Application of YARS1 as medicine and diagnostic kit for treating liver cancer

Abstract

The invention discloses application of tyrosine tRNA synthetase YARS1 as a liver cancer treatment medicine and a liver cancer diagnosis kit, and belongs to the field of biological medicine. According to the invention, an expression vector for interfering the YARS1 gene is utilized, and a large number of in-vitro cell experiments prove that the proliferation of liver cancer cells can be inhibited by interfering the expression level of the YARS1 gene. Fluorescent quantitative PCR experiments show that after YARS1 gene expression is interfered, mRNA levels of cyclin dependent kinase 6 (CDK6) and G1 / S-specific cyclin D3 (Cyclin D3 / CCND3) are inhibited, it is proved from the molecular level of the gene that YARS1 can promote the occurrence of liver cancer, and it is prompted that YARS1 has good application in preparation of liver cancer diagnostic kits and targeted therapy drugs.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of YARS1 as a drug for treating liver cancer or in a diagnostic kit. Background Art

[0002] Liver cancer is the sixth most common cancer in the world and the third leading cause of cancer-related death. According to the epidemiological characteristics of liver cancer, the high incidence and prevalence of liver cancer in Southeast Asia are mainly related to the large number of HBV infected people in the region. About three-quarters of liver cancer cases worldwide are related to chronic hepatitis B or hepatitis C virus infection. In addition, factors such as dietary habits, excessive drinking, liver fatty degeneration or metabolic dysfunction-related liver disease also have an important impact on the occurrence of liver cancer.

[0003] Liver cancer can be divided into primary liver cancer and secondary liver cancer. Primary liver cancer can be divided into hepatocellular carcinoma (HCC), intrahepatic cholangiocarcinoma and mixed hepatocellular carcinoma-cholangiocarcinoma according to histopathological classification. HCC is the most common, accounting for about 70-85%. HCC has no obvious symptoms in the early stage, and many patients are already in the late stage of the disease when diagnosed, and the prognosis is usually poor. At present, there is a lack of more effective screening and prognostic biomarkers for liver cancer. Early detection and treatment are crucial to improving patient survival. In addition, the treatment methods for HCC include surgical resection, liver transplantation, liver-directed therapy and systemic therapy. Because hepatocellular carcinoma is prone to resistance to conventional chemotherapy and radiotherapy, surgical resection and liver transplantation are considered potential cures among these options. However, only a small number of patients are eligible for potentially curative treatments. Despite the emergence of many therapies with different mechanisms, the survival rate of patients with advanced HCC remains low.

[0004] YARS1 (tyrosyl-tRNA synthetase 1) belongs to the amino acid tRNA synthetase family and is a protein that is ubiquitously expressed in all life forms and highly evolutionarily conserved. Its main function is to catalyze the binding of tyrosine to its corresponding tRNA, ensuring the correct translation of genetic information. The protein synthesis involved is essential for the normal growth and development of cells. In addition, YARS1 is also involved in a variety of biological processes, including cell signaling, cell cycle regulation, and tumorigenesis.

[0005] In the field of cancer research, the function of YARS1 has received extensive attention. In bladder cancer, YARS1 is expected to become a valuable prognostic biomarker. Studies have shown that the expression level of YARS1 in bladder cancer tissue is significantly higher than that in normal bladder tissue, and high expression of YARS1 is associated with poor overall patient survival and poor prognosis. YARS1 can also interact with MYC and regulate ferroptosis, senescence, and stemness of bladder cancer cells. In addition, human tyrosyl-tRNA synthetase can be split into two fragments with different cytokine activities by proteolysis, one of which has the activity of promoting angiogenesis. YARS1 has great research potential in the field of cancer, but its specific mechanism of action in liver cancer is still unclear. Summary of the invention

[0006] The object of the present invention is to provide an application of YARS1 in a target or diagnostic kit for liver cancer occurrence.

[0007] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0008] 1. Use of the YARS1 gene (NCBI database, Gene ID: 8565) in the preparation of a drug or a diagnostic kit for cancers with abnormal YARS1 expression, wherein the cancer is liver cancer.

[0009] 2. Use of the YARS1 gene in the preparation of a drug for treating cancer with abnormal YARS1 expression. The cancer is liver cancer. The drug is designed with the YARS1 gene as a target.

[0010] 3. The inhibitor of YARS1 gene is small interfering RNA siYARS1, and its sequence is: 5'-GGAGGCAUUGAUCAGAGAATT-3'.

