA SEQ ID NO: 2 R GCCCCCAGCAGGTCCCACACTCACAGTTT SEQ ID NO: 3

[0064] (2) Providing a kit: Providing a kit for detecting rs671 SNP typing of the ALDH2 gene, which also includes an amplification reagent. The amplification reagent includes two pairs of universal probe compositions for rs671 SNP typing as described above, as well as a buffer, dNTPs, Taq enzyme and other solutions. The detection reagent used is IIProbe qPCR SuperMix probe method fluorescence quantitative premix reagent II (Cat. No. AQ711, Beijing Quanshijin Biotechnology)

[0065] The sequences of the two pairs of universal probes are as follows:

[0066] serial number sequence SEQ ID NO: 4 GAAGGTGACCAAGTTCATGCT SEQ ID NO: 5 AGCATGAACTTGGTCACCTTC SEQ ID NO: 6 GAAGGTCGGAGTCAACGGATT SEQ ID NO: 7 AATCCGTTGACTCCGACCTTC

[0067] The molar concentration ratio of the forward primer and the reverse primer for amplifying the ALDH2 gene fragment is 1:1:2.5.

[0068] Example 2

[0069] In this embodiment, a detection method for detecting SNP typing at the rs671 site of the ALDH2 gene is provided, and the detection method is specifically as follows:

[0070] (1) Add primer mix (i.e., primer F1, primer F2, and primer R) to the amplification reagent, then add appropriate amounts of three typing standards (plasmids of rs671 GG type samples, plasmids of AG type samples, and plasmids of AA type samples), and add nuclease-free water to 15 μL; in the reaction system, the final concentration of forward primer F1 is 300 nM, the final concentration of forward primer F2 is 300 nM, and the final concentration of reverse primer R is 750 nM; the final concentration of the two pairs of universal probes is 160 nM. The GG genotype plasmid sequence is shown in SEQ ID NO: 8, the AA genotype plasmid sequence is shown in SEQ ID NO: 9, and the AG plasmid is prepared by mixing the AA genotype plasmid and the GG genotype plasmid in equal proportions.

[0071] The reaction system is shown in Table 2:

[0072] Table 2. Reaction system table for amplification reaction

[0073] Components Addition volume (total volume 15 μL) Amplification reagents 7.5μL Primer mix 0.42 Template (standard) 2μL Nuclease-free water 15μL

[0074] (2) The specific amplification program is 95℃ pre-denaturation for 5 minutes; 10 cycles of touchdown program amplification: 95℃ denaturation for 5 seconds, 61℃~55℃ (-0.6℃ / cycle) annealing and extension for 30 seconds; 26 cycles of amplification: 95℃ denaturation for 5 seconds, 55℃ annealing and extension for 30 seconds. The fluorescence signal was detected using the 7500Real-Time PCR System and the typing was analyzed using the clustering analysis software provided by the fluorescence quantitative analyzer. If the typing is not sufficient, continue to add cycles, and the annealing and extension temperature of the added cycles is changed to 57℃. After each additional 3 cycles, the fluorescence signal is detected until the typing is sufficient.

[0075] Test results such as Figure 1 As shown. According to the results, the cluster diagrams of the three typing standards can clearly distinguish that the blue dot in the upper left corner represents the homozygous GG typing, the red dot in the lower right corner represents the homozygous AA typing, and the green dot in the middle position represents the heterozygous AG typing. This shows that the kit provided by the present invention has a good typing effect.

[0076] Example 3

[0077] For the kit in Example 1, a sensitivity test was performed, and the specific steps are as follows:

[0078] (1) Dilute the 3000 copies / μL standards of the three typing methods with DNA diluent to obtain a 500 copies / μL detection limit reference. Perform two replicates for each reference.

[0079] (2) Add primer mix to the amplification reagent, then add detection limit reference, and make up to 15 μL with nuclease-free water;

[0080] (3) Pre-denaturation at 95°C for 5 minutes; 10 cycles of touchdown amplification: denaturation at 95°C for 5 seconds, annealing and extension at 61°C to 55°C (-0.6°C / cycle) for 30 seconds; 26 cycles of amplification: denaturation at 95°C for 5 seconds, annealing and extension at 55°C for 30 seconds. Use the 7500 Real-Time PCR System to detect the fluorescence signal and analyze the typing results;

[0081] The experimental results are as follows Figure 2 As shown, the detection limit reference materials of the three types can all be detected, and the clusters are clear, indicating that the kit provided by the present invention has good detection sensitivity.

[0082] Example 4

[0083] The kit in Example 1 was tested with oral swab samples of different types. The oral swab samples were collected from internal employees of the company. All participants who provided samples were voluntary. The standard oral swab collection method was used and the samples were collected by trained personnel. The specific operation steps are as follows:

[0084] (1) Take oral swab samples;

[0085] Table 3. Oral swab sample information table

[0086] Sample name rs671 genotype Sample name rs671 genotype Sample 1 GG Sample 8 AA Sample 2 GG Sample 9 GA Sample 3 GG Sample 10 GA Sample 4 GG Sample 11 GA Sample 5 GG Sample 12 GA Sample 6 GG Sample 13 GA Sample 7 GG ddH2O -

[0087] (2) Add primer mix to the amplification reagent, then add an appropriate amount of template and fill to 15 μL with nuclease-free water;

[0088] (3) Pre-denaturation at 95°C for 5 minutes; 10 cycles of touchdown amplification: denaturation at 95°C for 5 seconds, annealing and extension at 61°C to 55°C (-0.6°C / cycle) for 30 seconds; 26 cycles of amplification: denaturation at 95°C for 5 seconds, annealing and extension at 55°C for 30 seconds. Use the 7500 Real-Time PCR System to detect the fluorescence signal and analyze the typing results;

[0089] The experimental results are as follows Figure 3 As shown, the results show that the detection kit provided by the present invention can accurately perform genotyping on oral swabs.

