169results about How to "Inhibit inflammation" patented technology

The invention relates to oral liquid for tonifying kidney and bone and a preparation method thereof, and belongs to the technical field of medicine, the oral liquid contains rhizoma drynariae, polygonum multiflorum, poria cocos, teasel root, radix paeoniae alba, angelica sinensis, codonopsis pilosula, prepared rehmannia root, polygonatum kingianum, fructus lycii, native copper and pericarpium citri reticulatae; the rhizoma drynariae is a product obtained by performing enzymolysis on a whole rhizoma drynariae plant through hemicellulase and pectinase, performing enzymolysis through bromelain and papain and performing enzymolysis through nattokinase; polygonum multiflorum is a product obtained by carrying out enzymolysis on Polygonum multiflorum tuberous roots through hemicellulase and pectinase, then carrying out enzymolysis through bromelain and papain and then carrying out enzymolysis through gelatinase. Polygonatum sibiricum is a product obtained by performing enzymolysis on rhizome of Polygonatum sibiricum through hemicellulase and pectinase, performing enzymolysis through bromelain and papain, and performing fermentation through bacillus licheniformis and saccharomyces boulardii. All the active components are matched for use, kidney function metabolism can be well enhanced, bone mineral density is increased, the treatment course is short, the effect taking speed is high, safety and reliability are achieved, and medication compliance is effectively improved.

The invention discloses multifunctional hydrogel and application thereof, and belongs to the technical field of biological medicine. According to the multifunctional hydrogel, ketal mercaptan with two hydrazide ends and oxidized dextran are cross-linked to form a cross-linked network containing dynamic covalent bonds. The preparation method comprises the following steps: dissolving ketal mercaptan with two hydrazide ends in deionized water to obtain a ketal mercaptan solution, dissolving oxidized dextran in deionized water to obtain an oxidized dextran solution, mixing the ketal mercaptan solution with the oxidized dextran solution, and standing to obtain the multifunctional hydrogel. The multifunctional hydrogel has pH / ROS dual responsiveness, can respond to inflammation microenvironment and low pH of infectious wounds, remove active oxygen, release therapeutic drugs, regulate macrophage polarization and relieve bacterial infection, thereby playing a key role in inflammation, proliferation and remodeling stages of wound healing to accelerate wound healing. The curcumin-encapsulated liposome is added into the multifunctional hydrogel, so that the antibacterial effect can be further improved.

The invention relates to the technical field of compositions, in particular to an anti-aging composition for increasing corium layer collagen and a preparation method of the anti-aging composition. Comprising the following steps: preparing sargassum fusiforme polysaccharide; preparing a composite sargassum fusiforme polysaccharide stabilizer; and compounding and preparing the traditional Chinese medicine extract. The anti-aging composition is prepared by compounding the balm extract, the pistacia chinensis extract, the mulberry extract, the collagen tripeptide and the sargassum fusiforme polysaccharide, all the components are properly compounded, the obtained anti-aging composition and oral liquid are not prone to precipitation in the storage process, loss of nutritional ingredients is avoided, and the anti-aging effect is good. According to the present invention, the components have the obvious synergistic effect, such that the collagen secretion can be promoted while the oxidative stress, the collagen degradation and the skin inflammation can be inhibited so as to substantially increase the collagen content of the skin corium layer, and the anti-aging effect on the skin can be effectively achieved.

The invention relates to the technical field of microorganisms, in particular to application of pediococcus acidilactici ZJUIDS13 in improvement of liver diseases, including improvement of alcoholic liver diseases and improvement of fatty liver diseases related to metabolic dysfunction. The pediococcus acidilactici ZJUIDS13 has relatively strong capability of protecting liver injury induced by alcohol, and can improve the states of liver injury and lipid metabolism disorder caused by high fat diet.