[0011] 4. After the YARS1 gene inhibitor was applied, its effectiveness was determined by detecting the changes in the intracellular YARS1 gene mRNA level using 18S rRNA as the internal reference gene. The primer sequences were as follows: the forward primer of 18S was ATCACCATTATGCAGAATCCACG, and the reverse primer was GACCTGGCTGTATTTTCCATCC; the forward primer of YARS1 was CTGCACCTTATCACCCGGAAC, and the reverse primer was TCCGCAAACAGAATTGTTACCT; the forward primer of CDK6 was TCTTCATTCACACCGAGTAGTGC, and the reverse primer was TGAGGTTAGAGCCATCTGGAAA; the forward primer of CNND3 was TACCCGCCATCCATGATCG, and the reverse primer was AGGCAGTCCACTTCAGTGC.

[0012] 5. Use of an inhibitor of the YARS1 gene in the preparation of a drug for treating cancer with abnormal YARS1 expression, wherein the cancer is liver cancer.

[0013] The beneficial effects of the present invention are:

[0014] The present invention proves through a large amount of experimental data that YARS1 plays an important role in promoting the occurrence and development of liver cancer: the specific siRNA sequence is used to efficiently inhibit the expression of the YARS1 gene in human liver cancer cell lines; cell proliferation experiments, cell clone formation experiments and real-time fluorescence quantitative PCR and other experimental methods prove that knocking down the expression of the YARS1 gene can significantly inhibit the proliferation of liver cancer cells, indicating that YARS1 can be used as a diagnostic marker for liver cancer. The YARS1 gene has a wide range of applications in the preparation of drugs for treating liver cancer and in cancer diagnostic kits. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 Real-time fluorescence quantitative PCR analysis: Changes in the mRNA level of YARS1 gene in cells after transfection of YARS1 interference vector (siYARS1) in the liver cancer cell line HCCLM3. 18s rRNA was used as the internal reference gene of YARS1.

[0016] Figure 2 This is an MTT cell proliferation experiment; the proliferation of liver cancer cell HCCLM3 within 96 hours after being transfected with siYARS1.

[0017] Figure 3 This is a cell clone formation experiment; the cell clone formation status after the liver cancer cell HCCLM3 was transfected with siYARS for 148 hours.

[0018] Figure 4 Real-time fluorescence quantitative PCR analysis; A: Changes in the mRNA level of cyclin-dependent kinase 6 (CDK6) gene in HCCLM3 liver cancer cells 148 hours after transfection with siYARS; B: Changes in the mRNA level of G1 / S-specific cyclin-D3 (CCND3) gene in HCCLM3 liver cancer cells 148 hours after transfection with siYARS. DETAILED DESCRIPTION

[0019] The interference with YARS1 gene expression described in the present invention is not limited to the sequence of siRNA, but also includes knocking out the coding gene of YARS1 and interfering with the biological process of transcription or translation of the YARS1 gene.

[0020] In some specific embodiments, the drug may be added with one or more pharmaceutically acceptable adjuvants, including but not limited to granules, buffers, surfactants and other recognized pharmaceutical adjuvants.

[0021] In some specific embodiments, the drug can be prepared into dosage forms including but not limited to microinjections and dosage forms suitable for transfection, and these dosage forms can be prepared according to conventional methods in the pharmaceutical field.

[0022] The main materials and specific sources used in the present invention are shown in the following table. Unless otherwise specified, the cell lines and reagents used in the present invention can be obtained commercially. The present invention will be further described below through specific examples, but it should be understood that the method is only exemplary and not limiting the present invention. Materials with similar or identical performance or functions to the following instruments, reagents, etc. can be used in the implementation of the present invention.

[0023] Main Materials:

[0024]

[0025] 1. Analysis of YARS1 expression in liver cancer

[0026] 1. Cell Culture and Seeding

[0027] Human hepatoma cell line HCCLM3 cells were cultured in DMEM medium. The medium contained 10% (V / V) FBS fetal bovine serum, 1% (V / V) penicillin and streptomycin (final concentration of penicillin 10000unit / ml, final concentration of streptomycin 10mg / ml, two pieces of 1% V / V), and was placed in a 37°C incubator with 5% (V / V) CO 2 (the rest is air) under the environment. The cells were cultured at 1.0×10 5 The concentration of 1.8×10 5 The cells were seeded at a concentration of 100 / mL in a 6-well plate, with 2 mL in each well, for transfection with small interfering RNA (siYARS1), followed by cell clone formation experiments and RNA extraction.

