Application of hsacirc0003258 in prevention and / or treatment of hepatic ischemia reperfusion injury

Abstract

The invention discloses an application of hsacirc0003258 in the prevention and / or treatment of liver ischemia reperfusion injury. According to the application disclosed by the invention, through detection, the expression of hsacirc0003258 in a liver ischemia reperfusion patient is obviously reduced; the overexpressed hsacirc0003258 constructed by using the lentiviral vector can significantly inhibit macrophage inflammation and the apoptosis level of liver cells after hypoxia and reoxygenation treatment, and improve the functions of the liver cells; the hsacirc0003258 plays a protective role in relieving the hepatic ischemia reperfusion injury, and has the potential to become a medicine for treating the hepatic ischemia reperfusion injury.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of hsa_circ_0003258 in preventing and / or treating liver ischemia-reperfusion injury. Background Art

[0002] As the mortality and incidence of liver diseases have increased significantly worldwide, the number of patients with end-stage liver diseases has increased year by year. Liver transplantation has become the best treatment, but hepatic ischemia reperfusion injury (HIRI) is an inevitable complication during liver resection and liver transplantation, which seriously affects the treatment effect. After the liver is ischemic and blood flow is restored, the activation of hepatic macrophages and the release of inflammatory factors will lead to further aggravation of hepatocyte functional metabolic disorders and tissue structural damage, which is a risk factor for early liver failure in recipients and high morbidity and mortality. These pathological events promote each other, resulting in severe or even irreversible liver dysfunction, which seriously hinders the treatment effect of surgical transplantation. Therefore, in-depth analysis of the pathological process of hepatic ischemia reperfusion injury and targeted search for prevention and treatment targets are not only of great theoretical significance for accurate diagnosis and prevention, but also have urgent clinical needs.

[0003] Circular RNA (circRNA) is a new type of long non-coding RNA, characterized by covalently closed continuous loops and strong stability. Its main function is to act as a sponge for adsorbing miRNA, translating into proteins, and regulating transcription. It is reported to play an important role in a variety of liver diseases. Therefore, the purpose of the present invention is to reveal the prevention and treatment targets of liver ischemia-reperfusion injury, which will help provide a new scientific basis for its prevention and treatment. The present invention belongs to the fields of genetic engineering, life sciences, medicine, etc., and specifically relates to the application of hsa_circ_0003258 in the prevention and / or treatment of liver ischemia-reperfusion injury.

[0004] Studies have shown that circRNAs are involved in the occurrence and progression of a variety of liver diseases. For example, mitochondrial circRNA SCAR, circRNA_002581, and circRNA_0001805 can alleviate the progression of NASH, while other circRNAs, such as hsa_circRNA_104348 and circRNA-100338, are involved in the occurrence and development of tumors. These research reports show that circRNAs can be used as ideal biological targets for the diagnosis and treatment of liver ischemia-reperfusion injury. Therefore, circRNAs and their specific biological effects in the course of liver ischemia-reperfusion injury are worth exploring. Summary of the invention

[0005] The purpose of the first aspect of the present invention is to provide the use of hsa_circ_0003258 as a target in the preparation of diagnostic and / or therapeutic products for ischemia-reperfusion injury.

[0006] The second aspect of the present invention aims to provide a reagent for detecting the expression level of hsa circ 0003258 and its use in preparing a diagnostic product for ischemia-reperfusion injury.

[0007] The third aspect of the present invention is to provide an application of an hsa_circ_0003258 expression promoter in the preparation of a therapeutic product for ischemia-reperfusion injury.

[0008] The technical solution adopted by the present invention is:

[0009] In a first aspect of the present invention, there is provided the use of hsa_circ_0003258 as a target in the preparation of a diagnostic and / or therapeutic product for ischemia-reperfusion injury.

[0010] In some embodiments of the present invention, the ischemia-reperfusion injury includes: renal ischemia injury and / or ischemia-reperfusion injury, myocardial ischemia injury and / or post-ischemia-reperfusion injury, liver ischemia injury and / or ischemia-reperfusion injury; preferably, the ischemia-reperfusion injury is liver ischemia injury and / or ischemia-reperfusion injury.

[0011] A second aspect of the present invention is the use of a reagent for detecting the expression level of hsa_circ_0003258 in the preparation of a diagnostic product for ischemia-reperfusion injury.

[0012] In some embodiments of the present invention, the ischemia-reperfusion injury includes: renal ischemia injury and / or ischemia-reperfusion injury, myocardial ischemia injury and / or post-ischemia-reperfusion injury, liver ischemia injury and / or ischemia-reperfusion injury; preferably, the ischemia-reperfusion injury is liver ischemia injury and / or ischemia-reperfusion injury.

[0013] In some embodiments of the present invention, the reagents include reagents suitable for at least one of the following methods: fluorescent dye method, nucleic acid amplification technology, resonance light scattering method, sequencing or biological mass spectrometry.

[0014] In some embodiments of the present invention, the reagent includes a probe or primer that can specifically bind to hsa_circ_0003258 or a cDNA corresponding to hsa_circ_0003258.

[0015] In some embodiments of the present invention, the sequence of the primer is:

[0016] F1:5'-CATGAAAACACACACTGCAC-3';

[0017] R1:5'-TCCAGAATGCTGCAAGGAGT-3'.

[0018] In some embodiments of the present invention, the product is a kit, a chip, a test paper or a reagent.

