55results about How to "Inhibit inflammation" patented technology

The invention discloses multifunctional hydrogel and application thereof, and belongs to the technical field of biological medicine. According to the multifunctional hydrogel, ketal mercaptan with two hydrazide ends and oxidized dextran are cross-linked to form a cross-linked network containing dynamic covalent bonds. The preparation method comprises the following steps: dissolving ketal mercaptan with two hydrazide ends in deionized water to obtain a ketal mercaptan solution, dissolving oxidized dextran in deionized water to obtain an oxidized dextran solution, mixing the ketal mercaptan solution with the oxidized dextran solution, and standing to obtain the multifunctional hydrogel. The multifunctional hydrogel has pH / ROS dual responsiveness, can respond to inflammation microenvironment and low pH of infectious wounds, remove active oxygen, release therapeutic drugs, regulate macrophage polarization and relieve bacterial infection, thereby playing a key role in inflammation, proliferation and remodeling stages of wound healing to accelerate wound healing. The curcumin-encapsulated liposome is added into the multifunctional hydrogel, so that the antibacterial effect can be further improved.

The invention relates to plant-extracted anti-hair-loss hair-strengthening essence and a preparation method thereof, and belongs to the technical field of scalp care. The plant-extracted anti-hair loss and hair-strengthening essence is prepared from an anti-hair loss agent A, an anti-hair loss agent B, a composite conditioner, pyrrolidinyl diaminopyrimidine oxide, pyridoxine hydrochloride, dipotassium glycyrrhizinate, allantoin, ethanol, butanediol, a preservative and deionized water. Various plant extracts are added and cooperate with other components to jointly promote blood circulation, nourish scalp and stimulate hair follicle growth, meanwhile, the scalp environment is conditioned, nutrition is provided for scalp and hair roots, the hair roots are strengthened, and therefore the comprehensive effects of preventing hair loss and strengthening hair are achieved.

This utility model relates to the field of knee joint prosthesis technology, and more particularly to a low-wear knee joint replacement prosthesis. The technical solution describes a replacement prosthesis comprising a femoral prosthesis body, a liner body, and a tibial support. The femoral prosthesis body includes an upper femoral prosthesis plate and a lower femoral prosthesis plate, with multiple sets of magnets disposed between the upper and lower femoral prosthesis plates. The liner body includes an upper liner plate and a lower liner plate, with upper and lower liner cavities respectively formed on their adjacent sides, and magnets are disposed within these cavities. The magnetic poles of the adjacent sides of magnets are the same. This utility model optimizes the materials used in the replacement prosthesis, avoiding wear-prone metal particles and thus preventing inflammation. Utilizing the principle of magnetic repulsion, magnetically levitated micro-gap is formed between the prosthesis components, thereby minimizing prosthesis wear and extending its service life.

The application discloses a novel fullerene hydrogel and a preparation method and application thereof. The fullerene hydrogel is formed by chemical cross-linking of a fullerene derivative shown in formula I and oxidized hyaluronic acid (oxHA). The fullerene-hyaluronic acid hydrogel material provided by the application has a porous framework, a large pore size and a cell loading potential.

The present application relates to a cosmetic composition, and more particularly, to a cosmetic composition comprising an amino acid-amino acid eutectic mixture and Troxerutin as an effective ingredient, thereby providing an effect of inhibiting inflammation and relieving / reducing skin irritation.

The invention belongs to the technical field of biological medicines, and particularly relates to application of a reagent for promoting expression of miR-15b-5p in preparation of a medicine for promoting muscle injury repair, the nucleotide sequence of the miR-15b-5p is TAGCAGCACATCGGTTTACA, and the nucleotide sequence is marked as SEQ ID NO.1. The invention also relates to application of the reagent for promoting expression of the miR-15b-5p in preparation of a medicine for promoting muscle injury repair. Through miR-15b-5p overexpression and knock-down experiments, the overexpression of the miR-15b-5p can extremely remarkably inhibit the expression of a proliferation gene of a C2C12 cell and extremely remarkably inhibit the cell activity, the miR-15b-5p can promote the apoptosis of the C2C12 cell, and meanwhile, the overexpression of the miR-15b-5p can promote the differentiation of the C2C12 cell.