The invention provides hydrogel wound dressing and a preparation method thereof.The hydrogel wound dressing comprises a hydrogel layer, a supporting layer and a protective layer, the hydrogel layer is prepared from, by mass, 10%-15% of polyvinylpyrrolidone, 5%-8% of polycaprolactone, 2%-4% of sodium carboxymethyl cellulose, 1%-3% of chitosan, 0.5%-1.5% of an antibacterial agent, 0.1%-0.3% of an antioxidant and the balance water; the invention discloses a graphene quantum dot gel which comprises the following components in percentage by weight: 0.01-0.1% of a growth factor, 0.1-0.5% of a temperature-sensitive polymer, 0.05-0.15% of graphene quantum dots, 0.5-1.5% of a self-healing polymer, 0.5-1.5% of a pH sensitive material, 0.1-0.3% of nano titanium dioxide and the balance of deionized water. The supporting layer is a porous polylactic acid film, and the thickness of the supporting layer is 0.1-0.3 mm; the protective layer is an air-permeable polyurethane film, and the thickness of the protective layer is 0.2-0.4 mm. Through the synergistic effect of an antibacterial agent, nano titanium dioxide and graphene quantum dots, the antibacterial performance of the dressing is remarkably improved.

The invention discloses an anti-alopecia traditional Chinese medicine composition in the technical field of traditional Chinese medicines. The anti-alopecia traditional Chinese medicine composition comprises the following components in parts by weight: 20-50 parts of prepared polygonum multiflorum, 20-50 parts of cacumen biotae, 5-30 parts of duckweed, 10-30 parts of garden balsam stem, 10-30 parts of ligusticum wallichii, 10-30 parts of rhizoma alismatis, 10-35 parts of cortex lycii radicis, 15-40 parts of hot rhizoma drynariae, 10-40 parts of Chinese honeylocust fruit and 5-40 parts of fructus forsythiae. The anti-alopecia traditional Chinese medicine composition has the effects of nourishing liver and tonifying kidney, boosting essence and cooling blood, clearing damp and dispersing blood stasis, consolidating hair and stopping alopecia, and blackening and growing hair, and can improve the alopecia problem caused by deficiency of essence and blood of liver and kidney; meanwhile, heat clearing and diuresis promoting can be achieved, greasy hair can be reduced, the scalp environment is improved, and seborrheic alopecia caused by damp-heat phlegm stasis is reduced; the shampoo has the effects of dispelling wind, promoting blood circulation, removing dampness and reducing phlegm, and can improve scalp blood circulation and promote hair growth.

The invention discloses combined lactobacillus salivarius CCFM1398 for regulating and controlling bone homeostasis and relieving bone resorption and a metagen of the combined lactobacillus salivarius CCFM1398, and belongs to the technical field of microorganisms. The combined lactobacillus salivarius CCFM1398 provided by the invention is separated from oral dental plaque of healthy teenagers, has the effects of relieving bone resorption and resisting inflammation, and is specifically reflected in that expression of protein level and gene level of MC3T3-E1 cell osteoprotegerin (OPG) is improved in vitro; the bone absorption amount of orthodontic bone absorption rat alveolar bone is reduced, the number of alveolar bone osteoclasts is reduced, and the level of rat serum OPG is improved; the secretion of inflammatory factors TNF-alpha, IL-6 and MPO of the orthodontic bone absorption rat is reduced; and the pathological condition of orthodontic bone absorption rat alveolar bone tissue is improved. Therefore, the combined lactobacillus salivarius has a huge application prospect in products for relieving bone resorption and assisting in inhibiting periodontal tissue inflammation.

The invention discloses a traditional Chinese medicine effective component compound preparation for inhibiting colorectal cancer transformation, which is composed of palmatine, berberine, coptisine and aesculin, and the mass ratio of the palmatine to the berberine to the coptisine to the aesculin is 3: 3: 1: 3. The traditional Chinese medicine active ingredient compound preparation can be prepared into clinical common preparations including granules, capsules or oral liquid according to a conventional method. The traditional Chinese medicine effective component compound preparation disclosed by the invention is proved to be capable of inhibiting intestinal inflammation, improving the intestinal barrier function and remarkably inhibiting colorectal tumor in an inflammatory state by intervening a mouse DSS induced chronic colitis model and an AOM / DSS combined induced colitis and proctitis cancer transformation model.