[0028] 2. Cell Transfection

[0029] When HCCLM3 cells adhered to the plate and covered 60%-70% of the bottom area, cell transfection was performed. The siNC negative control group and siYARS1 interference group were set up for transfection. The transfection concentration was 50nM. The transfection reagent used was Lipofectamine 8000. The transfection method was carried out according to the instructions. After 6-8 hours, the culture medium was replaced with complete medium for continued culture.

[0030] 3. RNA Extraction

[0031] Continue to culture cells for 24 hours after transfection, discard the culture medium, add 500μL Trizol reagent and place on a shaker for lysis for 4-5min, transfer the lysed cells to a 1.5ml centrifuge tube, add 100μL BCP solution for extraction, vortex and mix for 15 seconds, and let stand for 8-10 minutes. Centrifuge at 12000g at 4℃ for 15min, take the supernatant to a new centrifuge tube, add isopropanol (1:1 with the supernatant volume), invert and mix, and let stand for 10min; centrifuge at 12000g at 4℃ for 10min to obtain RNA precipitation. Discard the supernatant and add 500μL 75% (V / V) DEPC ethanol solution to wash RNA twice. Discard the supernatant and place it at room temperature for ventilation and air drying for 30-40 minutes. Add nuclease-free water according to the amount of RNA and dissolve it in a metal bath at 55℃ for 10 minutes. Use Nano Drop 2000 spectrophotometer to detect the concentration of RNA samples. The RNA samples were homogenized and centrifuged, and then stored at -80°C.

[0032] 4. Reverse transcription of cDNA

[0033] Select the Vazyme reverse transcription kit, calculate the volume of RNA required for loading 3000ng according to the concentration of RNA, and add nuclease-free water to a total volume of 8μL. Place in a gene amplifier, heat at 65℃ for 5 minutes, and then quickly place on ice for 2min. According to the instructions of the kit, add 2μL each of RT Mix, HiScriptⅢEnzyme Mix, Random hexamers, and 5μL of nuclease-free water to the system, put it into the gene amplifier and start reverse transcription: 25℃10min→37℃30min→85℃5min→16℃, repeat 1 cycle. After the reaction is completed, real-time fluorescence quantitative PCR experiments can be performed, or stored at -80℃.

[0034] 5. Detection of YARS1 mRNA levels in cells

[0035] Using cDNA as a template, YARS1 upstream and downstream primers and 2×SYBR Select Master Mix were added for real-time fluorescence quantitative PCR, and the control group samples were selected for gradient dilution as the standard curve. The reaction conditions were 50℃2min; 95℃10min, 95℃1s, 60℃1min, and repeated 40 cycles. Relative quantification was performed according to the standard curve, and the internal reference gene 18SrRNA was used for correction to compare the differences in YARS1 content between different samples. (The 18S forward primer used is described in the sequence list ID NO: 1; the 18S reverse primer is described in the sequence list ID NO: 2, the YARS1 forward primer used is described in the sequence list ID NO: 3; the YARS1 reverse primer is described in the sequence list ID NO: 4)

[0036] Results: Figure 1 As shown in the figure, the results of real-time fluorescence quantitative PCR showed that the mRNA level of YARS1 was knocked down by 60% in the siYARS1 transfection group compared with the control group (P < 0.001), proving that siYARS1 has been successfully transferred into the cells and caused a decrease in the content of YARS1. This result shows that the expression level of YARS1 in liver cancer can be reduced by exogenous interference.

[0037] 2. Interfering with the YARS1 gene can inhibit the proliferation of liver cancer cells

[0038] 1. Cell proliferation MTT assay

[0039] HCCLM3 cells were seeded into a 96-well plate, and transfected after the cells adhered to the wall according to the method in Example 1. A siNC negative control group and a siYARS1 interference group were set up. 10 μL MTT was added 24 hours after transfection. After 4 hours of full reaction, 100 μL dimethyl sulfoxide (DMSO) was added, and the absorbance at 450 nm was measured by an ELISA instrument, which was recorded as the 0h group. Subsequently, the OD values ​​of 0h, 24h, 48h, and 72h were finally obtained. The cell proliferation curve was drawn according to the OD value.