The invention relates to the technical field of bioengineering, in particular to a targeting nanoparticle for treating acute respiratory distress syndrome as well as a preparation method and application of the targeting nanoparticle. Comprising the following steps: (1) combining MP peptide with DSPE-PEG2000-MAL through a maleimide-mercaptan reaction, dialyzing the obtained conjugate, washing, and freeze-drying, so as to obtain a DSPE-PEG2000-MP conjugate; and (2) mixing the conjugate, lipid, a pharmaceutical preparation and a solvent, removing the solvent to obtain a lipid film, hydrating the lipid film, and performing membrane extrusion to obtain the nanoparticles. The invention not only provides a novel efficient and safe ARDS treatment scheme, but also provides an innovative mode for the design of a nano-drug delivery system based on cell mediation. And due to the dual targeting capability, excellent anti-inflammatory efficiency and good biocompatibility, the nano-material has a wide prospect in clinical application.

The present application belongs to the technical field of daily chemicals, and particularly relates to a hair loss prevention composition containing burdock roots and a preparation method and application thereof. The hair loss prevention composition containing burdock roots is prepared from the following raw materials in parts by weight: 0.1-2 parts of burdock root extract, 0.1-2 parts of cypress leaf extract, 0.1-2 parts of Chinese aristolochia root extract, 0.1-2 parts of angelica root extract and 0.1-2 parts of honeysuckle flower extract. The composition is prepared from the components such as burdock root extract, cypress leaf extract, Chinese aristolochia root extract, angelica root extract and honeysuckle flower extract, can effectively prevent hair loss and inhibit inflammation, and prevent the generation of inflammation of the scalp.

The application discloses a multiple controlled-release drug-loaded coating modified anti-heterotopic ossification artificial temporomandibular joint prosthesis and a preparation method thereof, and comprises the following steps: surface treatment of a biomimetic artificial temporomandibular joint prosthesis; dopamine assisted co-deposition is adopted to sequentially form a DF-HA self-assembled nanosphere coating and a meloxicam liposome drug-loaded coating on the surface of the biomimetic artificial temporomandibular joint porous titanium prosthesis; and RGD is grafted on the surface of the meloxicam liposome drug-loaded coating by chemical natural deposition, and the anti-heterotopic ossification artificial temporomandibular joint prosthesis is obtained. The artificial temporomandibular joint prosthesis is modified by active drug-loaded meloxicam liposomes on one hand, and the artificial temporomandibular joint prosthesis is modified by RGD-DF-HA layered drug loading on the other hand, long-term slow release and programmed release of drugs are realized, anti-inflammatory effects are achieved, the purpose of treating and preventing heterotopic ossification after artificial joint replacement is achieved, long-term stability of artificial joint replacement is beneficial, early prevention, intervention, service life of the artificial joint prosthesis is improved, and the life quality of patients is improved.

The application discloses a kind of hydrogel microneedle patches based on bletilla striata polysaccharide composite engineered exosome and its preparation method and application, belong to the technical field of biomedical materials, with bletilla striata polysaccharide and methacrylated hyaluronic acid as matrix, and the hydrogel microneedle with excellent mechanical properties is prepared.The natural polyphenol caffeic acid is used to modify the bone marrow mesenchymal stem cell exosome, and the engineered exosome is loaded on the microneedle tip by centrifugation.The strong antioxidant capacity of caffeic acid is used to protect the structure of exosome, and a synergistic system is formed, combined with the antibacterial and anti-inflammatory properties of the bletilla striata polysaccharide matrix itself, the diabetic wound microenvironment can be improved from multiple dimensions such as bacteriostasis, antioxidant, anti-inflammatory and pro-angiogenesis.The preparation process of the application is simple and controllable, the product has high biological safety, and the active ingredients can be delivered precisely and minimally invasively, providing an efficient and safe solution for diabetic chronic wound repair.

The invention belongs to the technical field of biology, and particularly relates to a mesenchymal stem cell aggregate jointly energized by matrix and cell factors and application of the mesenchymal stem cell aggregate. The aggregate is prepared by culturing mesenchymal stem cells in a culture medium added with a cell culture matrix and IGF-1 (Insulin-like Growth Factor-1) to obtain pretreated mesenchymal stem cells; and continuing subculture in a 3D cell culture system to obtain the cadherin cell culture medium, wherein the cadherin cell culture medium is prepared from 1-3 parts of hE-cad-Fc and 1-3 parts of hN-cad-Fc. The obtained aggregate is complete in structure and clear in boundary, cell endogenous cadherin and phosphorylated IGF-1 receptors are highly expressed, and the curative effect of treating refractory and repeated immune disorder diseases, such as systemic sclerosis, xerosis and systemic lupus erythematosus, with complex etiology is remarkably improved.

