Reference gene for gene expression analysis in full development stage of bombyx mori, screening method, primer and application
Through transcriptomics technology, CYPA genes that express stable expression in the whole life cycle of silkworms were screened, and primers were designed as internal reference genes, which solved the problem of internal reference gene selection dependence in the existing technology, and improved the accuracy and credibility of qPCR results. .
Patent Information
- Application Number
- CN202411650844.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-19
- Publication Date
- 2025-02-14
AI Technical Summary
The screening and selection of internal reference genes in different development stages of silkworms mainly depends on experience, resulting in a decrease in the accuracy and credibility of qPCR results.
Transcriptomics technology was used to sequence silkworm samples from different developmental stages, and Cyclophilin A (CYPA) genes that express stable expression in the entire life cycle of silkworms were screened, and corresponding primers were designed to be used as internal reference genes for qPCR experiments.
The accuracy and credibility of qPCR results are improved, and the stability and applicability of internal reference genes in gene expression analysis at the entire development stage of silkworms are ensured.
Smart Images
Figure CN119433041A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to an internal reference gene, a screening method, a primer and an application for gene expression analysis in all development stages of silkworm, and belongs to the technical field of molecular biology. Background Art
[0002] The silkworm (Bombyx mori) is a holometabolous insect that is domesticated for silk production because of its ability to spin silk. The silkworm has a short breeding cycle and relatively low cost, and has important economic value. Its unique genetic background, complete development process and wide application potential make it not only a traditional economic insect, but also an important model organism in modern scientific research. It plays an important role in research fields such as entomology, developmental biology, genomics and biotechnology. The life cycle of the silkworm includes four main stages: egg, larva (silkworm), pupa and adult (moth). The larval stage can be divided into the first, second, third, fourth and fifth instars. The development and morphological changes of different organs in each developmental stage of the silkworm are determined by the expression of specific genes. The study of the metamorphosis process of the silkworm is not only crucial to the sericulture industry, but also a classic model for studying the growth, development and metabolic regulation of insects.
[0003] As a model animal, researchers often need to use real-time fluorescence quantitative PCR (qPCR) technology to detect the expression of functional genes in silkworms. Reference genes are used to correct the differences between silkworm samples at different developmental stages during the experiment, so the selection of reference genes will directly affect the accuracy and credibility of qPCR results. Therefore, it is very important to screen a reference gene that has high expression stability at different stages of silkworm development and is not affected by the metamorphosis process.
[0004] Transcriptome sequencing (RNA-Seq) is a technology that studies all transcription products of cells or tissues under specific time and conditions. It can comprehensively analyze transcripts in organisms to reveal gene regulatory mechanisms. It has the advantages of high throughput and sensitivity, accurate quantification, and a wide range of applicable samples. Therefore, through transcriptomics technology, we can systematically compare the gene expression of silkworms at different developmental stages and identify genes with stable expression levels at different developmental stages. At present, the screening and use of internal reference primers at different developmental stages of silkworms mainly rely on experience, which will significantly reduce the accuracy and credibility of qPCR results. Screening internal reference genes with stable expression and used in the entire life cycle of silkworms through transcriptomics technology has become a hot topic in current research. Summary of the invention
[0005] In view of the above-mentioned current technical problems, the present invention provides an internal reference gene, a screening method, a primer and an application for gene expression analysis at all developmental stages of silkworm.
[0006] The present invention uses transcriptomics technology to sequence samples of silkworms at different developmental stages, screens out the gene Cyclophilin A (CYPA) that is stably expressed throughout the life cycle of silkworms, provides CYPA gene and primer sequences, and applies them as internal reference genes to qPCR experiments. The primer sequences of the internal reference genes provided by the present invention can be applied to all developmental stages of silkworms at the same time, have the characteristics of high sensitivity, stable expression, and a wide range of applicable sample types, thereby improving the accuracy and credibility of qPCR results.
[0007] In order to achieve the above technical objectives, the present invention provides the following technical solutions:
[0008] The present invention firstly provides an internal reference gene for gene expression analysis in all developmental stages of silkworm. The internal reference gene is Cyclophilin A (CYPA) gene, and the nucleotide sequence thereof is shown in SEQ ID No:1.
[0009] The full developmental stages of the silkworm include: egg, larva, pupa and adult (moth), wherein the larval stage includes the first instar, second instar, third instar, fourth instar and fifth instar.
[0010] Furthermore, the primer sequences of the internal reference gene are shown in SEQ ID No: 2 and SEQ ID No: 3.
[0011] The present invention also provides a primer for analyzing gene expression in all developmental stages of silkworm. The nucleotide sequences of the primers are shown in SEQ ID No: 2 and SEQ ID No: 3.
[0012] The invention also provides a kit for analyzing gene expression in all developmental stages of silkworm, which comprises the primers.
[0013] The present invention also provides application of the internal reference gene, primer or the kit in gene expression analysis at all developmental stages of silkworm.