The invention relates to the field of daily cosmetics, health care product raw materials and biology, and discloses lactobacillus rhamnosus JMB235 with the preservation number of CCTCC (China Center for Type Culture Collection) No.M 20232530. The fermentation product of lactobacillus rhamnosus has multiple effects, and can control grease secretion, prevent alopecia, inhibit acne, promote hair growth, inhibit eczema, inhibit inflammation, maintain skin barrier, promote epidermal cell proliferation and differentiation, block sun, repair damaged skin or improve insomnia. The compound can be used for preparing skin external preparations, health-care products, beautifying oral preparations, foods or food additives. And the fermentation product has good stability, is storable and has a wide application prospect.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a PDCD4 expression inhibitor in preparation of a traumatic craniocerebral injury repair medicine. The research finds that the PDCD4 gene is positioned in a cell nucleus of an astrocyte, the PDCD4 is transferred to cytoplasm after traumatic craniocerebral injury, and an inhibition effect is generated on autophagy. Based on the research result, the invention provides the sh-PDCD4 lentivirus which is relatively good in lentivirus infection effect and can stably knock down the expression level of PDCD4, and the sh-PDCD4 lentivirus remarkably promotes the autophagy of astrocytes and has a relatively good application prospect on targeted drugs for clinically developing and treating traumatic craniocerebral injury.

The invention belongs to the field of small molecule compound medicines, and relates to application of an APE1 inhibitor in preparation of a medicine for treating asthma. The invention provides a novel treatment strategy of asthma, discovers a new target APE1 for treating asthma, realizes an effective treatment effect on asthma by using an APE1 inhibitor C10 compound, can remarkably inhibit the inflammatory cell activity such as mast cells, eosinophilic granulocytes and lymphocytes of asthma, and can remarkably inhibit the inflammatory cell activity of mice lung pathology observation. The C10 compound disclosed by the invention has obvious relieving and relieving effects on lung pathological changes of asthma mice, so that the C10 compound can be clinically used for preventing or treating asthma, and has the industrial advantages of small molecular weight and simple synthesis process.

The invention discloses a silk fibroin-hyaluronic acid temperature-sensitive bioactive hydrogel scaffold, a preparation method thereof and application of the silk fibroin-hyaluronic acid temperature-sensitive bioactive hydrogel scaffold in TBI treatment, hyaluronic acid, silk fibroin and N-isopropylacrylamide are used as raw materials to construct temperature-sensitive hydrogel, and bone marrow mesenchymal stem cells (BMSCs) and paeoniflorin (PF) are loaded to form a treatment unit. Hyaluronic acid is one of components of an extracellular matrix (ECM), has high affinity to cells, and can promote proliferation of stem cells. Silk fibroin has high biocompatibility and biodegradability and good mechanical strength and ductility / toughness, and can promote tissue repair and stem cell attachment and proliferation. N-isopropylacrylamide endows the hydrogel with the characteristic of in-situ temperature-sensitive gelling. Therefore, the bioactive hydrogel stent has the advantages of components, combines the BMSCs and the PF, overcomes the obstacle that the medicine is limited by BBB to be transferred into the brain, and is implanted into a brain injury part after a TBI surgical operation to be used for repairing and treating nerve injury.

The invention discloses a novel hydrogen sulfide donor, a preparation method and application of the novel hydrogen sulfide donor in preparation of drugs for treating inflammatory diseases, and belongs to the technical field of biological medicines. The hydrogen sulfide donor comprises hydrogen sulfide synthetase, a drug carrier loaded with the hydrogen sulfide synthetase, and a functional coating coated outside the drug carrier. The drug carrier is a metal organic framework material, a polymer nano material, a liposome material, an exosome material or a hydrogel material, and can provide protection, slow release, enrichment and other functions for biological enzyme according to the characteristics of different inflammatory diseases. The functional coating is a surfactant, a polymer, an edge active agent, a biological membrane or a lipid double layer, and is used for improving the physicochemical properties of the drug carrier, so that the drug carrier is further endowed with special properties such as in-vivo targeting, long circulation, transdermal drug delivery and the like. According to the invention, an accurate, safe and lasting hydrogen sulfide supply means is realized, and the method has a wide application prospect. And a new treatment thought and strategy are expected to be provided for treatment of inflammatory diseases.

The invention discloses a polyethylene glycol complexing agent as well as a preparation method and application thereof and belongs to the technical field of medicines. The polyethylene glycol complexing agent comprises the following components in percentage by mass: 1-2% of mesenchymal stem cell source exosome modified by miRNA-138-5p, 1-2% of mesenchymal stem cell source exosome modified by miRNA-21, 1-2% of mesenchymal stem cell source exosome modified by lncGm36569, 1-2% of mesenchymal stem cell source exosome modified by mRNA of SNARE family protein, 1-2% of mesenchymal stem cell source exosome modified by mRNA of SNARE family protein and the balance of water. 1-2% of mesenchymal stem cell source exosome modified by mRNA (messenger Ribonucleic Acid) of syntachilin, and the balance of polyethylene glycol. The polyethylene glycol complexing agent disclosed by the invention can reconstruct spinal cord continuity and improve a spinal cord injury microenvironment, so that a neurological function is recovered.

