Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

38results about How to "Inhibit inflammation" patented technology

A low-wear knee joint replacement prosthesis

ActiveCN224421244UReduce the risk of osteolysisComply with bionic concept
This utility model relates to the field of knee joint prosthesis technology, and more particularly to a low-wear knee joint replacement prosthesis. The technical solution describes a replacement prosthesis comprising a femoral prosthesis body, a liner body, and a tibial support. The femoral prosthesis body includes an upper femoral prosthesis plate and a lower femoral prosthesis plate, with multiple sets of magnets disposed between the upper and lower femoral prosthesis plates. The liner body includes an upper liner plate and a lower liner plate, with upper and lower liner cavities respectively formed on their adjacent sides, and magnets are disposed within these cavities. The magnetic poles of the adjacent sides of magnets are the same. This utility model optimizes the materials used in the replacement prosthesis, avoiding wear-prone metal particles and thus preventing inflammation. Utilizing the principle of magnetic repulsion, magnetically levitated micro-gap is formed between the prosthesis components, thereby minimizing prosthesis wear and extending its service life.
Owner:PEKING UNIVERSITY THIRD HOSPITAL (THE THIRD CLINICAL MEDICAL SCHOOL OF PEKING UNIVERSITY)

A novel fullerene hydrogel and a preparation method and application thereof

The application discloses a novel fullerene hydrogel and a preparation method and application thereof. The fullerene hydrogel is formed by chemical cross-linking of a fullerene derivative shown in formula I and oxidized hyaluronic acid (oxHA). The fullerene-hyaluronic acid hydrogel material provided by the application has a porous framework, a large pore size and a cell loading potential.
Owner:INST OF CHEM CHINESE ACAD OF SCI

Application of reagent for promoting expression of miR-15b-5p in preparation of medicine for promoting muscle injury repair

PendingCN121943943Apromote proliferationInhibit inflammationOrganic active ingredientsAntipyreticNucleotideMuscle injury
The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.
Owner:SICHUAN AGRI UNIV

Targeting nanoparticle for treating acute respiratory distress syndrome as well as preparation method and application thereof

PendingCN121987593AInhibit inflammationHigh enrichment efficiencyOrganic active ingredientsRespiratory disorderLipid filmBiocompatibility
The invention relates to the technical field of bioengineering, in particular to a targeting nanoparticle for treating acute respiratory distress syndrome as well as a preparation method and application of the targeting nanoparticle. Comprising the following steps: (1) combining MP peptide with DSPE-PEG2000-MAL through a maleimide-mercaptan reaction, dialyzing the obtained conjugate, washing, and freeze-drying, so as to obtain a DSPE-PEG2000-MP conjugate; and (2) mixing the conjugate, lipid, a pharmaceutical preparation and a solvent, removing the solvent to obtain a lipid film, hydrating the lipid film, and performing membrane extrusion to obtain the nanoparticles. The invention not only provides a novel efficient and safe ARDS treatment scheme, but also provides an innovative mode for the design of a nano-drug delivery system based on cell mediation. And due to the dual targeting capability, excellent anti-inflammatory efficiency and good biocompatibility, the nano-material has a wide prospect in clinical application.
Owner:ACADEMY OF MILITARY MEDICAL SCIENCES

A hair loss prevention composition containing burdock root and a preparation method and application thereof

ActiveCN121465962BPromote hair loss prevention and hair growthPromote richnessCosmetic preparationsHair cosmeticsBiotechnologyAngelica Sinensis Root
The present application belongs to the technical field of daily chemicals, and particularly relates to a hair loss prevention composition containing burdock roots and a preparation method and application thereof. The hair loss prevention composition containing burdock roots is prepared from the following raw materials in parts by weight: 0.1-2 parts of burdock root extract, 0.1-2 parts of cypress leaf extract, 0.1-2 parts of Chinese aristolochia root extract, 0.1-2 parts of angelica root extract and 0.1-2 parts of honeysuckle flower extract. The composition is prepared from the components such as burdock root extract, cypress leaf extract, Chinese aristolochia root extract, angelica root extract and honeysuckle flower extract, can effectively prevent hair loss and inhibit inflammation, and prevent the generation of inflammation of the scalp.
Owner:YUNNAN QUNYOU BIOTECHNOLOGY CO LTD