[0090] Example 5

[0091] Compared with Example 1, the difference is that the forward primer sequence is different, and the tag sequence in the forward primer is the same. Specifically, the specific sequences of the forward primer and the reverse probe in the primer-probe composition are shown in Table 4.

[0092] Table 4. Specific sequence list of forward primer and reverse probe in primer-probe combination

[0093] Primer or probe name Primer or probe sequence (5'-3') F1 GAAGGTGACCAAGTTCATGCT GTCCCACACTCACAGTTTTCACTTT F2 GAAGGTCGGAGTCAACGGATTGTCCCACACTCACAGTTTTCACTTC R CGGGAGTTGGGCGAGTACGGGCTGCAGGC

[0094] The molar concentration ratio of the forward primer and the reverse primer for amplifying the ALDH2 gene fragment was 1:1:2.5. The amplification reaction conditions were the same as in Example 2, and three typing standards (the plasmid of the GG type sample of rs671, the plasmid of the AG type sample and the plasmid of the AA type sample) were tested. The typing results refer to Figure 4 As shown, the results showed that the standards could be accurately typed.

[0095] Example 6

[0096] Compared with Example 2, the molar ratio of the two forward primers and the reverse primer used to amplify the ALDH2 gene fragment in this example is 1:1:1, and the typing results are shown in Table 2. Figure 5 shown.

[0097] In summary, the primer combination provided by the present invention can detect the SNP typing of rs671 of the ALDH2 gene. The technology and method based on the primer-probe combination can achieve accurate, rapid and simple detection, and has the advantages of high sensitivity, strong specificity, simple operation procedure, short detection time, etc., and has broad application prospects.

[0098] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A KASP primer composition for detecting the rs671 polymorphic site of the ALDH2 gene, characterized in that: It includes: 2 forward primers and 1 reverse primer, wherein the sequence of one of the forward primers includes: 5'-first label sequence-(N)nG-3', and the sequence of the other forward primer includes: 5'-second label sequence-(N)nA, the first label sequence and the second label sequence are respectively complementary to two pairs of universal probes with fluorescent groups, N is selected from at least one of A, T, C and G, n is 15-35, and the sequence of the reverse primer is shown in SEQ ID NO:

3.

2. The KASP primer composition according to claim 1, characterized in that The first tag sequence is GAAGGTGACCAAGTTCATGCT, and the second tag sequence is GAAGGTCGGAGTCAACGGATT; Preferably, one of the forward primer sequences is as shown in SEQ ID NO: 1, and the other forward primer sequence is as shown in SEQ ID NO: 2; Preferably, the molar ratio of the two forward primers to the one reverse primer in the KASP primer composition is (0.5-1):(0.5-1):(1-2.5).

3. A reaction system for detecting the rs671 polymorphic site of the ALDH2 gene, characterized in that: The method comprises the KASP primer composition as described in any one of claims 1 to 2 and an amplification reaction premix.

4. The reaction system according to claim 3, characterized in that The final concentrations of the two forward primers and one reverse primer in the reaction system are 40-100 nM, respectively.

5. The reaction system according to claim 3, characterized in that: The amplification reaction premix includes: DNA polymerase, dNTPs, Mg 2+ and reaction buffer.

6. The reaction system according to claim 5, characterized in that The reaction system further comprises two pairs of universal probes, wherein the upstream sequence and the downstream sequence of one pair of universal probes are shown in SEQ ID NO: 4 and SEQ ID NO: 5, respectively, and the upstream sequence and the downstream sequence of the other pair of universal probes are shown in SEQ ID NO: 6 and SEQ ID NO: 7, respectively; Preferably, the final concentrations of the two pairs of universal probes in the reaction system are 150-200 nM respectively; the upstream sequences of the two pairs of universal probes both carry fluorescent reporter groups, and the downstream sequences both carry quencher groups.

7. The reaction system according to claim 6, characterized in that The reaction system also includes standards, which include: a plasmid of the GG genotype of rs671, a plasmid of the AG genotype, and a plasmid of the AA genotype.

8. The reaction system according to claim 7, characterized in that The reaction system also includes template DNA.

9. A kit or gene chip, characterized in that: It comprises the KASP primer composition according to any one of claims 1 to 2 or the reaction system according to any one of claims 3 to 8.

10. Use of the KASP primer composition according to any one of claims 1 to 2 or the reaction system according to any one of claims 3 to 8 in preparing a kit or gene chip for detecting the rs671 polymorphic site of the ALDH2 gene, characterized in that: The application comprises the following steps: mixing the sample to be tested with the KASP primer composition, performing an amplification reaction, wherein the amplification reaction is a common PCR or a touchdown PCR, collecting a fluorescent signal, and obtaining a typing result; Preferably, when the amplification reaction is touchdown PCR, the amplification reaction conditions include: At 95°C, 2-5 minutes; touchdown amplification program: denaturation at 95°C for 5-10 seconds, annealing and extension at 61°C-55°C (-0.6°C / cycle) for 30 seconds, 10 cycles; denaturation at 95°C for 5-10 seconds, annealing and extension at 55°C for 30 seconds, 26 cycles; fluorescence signal detection based on fluorescence quantitative PCR instrument, and analysis of typing; Preferably, if typing is insufficient, the number of cycles is increased, the annealing extension temperature of the additional cycle is 57°C, and fluorescence signal detection is performed after every 3 additional cycles; Preferably, cluster analysis is performed on the fluorescence signals to obtain typing results.

Images