[0019] In a third aspect of the present invention, a reagent for promoting hsa_circ_0003258 expression is provided for use in any of the following:

[0020] (1) Preparation of drugs for preventing and / or treating ischemia-reperfusion injury;

[0021] (2) Preparation of drugs for preventing and / or treating ischemic and / or hypoxic injury;

[0022] (3) preparing drugs for inhibiting macrophage inflammation;

[0023] (4) preparing drugs for inhibiting hepatocyte apoptosis;

[0024] (5) Prepare drugs to improve liver cell function.

[0025] In some embodiments of the present invention, the ischemia-reperfusion injury includes: renal ischemia injury and / or ischemia-reperfusion injury, myocardial ischemia injury and / or post-ischemia-reperfusion injury, liver ischemia injury and / or ischemia-reperfusion injury; preferably, the ischemia-reperfusion injury is liver ischemia injury and / or ischemia-reperfusion injury.

[0026] In some embodiments of the present invention, the hsa_circ_0003258 expression promoter includes an expression vector containing the circular RNA or the cDNA corresponding to the hsa_circ_0003258.

[0027] In some embodiments of the present invention, the vector of the construct is a non-pathogenic viral vector.

[0028] In some embodiments of the present invention, the non-pathogenic viral vector is an adenoviral vector, a lentiviral vector or a retroviral vector.

[0029] In some embodiments of the present invention, the vector comprises a viral vector or a non-viral vector.

[0030] In some embodiments of the present invention, the viral vector comprises at least one of a lentiviral vector, an adenoviral vector, a baculoviral vector, a retroviral vector, a poxvirus vector, a Sendai virus vector, and a herpes simplex virus vector.

[0031] In some embodiments of the present invention, the non-viral vector comprises at least one of a plasmid vector, a cationic polymer vector, chitosan, a liposome, and a nanoparticle vector.

[0032] In some embodiments of the present invention, the medicament comprises a pharmaceutical excipient.

[0033] In some embodiments of the present invention, the excipients include at least one of a diluent, a binder, a wetting agent, a lubricant, a disintegrant, an emulsifier, a solubilizer, a preservative, a pH regulator, an osmotic pressure regulator, a surfactant, a coating material, an antioxidant, an antibacterial agent or a buffer.

[0034] In some embodiments of the present invention, the dosage form of the drug includes at least one of a suspension, granules, capsules, powders, tablets, emulsions, solutions, pills, injections, oral preparations, suppositories, enemas, aerosols, patches or drops.

[0035] In some embodiments of the present invention, the administration route of the drug includes at least one of intravenous injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, oral administration, sublingual administration, nasal administration, aerosol administration or transdermal administration.

[0036] In some embodiments of the present invention, the drug contains an effective dose of an hsa_circ_0003258 expression promoter.

[0037] In the present invention, the effective dose can be reasonably adjusted according to the actual situation and the judgment of the clinician. For different species, it can be reasonably adjusted based on the drug dose conversion formula or ratio between different species in the art.

[0038] The beneficial effects of the present invention are:

[0039] The present invention detects that the expression of hsa_circ_0003258 is significantly decreased in patients with liver ischemia reperfusion; the use of lentiviral vectors to construct overexpression of hsa_circ_0003258 can significantly inhibit macrophage inflammation, and can also significantly inhibit the apoptosis level of liver cells after hypoxia and reoxygenation treatment, and improve liver cell function; this shows that hsa_circ_0003258 may play a protective role in alleviating liver ischemia reperfusion injury, and has the potential to become a drug for treating liver ischemia reperfusion injury. The nucleotide fragments of hsa_circ_0003258 can be synthesized and connected with appropriate carrier substances such as lentivirus, liposomes, functional nanoparticles, etc. to form a drug-carrier complex, and liver ischemia reperfusion injury can be treated by oral administration, intravenous injection, etc.

[0040] The advantages of hsa_circ_0003258 discovered by the present invention for the treatment of liver ischemia-reperfusion injury are as follows: as a new tool for gene expression regulation, circRNAs is a new type of targeted molecular therapeutic drug, which is different from traditional therapeutic drugs and has the advantages of being easy to synthesize, easy to detect, and accurate in quantification. After chemical modification, its stability and affinity can be increased, and it can be effectively located to the target organ through a special drug delivery system. The specificity and targeting of the treatment of liver ischemia-reperfusion injury will be greatly improved. The successful development of this circRNAs drug will provide a new way for the treatment of liver ischemia-reperfusion injury and provide a reference for the development of therapeutic drugs for other diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0041] Figure 1 Characterization results of exosomes, Figure 1 A in the middle shows a transmission electron microscope image. Figure 1 Middle B shows the results of protein immunoblotting (Western Blot).

[0042] Figure 2 3D hESC-Exosomes (3D-Exo) effectively improve mouse IRI and promote M2 polarization of intrahepatic macrophages and inhibit hepatocyte apoptosis. Figure 2 A in the middle shows the HE staining of liver tissues of mice in each group. Figure 2 Panel B shows the measurement results of physiological and biochemical indicators and inflammatory factors in serum.

[0043] Figure 3 Heat map of circRNAs with significant differential expression between 3D hESC-Exosomes and 2D hESC-Exosomes (with log2-fold change (FC) > 1 and corrected p value < 0.01 as screening criteria).