A multiple controlled-release drug-loaded coating modified anti-ectopic ossification artificial temporomandibular joint prosthesis and a preparation method thereof

The application discloses a multiple controlled-release drug-loaded coating modified anti-heterotopic ossification artificial temporomandibular joint prosthesis and a preparation method thereof, and comprises the following steps: surface treatment of a biomimetic artificial temporomandibular joint prosthesis; dopamine assisted co-deposition is adopted to sequentially form a DF-HA self-assembled nanosphere coating and a meloxicam liposome drug-loaded coating on the surface of the biomimetic artificial temporomandibular joint porous titanium prosthesis; and RGD is grafted on the surface of the meloxicam liposome drug-loaded coating by chemical natural deposition, and the anti-heterotopic ossification artificial temporomandibular joint prosthesis is obtained. The artificial temporomandibular joint prosthesis is modified by active drug-loaded meloxicam liposomes on one hand, and the artificial temporomandibular joint prosthesis is modified by RGD-DF-HA layered drug loading on the other hand, long-term slow release and programmed release of drugs are realized, anti-inflammatory effects are achieved, the purpose of treating and preventing heterotopic ossification after artificial joint replacement is achieved, long-term stability of artificial joint replacement is beneficial, early prevention, intervention, service life of the artificial joint prosthesis is improved, and the life quality of patients is improved.
Owner:SHANGHAI NINTH PEOPLES HOSPITAL SHANGHAI JIAO TONG UNIV SCHOOL OF MEDICINE

A hydrogel microneedle patch based on bletilla striata polysaccharide composite engineered exosome and a preparation method and application thereof

The application discloses a kind of hydrogel microneedle patches based on bletilla striata polysaccharide composite engineered exosome and its preparation method and application, belong to the technical field of biomedical materials, with bletilla striata polysaccharide and methacrylated hyaluronic acid as matrix, and the hydrogel microneedle with excellent mechanical properties is prepared.The natural polyphenol caffeic acid is used to modify the bone marrow mesenchymal stem cell exosome, and the engineered exosome is loaded on the microneedle tip by centrifugation.The strong antioxidant capacity of caffeic acid is used to protect the structure of exosome, and a synergistic system is formed, combined with the antibacterial and anti-inflammatory properties of the bletilla striata polysaccharide matrix itself, the diabetic wound microenvironment can be improved from multiple dimensions such as bacteriostasis, antioxidant, anti-inflammatory and pro-angiogenesis.The preparation process of the application is simple and controllable, the product has high biological safety, and the active ingredients can be delivered precisely and minimally invasively, providing an efficient and safe solution for diabetic chronic wound repair.
Owner:NANJING DRUM TOWER HOSPITAL

A culture medium for silver ear fungus and its cultivation method

ActiveCN118252065BGood water solubilityReduce allergic reactionsSterile waterPathogenicity
This invention proposes a culture medium and cultivation method for Tremella fuciformis, belonging to the field of Tremella fuciformis cultivation technology. It is prepared from the following raw materials in parts by weight: 0.5-1 parts antibacterial agent, 5-7 parts traditional Chinese medicine residue, 3-5 parts sugarcane bagasse, 2-3 parts fermentation extract, 30-40 parts cottonseed hulls, 7-10 parts wheat bran, 0.5-1 part gypsum, and 50-60 parts sterile water. The Tremella fuciformis culture medium obtained by this invention can significantly inhibit the growth of pathogenic bacteria during cultivation, reduce the pathogenicity rate, and increase the yield of Tremella fuciformis. Simultaneously, it increases the content and efficacy of active substances in Tremella fuciformis, producing selenium-enriched Tremella fuciformis polysaccharide. The active substances exhibit excellent antioxidant, anti-inflammatory, anti-tumor, moisturizing, hypoglycemic, hypolipidemic, and cardiovascular protective effects. Using this invention's culture medium, along with a suitable ratio of Tremella fuciformis and Clematis chinensis symbiotically, provides a new method and material for Tremella fuciformis cultivation, resulting in Tremella fuciformis with better utilization value and broad application prospects.
Owner:GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI

Dental floss pick with interdental brush

The utility model provides a floss pick with a tooth slit brush, and belongs to the technical field of oral care. Comprising a body handle, a dental floss rod is arranged at one end of the body handle, and a body dental floss, a handle hole, a push rod, a tooth picking tip, a left dental floss shell and a right dental floss shell are arranged in the dental floss rod. According to the utility model, the body handle is taken out by opening the left dental floss shell and the right dental floss shell, the body handle is held by a hand and moved to the oral cavity, so that the body dental floss below the dental floss rod is used for picking teeth and taking out food residues in the teeth, and the body handle is turned over to enable the tooth picking tip to face the teeth in the oral cavity; when the tooth picking tip is used, the edge of the residue needs to be slightly pressed to pick out the large food residue which is difficult to remove from the dental floss of the body in the tooth slit, and the forceful pricking of gingiva is reduced, so that the food residue and dental plaque between the teeth can be effectively cleaned, the tooth slit brush head is kept clean, and the push button is dragged to enable the movable sliding block to drive the tooth slit brush head to slide forwards. A user uses the tooth slit brush head to clean tooth slits of teeth.
Owner:DENTAL HOSPITAL AFFILIATED TO GUANGXI MEDICAL UNIV (DENTAL HOSPITAL OF GUANGXI ZHUANG AUTONOMOUS REGION)

A silk fiber-based anti-decubitus decompression pad and a preparation method thereof

ActiveCN118105260Bgood biocompatibilityNon-irritating
The application discloses a silk fiber-based anti-bedsores decompression pad and a preparation method thereof, which comprises a fabric layer in a concave shape, an aerogel layer and a fiber layer are arranged in the fabric layer from bottom to top, the total height of the aerogel layer and the fiber layer after being stacked is equal to the depth of the fabric layer, the fiber layer is prepared from drug-loaded hydrophobically modified sodium alginate fiber, and the aerogel layer is prepared from degummed silk-sodium alginate composite aerogel with a three-dimensional porous structure. The decompression pad has antibacterial and healing promotion effects, the silk fiber enhances the physical and mechanical properties of the aerogel layer, can greatly reduce external pressure, has excellent air permeation effect due to the through-hole structure in the interior, can fully and quickly absorb wound exudates, the sodium alginate-based material also provides a suitable microenvironment for cell growth, accelerates wound healing, and is suitable for the prevention and treatment of bedsores of patients who need to be in bed for a long time.
Owner:JIANGNAN UNIV

Self-adhering electrodes with low skin contact impedance and uses thereof

The application discloses a self-adhesive electrode with low skin contact impedance and application thereof, wherein the self-adhesive electrode comprises an electrode containing Ag / AgCl material, a conductive layer and a substrate. The conductive layer changes the contact characteristics of the hydrogel and the skin by adding nano-clay in the ion-conducting hydrogel system, so that the conductive layer and the skin are tightly coupled, thereby realizing the effects of long-time stable and low contact impedance and anti-interference. In addition, the conductive layer has good tensile strength and viscoelasticity, so that a wet electrode which realizes adhesion only by the conductive layer can be obtained without using common electrode auxiliary materials such as foam, non-woven fabric and pressure-sensitive adhesive. The electrode overcomes the defect that the contact impedance of the common electrode cannot be kept stable for a long time, and simplifies the fixing mode of the electrode, and can be used for continuous acquisition of physiological signals such as electroencephalogram, electrocardiogram and electromyogram, and has the advantages of stable contact impedance, simple structure, good water retention and good biocompatibility.
Owner:ZHEJIANG UNIV +1