This invention proposes a culture medium and cultivation method for Tremella fuciformis, belonging to the field of Tremella fuciformis cultivation technology. It is prepared from the following raw materials in parts by weight: 0.5-1 parts antibacterial agent, 5-7 parts traditional Chinese medicine residue, 3-5 parts sugarcane bagasse, 2-3 parts fermentation extract, 30-40 parts cottonseed hulls, 7-10 parts wheat bran, 0.5-1 part gypsum, and 50-60 parts sterile water. The Tremella fuciformis culture medium obtained by this invention can significantly inhibit the growth of pathogenic bacteria during cultivation, reduce the pathogenicity rate, and increase the yield of Tremella fuciformis. Simultaneously, it increases the content and efficacy of active substances in Tremella fuciformis, producing selenium-enriched Tremella fuciformis polysaccharide. The active substances exhibit excellent antioxidant, anti-inflammatory, anti-tumor, moisturizing, hypoglycemic, hypolipidemic, and cardiovascular protective effects. Using this invention's culture medium, along with a suitable ratio of Tremella fuciformis and Clematis chinensis symbiotically, provides a new method and material for Tremella fuciformis cultivation, resulting in Tremella fuciformis with better utilization value and broad application prospects.

The utility model provides a floss pick with a tooth slit brush, and belongs to the technical field of oral care. Comprising a body handle, a dental floss rod is arranged at one end of the body handle, and a body dental floss, a handle hole, a push rod, a tooth picking tip, a left dental floss shell and a right dental floss shell are arranged in the dental floss rod. According to the utility model, the body handle is taken out by opening the left dental floss shell and the right dental floss shell, the body handle is held by a hand and moved to the oral cavity, so that the body dental floss below the dental floss rod is used for picking teeth and taking out food residues in the teeth, and the body handle is turned over to enable the tooth picking tip to face the teeth in the oral cavity; when the tooth picking tip is used, the edge of the residue needs to be slightly pressed to pick out the large food residue which is difficult to remove from the dental floss of the body in the tooth slit, and the forceful pricking of gingiva is reduced, so that the food residue and dental plaque between the teeth can be effectively cleaned, the tooth slit brush head is kept clean, and the push button is dragged to enable the movable sliding block to drive the tooth slit brush head to slide forwards. A user uses the tooth slit brush head to clean tooth slits of teeth.

The application discloses a silk fiber-based anti-bedsores decompression pad and a preparation method thereof, which comprises a fabric layer in a concave shape, an aerogel layer and a fiber layer are arranged in the fabric layer from bottom to top, the total height of the aerogel layer and the fiber layer after being stacked is equal to the depth of the fabric layer, the fiber layer is prepared from drug-loaded hydrophobically modified sodium alginate fiber, and the aerogel layer is prepared from degummed silk-sodium alginate composite aerogel with a three-dimensional porous structure. The decompression pad has antibacterial and healing promotion effects, the silk fiber enhances the physical and mechanical properties of the aerogel layer, can greatly reduce external pressure, has excellent air permeation effect due to the through-hole structure in the interior, can fully and quickly absorb wound exudates, the sodium alginate-based material also provides a suitable microenvironment for cell growth, accelerates wound healing, and is suitable for the prevention and treatment of bedsores of patients who need to be in bed for a long time.

The application discloses a self-adhesive electrode with low skin contact impedance and application thereof, wherein the self-adhesive electrode comprises an electrode containing Ag / AgCl material, a conductive layer and a substrate. The conductive layer changes the contact characteristics of the hydrogel and the skin by adding nano-clay in the ion-conducting hydrogel system, so that the conductive layer and the skin are tightly coupled, thereby realizing the effects of long-time stable and low contact impedance and anti-interference. In addition, the conductive layer has good tensile strength and viscoelasticity, so that a wet electrode which realizes adhesion only by the conductive layer can be obtained without using common electrode auxiliary materials such as foam, non-woven fabric and pressure-sensitive adhesive. The electrode overcomes the defect that the contact impedance of the common electrode cannot be kept stable for a long time, and simplifies the fixing mode of the electrode, and can be used for continuous acquisition of physiological signals such as electroencephalogram, electrocardiogram and electromyogram, and has the advantages of stable contact impedance, simple structure, good water retention and good biocompatibility.