[0044] Figure 4 Detection of expression levels of screened circRNAs, Figure 4 A in the figure shows the expression levels of the six circRNAs with the most significant differential expression in 2D hESC-Exosomes and 3D hESC-Exosomes detected by RT-qPCR. Figure 4 Figure B shows the expression levels of the above six circRNAs in the plasma of patients with liver ischemia-reperfusion detected by RT-qPCR.

[0045] Figure 5 The circular nature of has_circ_0003258, Figure 5Figure A shows that has_circ_0003258 is located on chromosome 17q21 from CircBase (http: / / www.circbase.org / ), formed by reverse splicing of exons 4 and 5 of the linear gene ZNF652, and the junction site of has_circ_0003258 detected by Sanger sequencing. Figure 5 Figure B shows the molecular weight of the PCR product of hsa_circ_0003258 detected by nucleic acid electrophoresis (the amplified fragment size of hsa_circ_0003258 is 112 bp.

[0046] Figure 6 Intervention of hsa_circ_0003258 expression in THP-1, Figure 6 A in the middle shows the efficiency of THP-1 cells transfected with hsa_circ_0003258-specific siRNA by RT-qPCR. Figure 6 Middle B shows RT-qPCR detection of the efficiency of THP-1 cells transfected with lentivirus overexpressing hsa_circ_0003258.

[0047] Figure 7 hsa_circ_0003258 has a significant inhibitory effect on macrophage inflammation. Figure 7 Middle A shows the CLSM images of CD86 immunostaining in THP-1-induced M1 macrophages transfected with hsa_circ_0003258-specific siRNA (circ si), hsa_circ_0003258-overexpressing lentivirus (circ OE), or negative control (circ si-NC and circ OE-NC), green: CD86; blue: DAPI (original magnification, 20 times, scale bar, 40 μm); Figure 7 Middle B shows the levels of pro-inflammatory cytokines (IL-1β and IL-6) in the supernatant of M1 macrophages in each group detected by Elisa; Figure 7 Middle C shows the expression levels of inflammatory genes (IL-6, IL-1β, ARG-1, and CD206) in M1 macrophages of each group detected by RT-qPCR; Figure 7 Figure D shows the expression levels of inflammatory proteins (KLF4, Arg-1, CD206 and CD68) in M1 macrophages of each group detected by western blot.

[0048] Figure 8 Intervention of hsa_circ_0003258 expression in primary human hepatocytes, Figure 8 Figure A shows the efficiency of human primary hepatocytes transfected with hsa_circ_0003258-specific siRNA by RT-qPCR. Figure 8 Figure B shows the efficiency of RT-qPCR detection of human primary hepatocytes transfected with lentivirus overexpressing hsa_circ_0003258.

[0049] Fig. 9 hsa_circ_0003258 has a significant inhibitory effect on hepatocyte apoptosis. Fig. 9 Figure A shows the expression levels of apoptosis (Bax, Caspase 3) and liver function (ALB, HGF) related genes in human primary hepatocytes overexpressing hsa_circ_0003258 lentivirus, hsa_circ_0003258 specific siRNA or negative control (circ si-NC and circ OE-NC) after hypoxia-reoxygenation treatment. Fig. 9 Figure B shows the flow cytometry detection of each group of human primary hepatocytes after hypoxia and reoxygenation treatment, apoptotic cells (Annexin + 7-AAD - and Annexin + 7-AAD + ) ratio. DETAILED DESCRIPTION

[0050] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0051] Unless otherwise specified, the raw materials, reagents or devices used in the examples and comparative examples can be obtained from conventional commercial sources or by prior art methods. Unless otherwise specified, the experiments or test methods are conventional methods in the art.

[0052] Full-length sequence of hsa_circ_0003258: CACACACAAAAGACATGCCATTTACATGCGAA ACCTGTGGAAAATCATTCAAACGCAGTATGTCACTCAAGGTGCACTCCTTGCAGCATTCTGGAGAAGCCCTTTAGATGCGAGAACTGTGACGAAAGGTTTCAGTACAA GTACCAGCTACCGCTCCCACATGAGCATTCATATTGGGCACAAACAGTTCATGTGCCAGTGGTGTGGCAAGGATTTCAACATGAAGCAGTACTTCGACGAACACATGAAAACACACACTG (SEQ ID NO: 1).

[0053] Example 1: Cultivation of human embryonic stem cells and isolation of exosomes

[0054] (1) 2D culture

[0055] Pre-spread Matrigel to prepare a special culture plate for human embryonic stem cells (hESCs): Pre-spread diluted Matrigel (DMEM / F12:Matrigel (Corning Matrigel matrix) = 100:1) in a volume of 2 mL / well in a six-well plate, and place the plate back into the CO 2 Incubate in an incubator for more than 24 hours;

[0056] Digestion and passaging: Select a well of hESCs in good condition (good condition: 4-5 days after hESCs passaging, the cell coverage rate reaches about 70%-80%, the clone edges are regular and there are no differentiated cells in hESCs), aspirate the culture medium and add 1mL calcium-free PBS to wash the cells, aspirate and add 1mL ReLeSR TM (STEMCELL) and aspirate within 1 minute, then return the cells to CO 2 Incubate in the incubator for 2-3 minutes, then add 1 mL of mTeSR to each well. TM 1 culture medium (STEMCELL), gently tap the culture plate to try to get the digested cells off the bottom of the plate, and then use a 1 mL disposable pipette to gently pipette the cells into small cell clusters (about a dozen hESCs).