Application of Reg4 gene in treatment of metabolism-related fatty liver

The invention discloses application of a Reg4 gene in treatment of metabolism-related fatty liver, and relates to the technical field of biomedicine. The Reg4 gene is applied to the aspect of treating obesity and metabolism-related fatty liver; according to the application, by increasing expression of the Reg4 gene, liver lipid deposition, liver cell ballooning and inflammatory infiltration related to the metabolism-related fatty liver are inhibited; the application is realized by inhibiting the processes of de novo synthesis of fat in the liver, liver lipid uptake and fatty acid beta oxidation. The step of inhibiting the de novo synthesis of fat in the liver comprises the step of inhibiting the expression of genes of acetyl coenzyme A carboxylase 1, fatty acid synthase and / or stearoyl coenzyme A desaturase 1. The invention definitely proves that the Reg4 gene has an obvious effect of improving obesity and metabolism-related fatty liver, and can relieve hepatic fatty degeneration and inflammation.
Owner:CHONGQING MEDICAL UNIVERSITY

Use of a compound of artemisinin in the preparation of a drug for treating and / or preventing NMOSD and a pharmaceutical composition

PendingCN122681851Aachieve therapeutic effectInhibit local inflammation
The application relates to the technical field of medicines, in particular to application of an artemisinin compound in preparation of a medicine for treating and / or preventing NMOSD and a medicine composition. The application relates to application of an artemisinin compound in preparation of a medicine for treating and / or preventing NMOSD. The application provides a new medical use of an artemisinin compound, that is, application of artemisinin and derivatives thereof in preparation of a medicine for treating, relieving and preventing NMOSD, fills the above technical gap, provides a new treatment option for patients with NMOSD who are not sensitive to existing treatment or are not tolerant to the existing treatment, and makes up for the deficiency of the existing treatment. Specifically, the artemisinin compound can treat the core pathogenic link of NMOSD, realize the double effects of rapidly controlling inflammation in the acute stage and effectively preventing recurrence in the remission stage, reverses part of the nerve damage, and improves the nerve function of the patient.
Owner:GUANGZHOU NEURON MEDICAL TESTING CO LTD

Use of caffeine in the preparation of a composition for improving high red meat intake associated liver inflammation and oxidative stress damage

PendingCN122582164AInhibit inflammationSuppresses oxidative stress phenotype
This invention belongs to the field of biomedicine, specifically relating to the application of caffeine in the preparation of a composition for improving liver inflammation and oxidative stress damage associated with high red meat intake. This invention is the first to discover that caffeine can significantly inhibit liver inflammation and oxidative stress phenotypes and improve liver function indicators in the context of high HLC exposure. Caffeine is a mature raw material with abundant dosage forms, easily forming oral formulations or food compositions, suitable for rapid intervention or long-term risk management after short-term high red meat intake, and has good operability. Caffeine can be combined with gut microbiota modulatory components to form compositions that balance short-term effects with long-term microecological improvement. In the application provided by this invention, through caffeine intake, animal experiments have shown that it can comprehensively improve abnormal lipid metabolism and liver histological damage, demonstrating systemic metabolic protective potential.
Owner:JINING MEDICAL UNIV

Use of sEH inhibitors for the preparation of a medicament for the treatment of IgA nephropathy