The invention discloses a premature delivery delaying device which comprises a plurality of sectioning rings, and the sectioning rings are sequentially arranged in the circumferential direction to form an annular structure. The premature delivery delaying device further comprises fixing rings and connecting pieces, each sectioning ring comprises an upper ring body and a lower ring body, the fixing rings are arranged on the lower ring bodies in a sleeving mode, and the connecting pieces are connected to every two adjacent upper ring bodies. The premature delivery delaying device further comprises a locking structure for locking the positions of the upper ring bodies and the connecting piece, and the locking structure is at least arranged between the connecting piece and one upper ring body connected with the connecting piece. The locking structure is provided with a plurality of locking positions, when the locking structure is located at different locking positions, the inner diameters of the annular structures formed by the upper ring bodies are different, and the locking structure can be automatically adjusted according to cerclage force so that the locking structure can be located at the different locking positions. The device can effectively prevent cervical dilation and thinning and prevent or delay early delivery, can avoid amniotic sac inflammation, and can prevent cerclage force from increasing along with the weight of an infant to damage the cervix and cause discomfort and pain of a patient.

The invention discloses application of a Reg4 gene in treatment of metabolism-related fatty liver, and relates to the technical field of biomedicine. The Reg4 gene is applied to the aspect of treating obesity and metabolism-related fatty liver; according to the application, by increasing expression of the Reg4 gene, liver lipid deposition, liver cell ballooning and inflammatory infiltration related to the metabolism-related fatty liver are inhibited; the application is realized by inhibiting the processes of de novo synthesis of fat in the liver, liver lipid uptake and fatty acid beta oxidation. The step of inhibiting the de novo synthesis of fat in the liver comprises the step of inhibiting the expression of genes of acetyl coenzyme A carboxylase 1, fatty acid synthase and / or stearoyl coenzyme A desaturase 1. The invention definitely proves that the Reg4 gene has an obvious effect of improving obesity and metabolism-related fatty liver, and can relieve hepatic fatty degeneration and inflammation.

The invention discloses a Lactobacillus paracasei strain capable of relieving bone resorption and having an anti-inflammatory effect and a metagen thereof, and belongs to the technical field of microorganisms. The invention provides a novel application of the Lactobacillus paracasei CCFM1396 (Lactobacillus paracasei CCFM1396) in the treatment of the orthodontically induced excessive bone resorption, and particularly provides the application of the Lactobacillus paracasei CCFM1396 in the treatment of the orthodontically induced excessive bone resorption. The lactobacillus paracasei provided by the invention can regulate and control osteoblasts to secrete osteoprotegerin (OPG) and improve gene expression of bone morphogenetic protein (BMP), osteoprotegerin (OPG) and osteopontin (OPN). In a rat orthodontic model, the strain disclosed by the invention can effectively relieve bone resorption, inhibit the inflammatory factor level of gingival tissues and protect the stability of periodontal tissues.

The application relates to the technical field of medicines, in particular to application of an artemisinin compound in preparation of a medicine for treating and / or preventing NMOSD and a medicine composition. The application relates to application of an artemisinin compound in preparation of a medicine for treating and / or preventing NMOSD. The application provides a new medical use of an artemisinin compound, that is, application of artemisinin and derivatives thereof in preparation of a medicine for treating, relieving and preventing NMOSD, fills the above technical gap, provides a new treatment option for patients with NMOSD who are not sensitive to existing treatment or are not tolerant to the existing treatment, and makes up for the deficiency of the existing treatment. Specifically, the artemisinin compound can treat the core pathogenic link of NMOSD, realize the double effects of rapidly controlling inflammation in the acute stage and effectively preventing recurrence in the remission stage, reverses part of the nerve damage, and improves the nerve function of the patient.

This invention belongs to the field of biomedicine, specifically relating to the application of caffeine in the preparation of a composition for improving liver inflammation and oxidative stress damage associated with high red meat intake. This invention is the first to discover that caffeine can significantly inhibit liver inflammation and oxidative stress phenotypes and improve liver function indicators in the context of high HLC exposure. Caffeine is a mature raw material with abundant dosage forms, easily forming oral formulations or food compositions, suitable for rapid intervention or long-term risk management after short-term high red meat intake, and has good operability. Caffeine can be combined with gut microbiota modulatory components to form compositions that balance short-term effects with long-term microecological improvement. In the application provided by this invention, through caffeine intake, animal experiments have shown that it can comprehensively improve abnormal lipid metabolism and liver histological damage, demonstrating systemic metabolic protective potential.