[0057] Inoculation: Take out the well plate pre-coated with Matrigel, discard the Matrigel diluent, and add 3mL mTeSR TM1 and add 10 μM Y-27632 (Rock inhibitor, purchased from Selleckchem) to improve the survival rate of cell inoculation, aspirate the cell suspension and add 2.5 mL serum-free mTeSR TM 1 medium (ratio of 1:6-1:10) for culture, cross-shake the well plate to make the cells evenly suspended in the culture medium, and change the medium every day. Supernatant harvest: From the third day, collect the cell supernatant and store it at -80℃ for exosome isolation.

[0058] (2) 3D culture

[0059] Digestion and passaging: When passaging hESCs, select culture wells with a coverage rate of 70%-80%, regular cloning edges and no differentiated cells, aspirate the culture medium, add 1 mL of calcium- and magnesium-free PBS buffer to wash the cells, aspirate and add 1 mL of GCDR (GentleCell Dissociation Reagent), and return to CO 2 Incubate in the incubator for 5-10 minutes, then discard the GCDR in the well and add 1 mL of mTeSR TM 1 culture medium, pipette down the cells and blow into a single-cell suspension using a pipette.

[0060] Inoculation: Pipette 10 μL of single cell suspension, stain with trypan blue, count using a hemocytometer, and add 5 mL of mTeSR to a low-adhesion plate. TM 1. Add 10 μM Y-27632 (Rocki) to improve the survival rate of cell inoculation, aspirate the cell suspension containing 500,000 single cells and inoculate it into the wells, and shake the well plate crosswise to make the cells evenly suspended in the culture medium;

[0061] Medium change: After 48 hours, the medium in each well was changed by half every day. During the subsequent culture process, Y-27632 was no longer added to the culture medium;

[0062] Supernatant harvest: Starting from the third day of culture, the spent culture medium from each medium change was collected, filtered through a 0.22 μm sterile membrane, and placed into a 50 mL sterile centrifuge tube for subsequent isolation and purification of exosomes.

[0063] (3) Exosome separation and purification includes: human embryonic stem cells are cultured in 2D and 3D according to the method of Example 1, and each generation of cells is co-cultured for 6 days. From the 3rd day to the 6th day, the culture medium is collected and discarded every day. Filter, then centrifuge at 4°C, 1000g for 10 minutes, collect the supernatant; centrifuge the collected supernatant at 4°C, 2000g for 20 minutes, collect the supernatant; centrifuge the collected supernatant at 4°C, 10000g for 30 minutes, collect the supernatant; centrifuge the collected supernatant at 110000g for 70 minutes, discard the supernatant, resuspend the precipitate with phosphate buffer; centrifuge again at 110000g for 70 minutes, discard the supernatant, resuspend the precipitate with a small amount of phosphate buffer, filter and sterilize with a 0.22μm filter membrane to obtain hESC-exosomes.

[0064] The experimental results are as follows Figure 1 As shown: Figure 1 Middle A) Under transmission electron microscopy (TEM), both 2D hESC-Exosomes and 3D hESC-Exosomes appear as round and cup-shaped vesicles with a diameter of about 120-140 nm, granular, showing a clear membrane structure and containing low-density substances. ( Figure 1 Middle B) 2D hESC-Exosomes and 3D hESC-Exosomes were collected, proteins were extracted and then tested by western blot. The results showed that both 2D hESCs and 3D hESCs-derived exosomes expressed CD9 and CD63 proteins. The above results confirmed that the exosomes collected by centrifugation were exosomes.

[0065] Example 2: Establishment of a liver ischemia-reperfusion model mouse and delivery of exosomes for treatment

[0066] (1) Establishment of the liver ischemia-reperfusion model in mice: 6-8 week old SPF-grade ICR mice were anesthetized and fixed, and the skin was prepared and disinfected. A 5 cm longitudinal midline incision was made from the xiphoid process to the upper abdomen. The abdominal skin was grasped with forceps, and the liver and gastrointestinal tract were fully exposed and the hepatic ligaments were separated. The hepatic hilum was dissected, and the hepatic pedicles innervating the left and middle lobes of the liver were bluntly separated and quickly clamped with a small non-invasive artery. After 60 minutes of occlusion, the vascular clamp was removed, and the color of the left middle lobe of the liver gradually became ruddy, indicating that the liver was successfully reperfused. The abdominal cavity was sutured and closed during the reperfusion period.

[0067] (2) Treatment groups: After successful blocking, the two treatment groups were 2D hESC-Exosomes (2D-Exos) and 3D hESC-Exosomes (3D-Exos), that is, 50 μL of 2D-Exos and 3D-Exos at a concentration of 1 μg / mL were injected into the tail vein of mice. The negative control group (PBS group) was only injected with an equal amount of PBS buffer after blocking, and the normal control group (Sham group) was only laparotomy sutured without blocking treatment.

[0068] (3) Detection: The mice were killed 6 hours after reperfusion, and the serum of each group of mice was collected for the detection of physiological and biochemical indicators. The liver was collected for histopathological staining and Elisa was used to detect the levels of liver injury indicators such as aspartate aminotransferase (AST) and alanine aminotransferase (ALT) and inflammatory cytokines such as interleukin 1β (IL-1β) and interleukin 6 (IL-6).