[0040] Results: Figure 2 As shown in the figure, at 24h, the growth rate of the siYARS1 transfected group was significantly lower than that of the control group (P < 0.01); at 48h and 72h, there was a significant statistical difference in the growth rate of cells in the siYARS1 transfected group and the siNC group (P < 0.001). At 96h, it was clearly observed that the cells in the siYARS1 transfected group did not grow significantly compared with 24h, indicating that cell proliferation was inhibited, while the cells in the siNC control group still grew rapidly, and the number of cells between the two groups was significantly different (P < 0.0001). This result shows that after the YARS1 gene is knocked down, it can effectively inhibit the proliferation of liver cancer cells.

[0041] 2. Cell clone formation experiment

[0042] The HCCLM3 cells were seeded into a 6-well plate, and transfected after the cells adhered to the wall according to the method in Example 1. The siNC negative control group and siYARS1 interference group were set up. After 48 hours of transfection, the cells were taken and the supernatant was discarded. 1 mL of PBS was added to each well for washing; the supernatant was discarded, 1 mL of neutral formalin fixative was added, and the supernatant was discarded after reacting for 20 minutes. After washing with PBS, 0.1% crystal violet stain was added for staining for 10 minutes. The supernatant was discarded, and the cells were dried and photographed to observe the cell clone formation ability.

[0043] Results: Figure 3As shown, the number and degree of staining in the negative control group were significantly higher than those in the siYARS1 interference group, indicating that knocking down the YARS1 gene can effectively inhibit the proliferation of liver cancer cells.

[0044] 3. Interference with the YARS1 gene can affect the expression of cell cycle-related genes in liver cancer cells

[0045] According to the method in Example 1, the growing HCCLM3 cells were seeded into a 6-well plate, and transfection was performed after the cells adhered to the wall. The siNC negative control group and the siYARS1 interference group were set up. RNA was extracted 48 hours after transfection, the concentration was measured, and cDNA was reverse transcribed, and then Real-time PCR was performed. The internal reference gene 18S was used for correction to compare the differences in the mRNA levels of CDK6 and CCND3 between the two groups. (The 18S forward primer used is as described in the sequence list ID NO: 1; the 18S reverse primer is as described in the sequence list ID NO: 2, the CDK6 forward primer used is as described in the sequence list ID NO: 5; the CDK6 reverse primer is as described in the sequence list ID NO: 6, the CCND3 forward primer used is as described in the sequence list ID NO: 7; the CCND3 reverse primer is as described in the sequence list ID NO: 8.)

[0046] Results: Figure 4 As shown in -A, compared with the siNC control group, the mRNA level of CDK6 in the siYARS1 interference group was inhibited (P<0.05); Figure 4 -B shows that compared with the siNC control group, the mRNA level of CCND3 in the siYARS1 interference group was inhibited (P<0.05). The results showed that knockdown of YARS1 could downregulate the expression of CDK6 and CCND3 in cells, thereby blocking the cell cycle from entering the S phase from the G1 phase, thereby inhibiting cell proliferation.

[0047] Statistical analysis: All data were obtained by taking the average of three independent experiments and subjected to standard deviation analysis. P < 0.05 was considered statistically significant, denoted by *; P < 0.01 was denoted by **; P < 0.001 was denoted by ***.

[0048] The scope of protection claimed for the present invention is not limited to the description of the specific embodiments.

[0049] Sequence Listing

[0050]

Claims

1. YARS1 is used as a drug for treating liver cancer or a kit for diagnosing liver cancer.

2. Application of YARS1 as a drug for treating liver cancer or a kit for diagnosing liver cancer, characterized in that Designed with YARS1 as the target, it includes the following steps; a. Take YARS1 as the target regulatory gene and construct a vector that interferes with the expression of the YARS1 gene; b. Using the carrier in step a, preparing a drug for ex vivo or in vivo administration.

3. The use according to claim 2, characterized in that: In the step b, whether the vector or the administered drug is effective is determined based on the mRNA expression level of the cell YARS1, CDK6 or CCND3 gene.

4. The use according to claim 2, characterized in that: In the step a, interfering with the YARS1 gene includes knocking out or silencing the YARS1 coding gene, inhibiting or reducing the transcription and translation function of YARS1 through the RNAi gene silencing system, thereby interfering with one or more genes that function as the YARS1 protein; the vector is a viral vector or a non-viral gene silencing vector.

5. The use according to claim 4, characterized in that: The viral vector is an adenoviral vector, an adeno-associated viral vector, a retroviral vector or a herpes virus vector.

6. The application according to claim 4, characterized in that: The non-viral gene silencing vector is a CRISPR / Cas9 system gene knockout vector, an RNAi system gene silencing vector, or a vector modified on this basis.

Images