PendingCN122251378Arecovery levelInhibit inflammationOrganic active ingredientsUrinary disorderInflammatory factorsHydrolysate
The application discloses application of an sEH inhibitor in preparation of a medicine for treating IgA nephropathy. The application proposes that an sEH inhibitor (such as t-AUCB, N-benzyl linoleamide) is used to inhibit sEH activity, restore the level of endogenous anti-inflammatory mediator epoxyeicosatrienoic acid (EETs), and rebuild the EETs / DiHETs metabolic balance. Experiments prove that the sEH inhibitor can significantly reduce the urine albumin / creatinine ratio of an IgA nephropathy model mouse, improve the blood urea and creatinine levels, and reduce glomerular IgA deposition. Mechanically, the therapy can restore the EETs level, down-regulate the content of hydrolysis product DiHETs, rebuild the EETs / DiHETs metabolic balance, and then inhibit the expression of renal IL-1beta, IL-6, TNF-alpha and other pro-inflammatory factors. It is clear that the sEH / EET axis is a key pathogenic pathway of IgA nephropathy, and a novel metabolic targeting strategy is provided for developing a specific medicine for treating IgA nephropathy.
Owner:CHONGQING MEDICAL UNIVERSITY

A low-infection-risk detachable fixed-wing and recess-free fluid-stopping hemodialysis catheter system

PendingCN122272936AExtended service lifeimprove securityBlood flowMechanical lesion
This invention discloses a low-infection-risk detachable fixation wing and grooveless stop clamp hemodialysis catheter system, belonging to the field of medical device technology. This invention addresses two core pain points of existing long-term hemodialysis catheters: first, it redesigns the traditional one-piece fixation wing as a detachable structure, allowing for quick assembly and disassembly by external force without damaging the catheter, facilitating skin cleaning and reducing the risk of local infection and mechanical damage; second, it optimizes the separate stop clamp into a grooveless structure integrated with the connector, employing a full, smooth inner lumen to completely eliminate dead zones for bacterial residue, reducing catheter-related bloodstream infections at the source. This invention has a simple structure, strong clinical adaptability, and can be widely applied in the field of long-term hemodialysis treatment, demonstrating significant clinical application value.
Owner:曾梓群

Clostridium perfringens sporulation inhibitor

PendingEP4368031A4prevent vegetative cells of CInhibit inflammationOrganic active ingredientsAntibacterial agents
The present invention provides a sporulation inhibitor of Clostridium perfringens containing at least one inorganic compound at a concentration that allows Clostridium perfringens to settle in vivo, wherein the inorganic compound is at least one salt selected from the group consisting of K, Na, Mg, Ca, and Fe, and the inorganic compound is coated with a protective layer containing hydrogenated vegetable oil.
Owner:AJINOMOTO CO INC

Compound traditional Chinese medicine and application thereof in preparation of medicine for resisting eimeria tenella or treating coccidiosis

The invention discloses a compound traditional Chinese medicine and application thereof in preparing a medicine for resisting eimeria tenella or treating coccidiosis, and relates to the technical field of livestock breeding. The compound traditional Chinese medicine comprises the following raw materials in parts by mass: 5-20 parts of hesperidin and 1-10 parts of citric acid. According to the invention, chicks are taken as experimental subjects, a chick coccidiosis model is established, and the effect of the compound traditional Chinese medicine on the chick coccidiosis is researched from the aspects of general conditions of the chicks, bloody stool conditions, coccidiocyst discharge conditions, cecum tissue lesion conditions, pathological detection, serum biochemistry, oxidation resistance detection and the like. The compound traditional Chinese medicine achieves a good anti-coccidiosis drug level, the required raw materials are low in cost, convenient to use and free of hormones and antibiotics, no toxic or side effect is caused to chickens, drug resistance cannot be caused, a new choice is provided for replacing chemical drugs for preventing and treating coccidiosis, and addition of anti-coccidiosis drugs in chicken feed is expected to be reduced or replaced.
Owner:GUANGXI UNIV