[0069] like Figure 2 As shown in the results, both 2D-Exo and 3D-Exo can effectively reduce the levels of liver injury indicators such as aspartate aminotransferase (AST) and alanine aminotransferase (ALT), and downregulate the levels of inflammatory cytokines such as interleukin 1β (IL-1β) and interleukin 6 (IL-6), indicating that liver damage treated with Exosomes is improved, inflammation is relieved, and liver function is recovering. Therefore, regardless of 2D culture or 3D culture, hESC-Exosomes can significantly improve liver inflammation and enhance liver function in mice with liver ischemia-reperfusion.

[0070] Example 3: Chip sequencing of circRNAs content in 2D hESC-Exosomes and 3D hESC-Exosomes

[0071] Circular RNA (circRNA) is a new type of long non-coding RNA, characterized by covalently closed continuous loops and strong stability. Its main functions are to act as miRNA sponges, translate into proteins, and regulate transcription. Increasing evidence shows that circRNA is involved in the occurrence and progression of various liver diseases. 2D hESC and 3D hESC cell supernatants were collected, exosomes were extracted from the supernatants, exosomal RNA was extracted, and uncircularized RNA was digested with ribonuclease R (RNase R), circRNA was enriched, and sequenced.

[0072] The results are as follows Figure 3 The results showed that the circRNAs with significant differential expression between the 2D hESC-Exosomes control group and the 3D hESC-Exosomes.

[0073] This example mainly uses human embryonic stem cells, which are cells of human origin, to produce exosomes that are rich in some specific circular RNAs using a specific culture method to maintain the pluripotency and stemness of stem cells. The chip sequencing technology is further combined with biological function experiments to identify specific circular RNA molecules with specific therapeutic effects in these rich circular RNAs.

[0074] Example 4: RT-qPCR verification of the expression of the most significantly differentially expressed circRNAs in 2D hESC-Exosomes and 3D hESC-Exosomes

[0075] According to the instructions, total RNA was extracted from 2D hESC-Exosomes, 3D hESC-Exosomes, plasma samples of healthy volunteers and plasma of patients with liver ischemia-reperfusion using RNAiso Plus (Takara, 9109).

[0076] Reverse transcription of circRNA using the PrimeScript kit TM RT Reagent Kit, the reaction system is prepared as follows:

[0077] Table 1 circRNA reverse transcription reaction system

[0078] Reagents Dosage (μL) 5×PrimeScript Buffer(for Real Time) 2 Reverse Transcription Primer 0.5 PrimeScript RT Enzyme MixI 0.5 Total RNA * <![CDATA[RNase Free ddH 2 The]]> up to 10

[0079] *The reaction system can be scaled up according to experimental needs. A maximum of 500ng of TotalRNA can be used in a 10μL reaction system.

[0080] Mix the sample gently and reverse the program as follows: reverse transcription at 25°C for 10 minutes and 42°C for 30 minutes; inactivate reverse transcriptase at 85°C for 5 seconds; obtain cDNA at 4°C and store at -80°C or for subsequent experiments.

[0081] For RT-qPCR reaction, the obtained cDNA was diluted 10 times and the reaction system was configured as follows:

[0082] Table 2 Amplification reaction system

[0083] System components Dosage 2×SYBR qPCR Master Mix 5μL Primer1 (10 μM) 0.2μL Primer2 (10 μM) 0.2μL Template DNA / cDNA 3.6μL <![CDATA[ddH 2 The]]> To 10μL

[0084] Mix the solution of the reaction system, centrifuge it and put it on the centrifuge, and follow the following reaction procedure: pre-denaturation at 95℃ for 30 seconds; 95℃ for 10 seconds, 60℃ for 30 seconds, and cycle 40 times; melting curve: 95℃ for 15 seconds, 60℃ for 60 seconds, and 95℃ for 15 seconds. -△△CTThe forward primer and reverse primer of the amplification reaction were synthesized by Guangzhou Jisai Biotechnology Co., Ltd. and Guangzhou Aiji Biotechnology Co., Ltd. The specific sequences are shown in Table 3.

[0085] Table 3 Forward primer and reverse primer for amplification reaction

[0086] name sequence SEQ ID NO: hsa_circ_024516-qF GCCAGTTCTTCCTTATCCA 2 hsa_circ_024516-qR TGCGGAGTCCAACATCA 3 hsa_circ_103845-qF CACCTAGCAAAAGATCACC 4 hsa_circ_103845-qR GTGCCATTGTCCACATC 5 hsa_circ_102444-qF GACAGAGCGAATCGTCAC 6 hsa_circ_102444-qR GGATGTTCTTAATGGCATAG 7 hsa_circ_405229-qF TAACGATTGTTGAGTGCAGTCCTCA 8 hsa_circ_405229-qR TGAGGACTGCACTCAACAATCGTTA 9 hsa_circ_001302-qF GCGAATCGTCACCACTTAC 10 hsa_circ_001302-qR TTCTTAATGGCATAGCTGATC 11 hsa_circ_0003258-qF CATGAAAACACACACTGCAC 12 hsa_circ_0003258-qR TCCAGAATGCTGCAAGGAGT 13

[0087] The results are as follows Figure 4 As shown, Figure 4 Figure A shows that among these circRNAs, hsa_circ_0003258 was significantly upregulated and had the highest relative abundance in 3D hESCs-Exosomes. Figure 3 The results of chip sequencing of the circRNAs shown are consistent; Figure 4 Figure B shows that the expression level of hsa_circ_0003258 in the plasma of patients with hepatic ischemia-reperfusion was significantly reduced. Next, clinical samples were used to analyze the role of hsa_circ_0003258 in hepatic ischemia-reperfusion.