The invention belongs to the technical field of medicines, provides an in-situ bubble generation hyaluronic acid composition for ultrasonic introduction and a patch thereof, and relates to the hyaluronic acid composition, a method for preparing and introducing the patch from the composition and an ultrasonic introduction method. The hyaluronic acid composition comprises the following raw materials: hyaluronic acid, a foaming agent and a penetration enhancer, the preparation method of the lead-in patch comprises the steps of mixing the components and applying. The ultrasonic leading-in method comprises the steps of setting ultrasonic leading-in instrument parameters and leading-in time, and carrying out specific ultrasonic leading-in operation. According to the ultrasonic introduction mode, bubbles are generated in situ, the efficiency is higher than that of pure ultrasonic introduction, and the concentration of hyaluronic acid in the articular cavity can be rapidly increased. Compared with hyaluronic acid injection administration, the administration technology is noninvasive, painless, good in clinical compliance, simple and convenient to operate and low in cost; compared with oral administration of hyaluronic acid, the composition has the advantages of good directionality, accurate and controllable action range and small gastrointestinal irritation.

The invention belongs to the technical field of handmade soap, and particularly relates to an antibacterial handmade soap formula of ganoderma lucidum enzymatic hydrolysate, which is prepared from the following raw materials in percentage by mass: 14-20% of ganoderma lucidum enzymatic hydrolysate, 50-65% of coconut oil, 3-7% of sodium hydroxide, 14-20% of distilled water, 1-3% of tea tree oil, 1-3% of unsaturated lipoglycerin and 0.1-0.3% of vitamin E, an extraction method of the lucid ganoderma enzyme dissolving solution comprises the following steps: putting raw material lucid ganoderma into a cleaning machine, cleaning, airing the cleaned lucid ganoderma, crushing into powder, putting pure water into the lucid ganoderma powder according to a ratio of 1: 10, and uniformly stirring. The composition can resist bacteria, moisten, repair and resist oxidation, the ganoderma lucidum enzymatic hydrolysate and the tea tree oil provide a natural antibacterial effect and prevent skin infection, the ganoderma lucidum polysaccharide and the ganoderma lucidum saponin promote collagen generation, balance skin color, resist oxidation and delay senescence, the composition does not contain synthetic perfume and preservatives, is suitable for sensitive skin, and adopts modern enzymolysis and sterilization technologies, so that the composition is safe and reliable. High efficiency and stability of products are ensured.

The invention mainly relates to composite hydrogel of a targeted cartilage end plate as well as a preparation method and application of the composite hydrogel, and belongs to the technical field of biological medicines. The composite hydrogel of the targeting cartilage end plate comprises a cartilage targeting peptide modified drug-loaded exosome, calcium carbonate, chitosan and water, and the cartilage targeting peptide modified drug-loaded exosome comprises an exosome, a cartilage targeting peptide and salvianolic acid A. The composite hydrogel of the targeting cartilage end plate is prepared by the following steps: encapsulating salvianolic acid A by exosome derived from human mesenchymal stem cells, modifying by cartilage targeting peptide to obtain drug-loaded exosome modified by the cartilage targeting peptide, and mixing the drug-loaded exosome with calcium carbonate, chitosan and water. The compound can be used for accurately targeting cartilage endplate cells (CEPCs), remarkably relieving the inflammation of the CEPCs, changing the secretion phenotype of the CEPCs, delaying the senescence of nucleus pulposus cells (NPCs), relieving the inflammation of the NPCs and effectively treating intervertebral disc diseases.

The invention discloses a preserving fluid for relieving ischemia-reperfusion injury of transplanted fatty liver, and belongs to the technical field of biomedicine. The invention provides an application of a fibroblast growth factor 21 in preparation of a medicine for preventing and treating liver injury caused by ischemia-reperfusion or a liver transplanted organ preserving fluid. Hepatic cell injury caused by ischemia-reperfusion can be effectively improved through exogenous supplement of the fibroblast growth factor 21; particularly, aiming at the fatty degeneration transplanted liver, the traditional Chinese medicine composition not only can inhibit color tissue damage, cell apoptosis and inflammation caused by ischemia-reperfusion, but also can improve lipid accumulation in the liver, reverse the fatty degeneration of the liver and improve the fatty degeneration donor liver transplantation curative effect.