Rehabilitation training wrist developer

ActiveCN224113219UInhibit inflammationAvoid inducing secondary injuryGymnastic exercisingVascular dilatationTendon sheath
A rehabilitation training wrist developer belongs to the field of rehabilitation training instruments. Comprising an elastic rubber airbag; the outer circular surface of the elastic rubber air bag is fixedly connected with a finger ring, and the outer circular surface of the elastic rubber air bag is also fixedly connected with a fixing seat for fixing a thumb; the fixed seat is arc-shaped, and an arc-shaped groove and a groove communicated with the arc-shaped groove are formed in the inner circular surface of the fixed seat; pressing air bags are fixedly connected into the arc-shaped grooves and the grooves; the end, located in the arc-shaped groove, of the pressing air bag is fixedly connected to the outer circle face of the elastic rubber air bag, and a through hole communicating the pressing air bag with the elastic rubber air bag is formed in the outer circle face of the elastic rubber air bag. The elastic rubber air bag is used for replacing a traditional body-building hand-muscle developer, inflammation aggravation or secondary injury induction caused by excessive friction between tendons and tendon sheaths is avoided, meanwhile, the functions of pressing the thumb of a patient and stimulating vasodilatation are achieved, blood circulation is promoted, metabolic waste discharge is accelerated, swelling and stiffness are relieved, and the body-building effect is achieved. The muscle tension can be relieved.
Owner:RONG COUNTY TRADITIONAL CHINESE MEDICINE HOSPITAL

An antibacterial slow-release patch

ActiveCN224404027UEfficient water lockreduce decreaseEczematous rashStratum corneum
The application relates to the technical field of antibacterial patches, and particularly discloses an antibacterial slow-release patch, which comprises a skin-friendly and air-permeable layer arranged on the outer side and a slow-release drug layer arranged on the inner side of the skin-friendly and air-permeable layer, a sweat-absorbing substrate layer is arranged on the inner side of the slow-release drug layer, a back adhesive layer is arranged on the rear side of the sweat-absorbing substrate layer, a release paper layer is arranged on the rear side of the back adhesive layer, and a plurality of gel pieces are adhered to the back adhesive layer; the antibacterial slow-release patch is designed in a multilayer structure, can not only resist bacteria and inflammation and efficiently lock water, but also can reduce skin problems caused by sweat accumulation from multiple dimensions. On one hand, bacterial growth is inhibited to avoid inflammation caused by bacterial infection; on the other hand, the skin is kept dry to prevent the horny layer from being excessively hydrated, reduce the occurrence probability of skin diseases such as eczema and miliaria, and provide comprehensive protection for skin health, and the antibacterial slow-release patch is particularly suitable for scenes with more sweat such as sports and high temperature.
Owner:CHENGDU UNIV OF TRADITIONAL CHINESE MEDICINE

Traditional Chinese medicine composition for treating atherosclerosis and method for detecting effect of traditional Chinese medicine composition

The invention relates to a traditional Chinese medicine composition for treating atherosclerosis and a method for detecting the effect of the traditional Chinese medicine composition. The traditional Chinese medicine composition comprises the following raw material components in parts by weight: 5-29 parts of Ziziphora bungeana, 1-20 parts of salvia miltiorrhiza, 1-15 parts of rhodiola rosea and 1-10 parts of lignum dalbergiae odoriferae. The traditional Chinese medicine composition can reduce the content of inflammatory factors in serum, inhibit inflammation and slow down AS formation, and the effect of the traditional Chinese medicine composition on prevention and treatment of atherosclerosis can be effectively verified by establishing an atherosclerosis mouse model.
Owner:CHANGJI HUI AUTONOMOUS PREFECTURE TRADITIONAL CHINESE MEDICINE HOSPITAL

A liquid dressing based on terpin-4-ol and paulownia extract, its preparation method and use

PendingCN122682085Aprocess stabilityGuarantee the healing process
The application discloses a liquid dressing based on terpin-4-ol and paulownia extract as well as a preparation method and application thereof. The liquid dressing comprises the following raw material components in percentage by weight: terpin-4-ol 0.27%-1.1%, beta-cyclodextrin 0.27%-1.1%, paulownia extract 0.2%-0.5% and auxiliary materials 97.3%-99.3%, the mass ratio of terpin-4-ol to the paulownia extract is 0.5-4:1, the mass ratio of terpin-4-ol to beta-cyclodextrin is 1:0.8-1.2, terpin-4-ol and beta-cyclodextrin form a terpin-4-ol / beta-cyclodextrin inclusion compound, and the auxiliary materials comprise a film forming agent. The liquid dressing can kill bacteria around a wound, neutralize slight inflammatory reactions caused after the bacteria are killed, reduce redness, prevent secondary infection and ensure a healing process when the liquid dressing is used for wound healing.
Owner:DESHENGKANG (SUZHOU) BIOTECHNOLOGY CO LTD