[0088] Example 5: Verifying the cyclic nature of has_circ_0003258

[0089] According to the CircBase (http: / / www.circbase.org / ) database, has_circ_0003258 is located on chromosome 17q21 and is formed by reverse splicing of exons 4 and 5 of the linear gene ZNF652. According to the junction sequence of the looping site, specific RT-qPCR primers for has_circ_0003258 were designed (primers F1: 5'-CATGAAAACACACACTGCAC-3' (SEQ ID NO: 12) and R1: 5'-TCCAGAATGCTGCAAGGAGT-3' (SEQ ID NO: 13)). The obtained RT-qPCR product was further subjected to Sanger sequencing to verify its splicing site, and the RT-qPCR product was detected by gel electrophoresis to verify its product size. Next, the RNase R treatment experiment was used to confirm whether the circular structure of has_circ_0003258 was resistant to RNase R.

[0090] The specific steps are as follows: Elimination of linear RNA using Epicentre's RNase R, refer to the instructions, and prepare the solution according to the reaction system in the table below: 1 μL RNase R, 2 μL 10×RNase R Reaction Buffer, 1 μL total RNA (500 ng / μL) and 15 μL RNase-Free H 2O. After preparing the reaction solution in a sterile EP tube according to the system, incubate at 37°C for 30 minutes. The product obtained after digestion and removal of linear RNA is the total circRNA, which can exclude the interference of linear RNA containing the same sequence.

[0091] The results are as follows Figure 5 As shown, has_circ_0003258 is located on chromosome 17q21 from CircBase (http: / / www.circbase.org / ), formed by the reverse splicing of exons 4 and 5 of the linear gene ZNF652, and the junction site of has_circ_0003258 detected by Sanger sequencing is consistent with that published in the circBase database ( Figure 5 In A), the molecular weight of the amplified product of hsa_circ_0003258 was detected by nucleic acid electrophoresis. The results are as follows Figure 5 In B, the amplified fragment size of hsa_circ_0003258 was 112 bp. After RNase R treatment, the expression of ZNF652 was significantly reduced, while the expression level of has_circ_0003258 had no significant difference before and after treatment ( Figure 5 The above results confirmed the circular nature of has_circ_0003258.

[0092] Example 6: Experiments to change the level of hsa_circ_0003258 in THP-1 cells

[0093] 1.25×10 5 THP-1 cells / well were planted in 6-well plates. According to the experimental grouping requirements, the control group (normal THP-1 cells without any treatment); circ si group (transfected with hsa_circ_0003258-specific 100nM siRNA), circsi-NC group (transfected with 100nM siRNA NC), circ OE group (transfected with hsa_circ_0003258 overexpression lentivirus, MOI value = 50) and circ OE-NC group (transfected with NC lentivirus, MOI value = 50). Subsequently, each group of THP-1 was induced into M1 macrophages for detection. THP-1 cells were purchased from the Cell Bank of the Chinese Academy of Sciences.

[0094] According to the instructions of the circRNA lentiviral expression vector pLC5-ciR of Gisai Biotechnology, the hsa_circ_0003258 overexpression lentiviral vector was constructed, and the obtained hsa_circ_0003258 overexpression lentivirus can overexpress the hsa_circ_0003258 shown in SEQ ID NO: 1.

[0095] The hsa_circ_0003258 overexpression lentivirus, hsa_circ_0003258 specific siRNA and negative controls (circ si-NC and circ OE-NC) used for cell transfection were designed by Guangzhou Gisai Biotechnology Co., Ltd. The transfection kit was Lipofectamine TM 3000 Reagent (Thermo Fisher). The transfection method was described in the instruction manual.

[0096] Table 4 siRNA and target sequence fragments

[0097] name sequence SEQ ID NO: hsa_circ_0003258-specific siRNA ACACACTGCACACACAAAAGA 14 siRNA NC Provided and interpreted by GISAIBIO /

[0098] Cells from each group were collected and total RNA was extracted using RNAiso Plus (Takara, 9109) according to the instructions, and then reversed into cDNA. mRNA reverse transcription system: 2 μL PrimeScript RT Enzyme Mix I, 1 μL total RNA (500 ng / ul) and 7 μL RNase-Free H 2 O. Then the conditions were set in the PCR instrument for amplification: first 37°C for 15 minutes, then 85°C for 5 seconds, and finally 4°C. The obtained cDNA was used in RT-qPCR experiments to detect the gene expression levels of hsa_circ_0003258 and pro-inflammatory cytokines (IL-6, IL-1β) and anti-inflammatory proteins (ARG-1 and CD206).

[0099] The circRNA reverse transcription and RT-qPCR system were the same as in Example 2. The results are shown in Figure 6 It was shown that after transfection of hsa_circ_0003258-specific siRNA and overexpression of hsa_circ_0003258 lentivirus, the expression level of hsa_circ_0003258 in THP-1 cells was significantly downregulated / upregulated.