The invention relates to plant-extracted anti-hair-loss hair-strengthening essence and a preparation method thereof, and belongs to the technical field of scalp care. The plant-extracted anti-hair loss and hair-strengthening essence is prepared from an anti-hair loss agent A, an anti-hair loss agent B, a composite conditioner, pyrrolidinyl diaminopyrimidine oxide, pyridoxine hydrochloride, dipotassium glycyrrhizinate, allantoin, ethanol, butanediol, a preservative and deionized water. Various plant extracts are added and cooperate with other components to jointly promote blood circulation, nourish scalp and stimulate hair follicle growth, meanwhile, the scalp environment is conditioned, nutrition is provided for scalp and hair roots, the hair roots are strengthened, and therefore the comprehensive effects of preventing hair loss and strengthening hair are achieved.

The utility model relates to the technical field of ear tags for animal husbandry, and discloses a flexible ear tag which comprises a front cover and a rear cover, the rear cover is embedded in the front face of the front cover, a flexible solar cell panel is embedded in the front cover, and the left side of the front face of the flexible solar cell panel is connected with a temperature measuring resistor. The flexible solar cell panel is externally connected with a flexible cell, the top of the front cover is connected with a first clamping piece, the front face of the first clamping piece is connected with a second clamping piece in a clamped mode, and a display panel is embedded in the front face of the front cover. According to the flexible ear tag, when a breeder manages the ear tag, the number of the ear tag can be seen clearly from a farther distance, and when the flexible ear tag is assembled to the ear of an animal through the additionally arranged second clamping piece and the first clamping piece, the junction of the first clamping piece and the second clamping piece is automatically shielded and protected; bacteria and dust are prevented from entering the junction of the first clamping piece and the second clamping piece, and then ear inflammation of the livestock is avoided.

This utility model relates to the field of knee joint prosthesis technology, and more particularly to a low-wear knee joint replacement prosthesis. The technical solution describes a replacement prosthesis comprising a femoral prosthesis body, a liner body, and a tibial support. The femoral prosthesis body includes an upper femoral prosthesis plate and a lower femoral prosthesis plate, with multiple sets of magnets disposed between the upper and lower femoral prosthesis plates. The liner body includes an upper liner plate and a lower liner plate, with upper and lower liner cavities respectively formed on their adjacent sides, and magnets are disposed within these cavities. The magnetic poles of the adjacent sides of magnets are the same. This utility model optimizes the materials used in the replacement prosthesis, avoiding wear-prone metal particles and thus preventing inflammation. Utilizing the principle of magnetic repulsion, magnetically levitated micro-gap is formed between the prosthesis components, thereby minimizing prosthesis wear and extending its service life.

The application discloses a novel fullerene hydrogel and a preparation method and application thereof. The fullerene hydrogel is formed by chemical cross-linking of a fullerene derivative shown in formula I and oxidized hyaluronic acid (oxHA). The fullerene-hyaluronic acid hydrogel material provided by the application has a porous framework, a large pore size and a cell loading potential.

The invention discloses a steroid compound, which has the following structural formula I: # imgabs0. The steroid compound can retard the pulmonary fibrosis progress by inhibiting fibroblast proliferation, regulating the generation and degradation of extracellular matrix and inhibiting inflammation.

The invention relates to a maintenance type sanitary towel and a preparation method thereof, and belongs to the technical field of sanitary towels. The microcapsule attached to the surface layer of the sanitary towel provided by the invention is prepared from composite chitosan and sodium carboxymethyl starch. Microcapsules attached to the surface of the sanitary napkin are prepared from pullulan in cooperation with composite chitosan and sodium carboxymethyl starch, and a good antibacterial effect and a proper release speed are kept under the condition that human body menstrual blood is acidic. The microcapsules are prepared into microcapsule-containing composite membrane liquid, the composite membrane liquid is sprayed on a non-woven fabric, and the non-woven fabric is used as a surface layer to prepare the maintenance type sanitary towel. The shea nut essential oil and the chitosan are used as raw materials to prepare the composite membrane liquid, so that gaps in the finally formed composite membrane are enlarged, holes are increased, the compactness of the chitosan composite membrane is reduced, and the chitosan composite membrane has good air permeability. In addition, due to the addition of the shea butter essential oil, the intermolecular acting force between the shea butter essential oil and the membrane is enhanced, and the water absorption rate of the finally formed composite membrane is improved.