A contact lens silicone hydrogel polymer material and method of making the same

ActiveCN120757961Bavoid infectionInhibit inflammation
The application discloses a kind of silicon hydrogel polymer materials for contact lenses and preparation method thereof, it is related to polymer material field, siloxane monomer, hydrophilic monomer and dynamic crosslinking agent are mixed to obtain monomer mixed solution;Functional nanoparticles, monomer mixed solution and initiator are mixed to obtain prepolymer liquid;The prepolymer liquid is injected into mould, and then demoulding is irradiated by ultraviolet light, and immersion is obtained, and the silicon hydrogel polymer material for contact lenses is obtained, the application utilizes cyclic siloxane monomer and linear siloxane copolymerization, forms controllable hydrophobic micro area, optimizes oxygen permeability, introduces borate bond as dynamic crosslinking point, network reconfiguration when ocular inflammation, release functional nanoparticles load's anti-inflammatory antibacterial component, and obtained high oxygen permeability, intelligent anti-inflammatory antibacterial and super durable comfortable silicon hydrogel polymer material for contact lenses.
Owner:IRIS (XIAMEN) TECH CO LTD

PHARMACEUTICALS CONTAINING XANTIN COMPOUNDS FOR THE PREVENTION OR TREATMENT OF URA-INDUCED DISEASES OR GOUT

UndeterminedVN101007AInhibit inflammationRelieve pain
The invention relates to a compound with formula (I), its pharmaceutical salts, its solvates, or any of these preparations for the reduction of uric acid levels, for the prevention or reduction of inflammation, and for the prevention or treatment of urate disease or gout. Specifically, the invention relates to a compound with formula (I), its pharmaceutical salts, its solvates, or any of these preparations for the treatment or prevention of hyperuricemia, gout, gouty inflammatory disease, uric acid-induced pain and nephropathy, wherein R1 is a hydrogen, C1-4 alkyl or similar group, R2 is a C1-10 alkyl or similar group, R3 is a halogen or similar group.
Owner:SHANTON PHARMA PTE LTD

A heart intervention procedure implant-free suturing device

ActiveCN121370263BSolve the problem that the spacing cannot be adjustedavoid scratchesSuture equipmentsSurgical needlesDevice implantApparatus instruments
This invention relates to the field of medical device technology and discloses a non-implantable suture device for cardiac interventional surgery. An adjustment component for adjusting the spacing of puncture needles is installed within a fixation plate. A release component for automatically releasing the puncture needle is installed at the end of the puncture needle near the fixation plate. The adjustment component includes a groove formed within the fixation plate, with multiple sliding seats slidably connected within the groove. A rotating plate is rotatably connected to the end of each sliding seat away from the puncture needle. In this invention, the release component solves the problems of easy inflammation of implants and low success rate of needle suturing in existing devices. An electric actuator drives clamps to tighten the suture site. A pressure sensor at the clamp contact end is linked to the electric actuator. The electric actuator pushes the puncture needle through the suture and inserts it into a cylinder. The cylinder engages the puncture needle, causing it to compress the locking block and release the lock, ultimately pulling the suture to complete the automatic suturing. This design avoids inflammation caused by implants and improves suturing efficiency.
Owner:THE FIRST MEDICAL CENT CHINESE PLA GENERAL HOSPITAL

Use of a traditional Chinese medicine composition in the preparation of a drug for treating chronic obstructive pulmonary disease