The application discloses application of an sEH inhibitor in preparation of a medicine for treating IgA nephropathy. The application proposes that an sEH inhibitor (such as t-AUCB, N-benzyl linoleamide) is used to inhibit sEH activity, restore the level of endogenous anti-inflammatory mediator epoxyeicosatrienoic acid (EETs), and rebuild the EETs / DiHETs metabolic balance. Experiments prove that the sEH inhibitor can significantly reduce the urine albumin / creatinine ratio of an IgA nephropathy model mouse, improve the blood urea and creatinine levels, and reduce glomerular IgA deposition. Mechanically, the therapy can restore the EETs level, down-regulate the content of hydrolysis product DiHETs, rebuild the EETs / DiHETs metabolic balance, and then inhibit the expression of renal IL-1beta, IL-6, TNF-alpha and other pro-inflammatory factors. It is clear that the sEH / EET axis is a key pathogenic pathway of IgA nephropathy, and a novel metabolic targeting strategy is provided for developing a specific medicine for treating IgA nephropathy.

This invention discloses a low-infection-risk detachable fixation wing and grooveless stop clamp hemodialysis catheter system, belonging to the field of medical device technology. This invention addresses two core pain points of existing long-term hemodialysis catheters: first, it redesigns the traditional one-piece fixation wing as a detachable structure, allowing for quick assembly and disassembly by external force without damaging the catheter, facilitating skin cleaning and reducing the risk of local infection and mechanical damage; second, it optimizes the separate stop clamp into a grooveless structure integrated with the connector, employing a full, smooth inner lumen to completely eliminate dead zones for bacterial residue, reducing catheter-related bloodstream infections at the source. This invention has a simple structure, strong clinical adaptability, and can be widely applied in the field of long-term hemodialysis treatment, demonstrating significant clinical application value.

The present invention provides an agent for treating an ischemic disease, including an apoptosis inhibitor of macrophage (AIM), an AIM fragment having a biological activity of AIM, or a nucleic acid encoding the AIM or AIM fragment.

The invention discloses a PP-BST3-x implant as well as a preparation method and application thereof, and belongs to the technical field of medical materials. According to the method, oxygen vacancies (BST3-x) are constructed on the surface of strontium ion doped barium titanate, so that electron movement in the material is enhanced under an ultrasonic condition, electron holes are easier to separate, the reaction between electrons and surrounding substances is accelerated, and the ROS generation efficiency is improved. In addition, according to the PP-BST3-x implant prepared by the invention, on one hand, macrophages can be polarized through potentials, so that inflammation is inhibited; on the other hand, Sr release can be adjusted through ultrasound, then osteoclast differentiation in the infection environment is inhibited, double-path osteogenesis is achieved, the high osteoclast environment brought by the bacterial microenvironment is improved while bacteria are inhibited, the bone regeneration speed is increased, the bone healing capacity is accelerated, and the recovery time of a patient is shortened.

The present invention provides a sporulation inhibitor of Clostridium perfringens containing at least one inorganic compound at a concentration that allows Clostridium perfringens to settle in vivo, wherein the inorganic compound is at least one salt selected from the group consisting of K, Na, Mg, Ca, and Fe, and the inorganic compound is coated with a protective layer containing hydrogenated vegetable oil.

The invention discloses a compound traditional Chinese medicine and application thereof in preparing a medicine for resisting eimeria tenella or treating coccidiosis, and relates to the technical field of livestock breeding. The compound traditional Chinese medicine comprises the following raw materials in parts by mass: 5-20 parts of hesperidin and 1-10 parts of citric acid. According to the invention, chicks are taken as experimental subjects, a chick coccidiosis model is established, and the effect of the compound traditional Chinese medicine on the chick coccidiosis is researched from the aspects of general conditions of the chicks, bloody stool conditions, coccidiocyst discharge conditions, cecum tissue lesion conditions, pathological detection, serum biochemistry, oxidation resistance detection and the like. The compound traditional Chinese medicine achieves a good anti-coccidiosis drug level, the required raw materials are low in cost, convenient to use and free of hormones and antibiotics, no toxic or side effect is caused to chickens, drug resistance cannot be caused, a new choice is provided for replacing chemical drugs for preventing and treating coccidiosis, and addition of anti-coccidiosis drugs in chicken feed is expected to be reduced or replaced.