[0100] RT-qPCR system: 10 μL Green PCR Master Mix, 0.5μL Forward primer, 0.5μL Reverse primer, 5μL cDNA and 4μL RNase Free ddH2O. Mix the reaction system solution, centrifuge and put it on the machine, according to the following reaction program: pre-denaturation 95℃ for 5 minutes; 95℃ for 15 seconds, 60℃ for 15 seconds, 72℃ for 32 seconds, 40 cycles; melting curve: 60℃-95℃.

[0101] The primers were synthesized by Guangzhou Aiji Biotechnology Co., Ltd.; see Table 5 for details.

[0102] Table 5

[0103] name sequence SEQ ID NO: hIL-6-qF CACACAGACAGCCACTCACC 15 hIL-6-qR TTTTCTGCCAGTGCCTCTTT 16 hIL-1β-qF TTACAG-TGGCAATGAGGATGAC 17 hIL-1β-qR GTCGGAGATTCGTAGCTGGAT 18 hARG-1-qF GGTTTTTGTTGTTGCGGTGTTC 19 hARG-1-qR CTGGGATACTGATGGTGGGATGT 20 hCD206-qF GGGTTGCTATCACTCTCTATGC 21 hCD206-qR TTTCTTGTCTGTTGCCGTAGTT 22 hGAPDH-qF GAAGATGGTGATGGGATTTC 23 hGAPDH-qR GAAGGTGAAGGTCGGAGTC 24

[0104] Finally, RT-qPCR data analysis was performed: all tests were repeated with three biological samples, and each biological sample was tested three times. The internal reference gene GAPDH was used at 2 -△△Ct Data were processed and graphed using Graphpad.

[0105] RT-qPCR results Figure 7 As shown in C, the results showed that hsa_circ_0003258 significantly reduced the gene expression levels of IL-1β and IL-6 in M1 macrophages, and upregulated the gene expression levels of ARG-1 and CD206, while M1 macrophages with hsa_circ_0003258 knockdown showed the opposite results.

[0106] Immunostaining was used to detect the expression of CD86.

[0107] The results of immunostaining were Figure 7 As shown in A, the results showed that hsa_circ_0003258 could effectively inhibit the expression of M1 macrophage marker CD86. However, M1 macrophages with hsa_circ_0003258 knockdown showed the opposite result.

[0108] Elisa was used to detect the levels of proinflammatory cytokines (IL-1β and IL-6) in the supernatant of M1 macrophages in each group.

[0109] The results are as follows Figure 7 As shown in B, the results showed that hsa_circ_0003258 could downregulate the levels of proinflammatory cytokines (IL-1β and IL-6) in the supernatant of M1 macrophages. However, M1 macrophages with hsa_circ_0003258 knockdown showed the opposite results.

[0110] The expression levels of inflammatory proteins (KLF4, Arg-1, CD206 and CD68) were detected by western blot.

[0111] The results are as follows Figure 7 As shown in D, the results showed that hsa_circ_0003258 significantly reduced the expression of inflammatory protein CD68 in M1 macrophages and upregulated the protein levels of anti-inflammatory proteins KLF4, Arg-1 and CD206. However, M1 macrophages with hsa_circ_0003258 knockdown showed the opposite results.

[0112] The above results confirmed that hsa_circ_0003258 has the effect of inhibiting macrophage inflammation.

[0113] Example 7: Experiments to alter hsa_circ_0003258 levels in primary human hepatocytes

[0114] 1.25×10 5 Human primary hepatocytes / well (isolated from normal tissue adjacent to human primary liver cancer, provided by Guangzhou First People's Hospital. This research was approved by the Research Ethics Committee of Guangzhou First People's Hospital, Ethics Approval No.: k-2019-167) were planted in 6-well plates and grouped according to the experimental requirements. The above groups were tested without or after hypoxia and reoxygenation (1% oxygen hypoxia culture for 12 hours, followed by normoxic culture for 6 hours). The specific grouping and treatment are as follows:

[0115] Table 6

[0116] Grouping Transfection Hypoxia-reoxygenation Control group (Sham) × × HR × √ circ si NC group Transfection with 100 nM siRNA NC × circ si group Transfection of hsa_circ_0003258 specific 100nM siRNA × circ si+HR group Transfection of hsa_circ_0003258 specific 100nM siRNA √ circ OE NC group Transfect with NC lentivirus, MOI = 50 × circ OE group Transfect hsa_circ_0003258 overexpression lentivirus, MOI value = 50 × circ OE+HR group Transfect hsa_circ_0003258 overexpression lentivirus, MOI value = 50 √

[0117] The hsa_circ_0003258 overexpression lentivirus, hsa_circ_0003258 specific siRNA and negative controls (circ si-NC and circ OE-NC) used for cell transfection were the same as those in Example 6 and were designed by Guangzhou Gisai Biotechnology Co., Ltd. The transfection kit was Lipofectamine TM 3000 Reagent, (Thermo Fisher), transfection method refers to the instruction manual.

[0118] Each group of cells was collected, and total RNA was extracted using RNAiso Plus (Takara, 9109) according to the instructions, and reversed into cDNA. The obtained cDNA was used in RT-qPCR experiments to detect the expression of hsa_circ_0003258, apoptosis-related genes (Bax, Caspase 3) and liver function-related genes (ALB, HGF). The reverse transcription and RT-qPCR systems of mRNA and circRNA were the same as those in Example 6.

[0119] The relevant primers were synthesized by Guangzhou Aiji Biotechnology Co., Ltd.; see Table 7 for details.