The present application relates to a cosmetic composition, and more particularly, to a cosmetic composition comprising an amino acid-amino acid eutectic mixture and Troxerutin as an effective ingredient, thereby providing an effect of inhibiting inflammation and relieving / reducing skin irritation.

The invention relates to the field of medicine and personal care products, and provides soothing and moisturizing bath oil capable of assisting in improving atopic dermatitis, the soothing and moisturizing bath oil is composed of grease, a surfactant, an emulsifier, an active functional component and a solvent, the grease comprises caprylic / capric triglyceride, jojoba oil and tocopheryl acetate; the surfactant is prepared from lauryl alcohol polyether sulfate (TIPA) salt and cocamide (MEA); the emulsifying agent is prepared from lauryl alcohol polyether-4 and cetearyl alcohol; the bath oil can relieve clinical symptoms of atopic dermatitis patients, such as pruritus, skin flushing and dryness, is high in comfort level and good in moisturizing performance, has the effects of increasing the water content of cuticle and promoting barrier repair, avoids further damage of skin barriers caused by excessive cleaning, can be used as a basic product for daily nursing of children with atopic dermatitis, and has a wide application prospect in daily nursing of children with atopic dermatitis. The invention further provides active ingredients of the bath oil and a preparation method of the bath oil.

The invention belongs to the field of cosmetics, and discloses a composition with oil control and anti-inflammatory effects as well as a preparation method and application thereof. The composition with the oil control and anti-inflammatory effects comprises a lotus seed extract, a phellinus linteus extract and a rhodomyrtus tomentosa fruit extract, wherein the mass ratio of the lotus seed extract to the phellinus linteus extract to the rhodomyrtus tomentosa fruit extract is (1-6): (0.05-0.2): (1-6). All the components in the composition have a synergistic effect, so that the composition not only can show an excellent instant effect, but also has a remarkable long-term oil control effect, and brings excellent oil control and anti-inflammatory effects to skin.

The invention provides a medicine for improving neurological dysfunction after cerebral ischemia, and relates to the technical field of biological medicine and molecular biology, and the medicine comprises the following steps: S1, preparing materials; s2, cell injury model and intervention test; s3, cell activity and oxidative stress index detection. The invention provides application of combination of baicalein and ferulic acid in preparation of a medicine for improving neurological dysfunction after cerebral ischemia, the embodiment of the invention proves that combination of baicalein and ferulic acid can improve neurological dysfunction after cerebral ischemia by reducing cerebral infarction area, resisting oxidation, inhibiting inflammatory response and the like, and test data shows that compared with a model group, the combination of baicalein and ferulic acid has the advantages that the combination of baicalein and ferulic acid has a good application prospect. White cerebral infarction areas of the rats in the administration group are reduced; after the palmitic acid treatment, the baicalein and ferulic acid combined administration group can promote the proliferation of SH-SY5Y nerve cells; after baicalein and ferulic acid are combined for treatment, the MDA level in damaged cells is remarkably reduced, and the SOD and GSH levels are remarkably increased, so that the baicalein and ferulic acid have the effects of resisting oxidation, inhibiting inflammation and protecting nerve cells.

The present invention provides an inhalable bionic nanomaterial for treating bacterial pneumonia of the lungs, and a preparation method and application thereof, belonging to the technical field of drug preparation. Mesoporous polydopamine nanoparticles A are prepared by a one-pot synthesis method using block polyether and 3,3',5,5'-tetramethylbenzidine as templates; levofloxacin is added to A, stirred and centrifuged, and freeze-dried to obtain nanoparticles B; RAW264.7 cells are resuspended after centrifugation, homogenized and centrifuged again to collect the supernatant, and the supernatant centrifugal precipitation is the prepared macrophage membrane C; the configured B solution and C are mixed, and a bionic nanomaterial D wrapped in a macrophage membrane coating is prepared by a direct extrusion method. The inhalable bionic nanomaterial prepared by the present invention can cross the complex lung barrier to target the inflammatory site to respond to the release of drugs, and can remove reactive oxygen to relieve lung inflammation, which is of great significance for the treatment of lung infection and has promotion and application value.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.