ActiveCN116570701Breduce inflammationReduce emphysemaDiseaseWolfiporia extensa
The application relates to an application of a traditional Chinese medicine composition in a drug for chronic obstructive pulmonary disease, characterized in that the traditional Chinese medicine composition comprises the following components in parts: Magnolia officinalis 1-100 parts, Strychnos ignatii 1-100 parts, Toddalia asiatica 1-100 parts, Ephedra 1-100 parts, Amygdalus 1-100 parts, Notopterygium 1-100 parts, Zingiber officinale 1-100 parts, Pogostemonis 1-100 parts, Perilla 1-100 parts, Atractylodes 1-100 parts, Poria cocos 1-160 parts, Atractylodes macrocephala 1-120 parts, Gypsum fibrosum 1-100 parts, Fructus Crataegi 1-100 parts, Fructus Junci 1-100 parts, Fructus Hordei 1-100 parts, Lumbricus 1-100 parts, Radix et Rhizoma Veratri 1-100 parts, Herba Eupatorii Fortunei 1-100 parts, Semen Lepidii 1-100 parts and Semen Platycladi 1-100 parts.
Owner:JIANGSU KANION PHARMA CO LTD

Application of Citrus leaf aqueous extract in the preparation of drugs for the prevention or treatment of alcoholic gastric ulcers

ActiveCN117752721BPlay an ulcer repair roleHigh expression
This invention belongs to the field of pharmaceutical technology, specifically relating to the application of citrus leaf aqueous extract in the preparation of drugs and health products for the prevention of gastric ulcers; using water as the extraction solvent, citrus leaf aqueous extract is obtained, providing its application in the preparation of drugs for the prevention and treatment of gastric ulcers, as well as its application in the preparation of health products for the prevention of gastric ulcers, thus providing a new strategy for the prevention of gastric ulcer disease.
Owner:CHINA PHARM UNIV

A medical cosmetology skin wound dressing and a preparation process thereof

This invention relates to the field of dressing technology, specifically to a medical aesthetic skin wound dressing and its preparation process. The preparation process of a medical aesthetic skin wound dressing includes: preparation of an antibacterial repair agent, preparation of a modified graphene oxide solution, preparation of modified carboxymethyl chitosan, and preparation of a wound hydrogel dressing. The dressing of this invention incorporates an antibacterial repair agent with a conjugated microporous network structure, providing dual potent antibacterial effects through physical confinement and chemical action, creating a sterile microenvironment for wound repair; it uses sericin-hydroxypropyl cellulose modified graphene oxide to solve problems of poor dispersibility and insufficient compatibility, enhancing moisturizing and cell repair activity; and it uses tetramethylolphosphonium sulfate as a crosslinking agent to construct a hydrogel framework, locking in components such as ε-polylysine hydrochloride, resulting in multi-component synergistic antibacterial action and promotion of epidermal regeneration, precisely meeting the needs of delicate, rapid, and scarless healing of medical aesthetic wounds.
Owner:JIANGXI HANSHI MEDICAL DEV CO LTD

Silicon ion preparation for treating chronic pancreatitis, and preparation method and application thereof

The application belongs to the technical field of biological medicine, and particularly relates to a silicon ion preparation for treating chronic pancreatitis and a preparation method and application thereof. The silicon ion preparation has excellent effects of promoting regeneration of pancreatic acinar cells and inhibiting inflammation and fibrosis of pancreatic tissue. The silicon mineral preparation prepared according to the concentration can be used for treating chronic pancreatitis and preventing fibrosis, and has great application prospects. The silicon ion preparation provided in the embodiment can treat chronic pancreatitis and prevent fibrosis. The active material can significantly treat the activity of pancreatitis cells, so as to form healthy pancreatic tissue. The silicon ion preparation comprises that the concentration of silicon ions in the silicon ion preparation is 5 ppm-800 ppm, and the silicon ion preparation is prepared by releasing silicon ions from a silicon mineral preparation.
Owner:WENZHOU INST UNIV OF CHINESE ACAD OF SCI