[0120] Table 7

[0121] name sequence SEQ ID NO: hBx CCCGAGAGGTCTTTTTCCGAG 25 hBx CCAGCCCATGATGGTTCTGAT 26 hCasapse 3-qF TTCAGAGGGGATCGTTGTAGAAGTC 27 hCasapse 3-qR CAAGCTTGTCGGCATACTGTTTCA 28 hALB-qF CTGCCTGCCTGTTGCCAAAGC 29 hALB-qR GGCAAGGTCCGCCCTGTCATC 30 hHGF-qF ATTGCCCTATTTCTCGTTGTG 31 hHGF-qR GCATTTCTCATCTCCTCTTCC 32 hGAPDH-qF GAAGATGGTGATGGGATTTC 33 hGAPDH-qR GAAGGTGAAGGTCGGAGTC 34

[0122] Finally, RT-qPCR data analysis was performed: all tests were repeated with three biological samples, and each biological sample was tested three times, using internal reference genes and 2 -△△CtData were processed and graphed using Graphpad.

[0123] Figure 8 The results showed that after transfection of hsa_circ_0003258-specific siRNA and overexpression of hsa_circ_0003258 lentivirus, the expression level of hsa_circ_0003258 in human primary hepatocytes was significantly downregulated / upregulated.

[0124] Fig. 9 Figure A shows that hsa_circ_0003258 can effectively inhibit the expression of apoptosis-related genes (Bax, Caspase 3) in hepatocytes treated with hypoxia and reoxygenation, and upregulate the levels of liver function-related genes (ALB, HGF).

[0125] In addition, cells from each group were collected, Annexin V-PE and 7-AAD were added, mixed and incubated in the dark for 8-10 min, pre-cooled 1× Binding Buffer was added, mixed and detected by flow cytometer.

[0126] Flow cytometry results ( Fig. 9 Middle B) further showed that overexpression of hsa_circ_0003258 could significantly reduce apoptotic cells in hepatocytes treated with hypoxia and reoxygenation (Annexin + 7-AAD - and Annexin + 7-AAD + ). However, the hepatocytes with hsa_circ_0003258 knockdown showed the opposite results. The above results confirm that hsa_circ_0003258 has the effect of inhibiting hepatocyte apoptosis and improving hepatocyte function.

[0127] The above specific implementations have been described in detail for the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Application of hsa_circ_0003258 as a target in the preparation of diagnostic and / or therapeutic products for ischemia-reperfusion injury.

2. Application of reagents for detecting the expression level of hsa_circ_0003258 in the preparation of diagnostic products for ischemia-reperfusion injury.

3. The use according to claim 2, characterized in that: The reagents include reagents suitable for at least one of the following methods: fluorescent dye method, nucleic acid amplification technology, resonance light scattering method, sequencing or biological mass spectrometry; Preferably, the reagent comprises a probe or primer capable of specifically binding to hsa_circ_0003258 or a cDNA corresponding to hsa_circ_0003258; Preferably, the sequence of the primer is: F1:5'-CATGAAAACACACACTGCAC-3'; R1:5'-TCCAGAATGCTGCAAGGAGT-3'; Preferably, the product is a kit, a chip, a test paper or a reagent.

4. Use of the reagent of hsa_circ_0003258 expression promoter in any of the following: (1) Preparation of drugs for preventing and / or treating ischemia-reperfusion injury; (2) Preparation of drugs for preventing and / or treating ischemic and / or hypoxic injury; (3) preparing drugs for inhibiting macrophage inflammation; (4) preparing drugs for inhibiting hepatocyte apoptosis; (5) Prepare drugs to improve liver cell function.

5. The use according to claim 4, characterized in that: The hsa_circ_0003258 expression promoter includes an expression vector containing the hsa_circ_0003258 or the cDNA corresponding to the hsa_circ_0003258.

6. The use according to claim 5, characterized in that: The vector includes a viral vector or a non-viral vector.

7. The use according to claim 6, characterized in that: The viral vector includes at least one of a lentiviral vector, an adenoviral vector, a baculoviral vector, a retroviral vector, a poxvirus vector, a Sendai virus vector, and a herpes simplex virus vector.

8. The use according to claim 7, characterized in that: The non-viral vector includes at least one of a plasmid vector, a cationic polymer vector, chitosan, a liposome, and a nanoparticle vector.

9. The use according to any one of claims 4 to 8, characterized in that: The drug contains pharmaceutical excipients; preferably, the excipients include at least one of a diluent, a binder, a wetting agent, a lubricant, a disintegrant, an emulsifier, a cosolvent, a solubilizer, a preservative, a pH regulator, an osmotic pressure regulator, a surfactant, a coating material, an antioxidant, an antibacterial agent or a buffer; Preferably, the dosage form of the drug includes at least one of suspension, granules, capsules, powders, tablets, emulsions, solutions, pills, injections, oral preparations, suppositories, enemas, aerosols, patches or drops; Preferably, the administration route of the drug includes at least one of intravenous injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, oral administration, sublingual administration, nasal administration, aerosol administration or transdermal administration.

10. The use according to any one of claims 1 to 8, characterized in that: The ischemia-reperfusion injury includes: renal ischemia injury and / or ischemia-reperfusion injury, myocardial ischemia injury and / or post-ischemia-reperfusion injury, liver ischemia injury and / or ischemia-reperfusion injury.

Images