[0014] The present invention also provides a method for screening the internal reference gene, the method comprising:
[0015] (1) Based on the transcriptome data of silkworm at different developmental stages, candidate reference genes were screened and qPCR primers were designed.
[0016] Among them, the transcriptome data included: stable expression levels in developmental stages, no significant differences (p>0.05), expression levels greater than 190, and small coefficient of variation.
[0017] (2) Samples of silkworms at different developmental stages were collected, RNA was extracted and reverse transcribed into cDNA, and the obtained cDNA was used as a template. The primers in step (1) were used to perform qPCR experiments on the candidate internal reference genes respectively to obtain the Cq value of each candidate internal reference gene at different developmental stages of silkworms.
[0018] (3) Evaluate the stability of candidate reference genes at different developmental stages of silkworm;
[0019] Preferably, four online tools, namely Comprehensive ranking, delta CT, BestKeeper and Normfinder, are used to evaluate the stability of candidate reference genes at different developmental stages of silkworm.
[0020] (4) The candidate reference genes were compared with reference genes in terms of expression level and stability, and finally the reference genes suitable for all developmental stages of silkworm were selected.
[0021] Wherein, the reference internal reference gene is ActinA3 gene.
[0022] An internal reference gene is required to compare the Cq value of the target gene in the same amount of the sample to be tested, and the relative expression of the sample to be tested can be obtained by calculating the 2^-ΔΔCq formula. After correction by the internal reference gene, the experimental errors in the sample loading amount and the loading process can be eliminated to ensure the accuracy of the experimental results.
[0023] Compared with the prior art, the present invention has the following beneficial effects:
[0024] (1) The present invention adopts transcriptomics technology to screen out an internal reference gene CYPA for gene expression analysis in all developmental stages of silkworm, so that when detecting functional genes of silkworm, the deficiency of internal reference genes selected by experience is compensated, and the accuracy and credibility of qPCR results are improved.
[0025] (2) The present invention screened candidate internal reference genes through transcriptomics technology, and further optimized the process and evaluation indicators for screening internal reference genes through transcriptomics technology. First, the internal reference genes that were stably expressed in all developmental stages of silkworms and had the smallest coefficient of variation were determined, and then the stability of the internal reference genes was comprehensively evaluated through Comprehensive ranking, delta CT, BestKeeper and Normfinder. Finally, the internal reference gene CYPA that could minimize the deviation caused by the metamorphosis of silkworms was determined.
[0026] (3) The present invention also provides primers for detecting the CYPA internal reference gene. The primers have good species specificity and have no amplification reaction to the human genome that is often exposed during the detection of all developmental stages of silkworms. Therefore, the primers can be well applied to the detection and amplification of the internal reference gene CYPA. BRIEF DESCRIPTION OF THE DRAWINGS
[0027] Figure 1 The expression levels and CV values of 12 candidate reference genes and the reference gene (ActinA3) in all samples of the whole developmental stage of silkworm.
[0028] Figure 2 Cq values of 12 candidate reference genes and the reference gene (ActinA3) at different developmental stages of silkworm.
[0029] Figure 3 is the expression level of BGIBMGA000526 and BGIBMGA003608 genes in all developmental stages of silkworm.
[0030] Figure 4 It is the relative expression level of BGIBMGA000526 gene after correction by different internal references.
[0031] Figure 5 It is the relative expression level of BGIBMGA003608 gene after correction by different internal references.
[0032] Figure 6 The relative expression levels of Siwi and Ago genes in all developmental stages of silkworm after correction by the CYPA internal reference gene. DETAILED DESCRIPTION
[0033] In order to enable those skilled in the art to better understand the technical solution of the present invention, the preferred embodiments of the present invention are described in detail below, but the following embodiments do not limit the protection scope of the present invention.
[0034] In the embodiments of the present invention, those that are not described in detail are all completed by conventional experimental methods. Those processes involved in the embodiments that are not described in detail are all understandable and easily implementable by those skilled in the art based on the product instructions or basic knowledge in the field, and therefore are not described in detail.
[0035] The accession numbers involved in the embodiments are all NCBI platform accession numbers. The silkworm diapause eggs are preserved and provided by the School of Life Sciences of Jiangsu University and are publicly known and publicly used materials. The activated eggs, first to fifth instar larvae, pupae and moths of the silkworm involved are all obtained by hatching from the same batch of silkworm diapause eggs; the ActinA3 internal reference gene is a publicly known and publicly used internal reference gene and can be purchased through conventional channels; the sequence information of the ActinA3 internal reference gene is as follows:
[0036]
[0037] Example 1: Screening of reference genes for all developmental stages of silkworm
[0038] S1. Silkworm sample preparation and transcriptome sequencing:
[0039] The samples of silkworms at all developmental stages include: diapause eggs, activated eggs, first-instar silkworms, second-instar silkworms, third-instar silkworms, fourth-instar silkworms, fifth-instar silkworms, fourth-day pupae, eighth-day pupae and moths. The transcriptome sequencing service of the above samples was entrusted to Shanghai Major Biotechnology Co., Ltd., and the transcriptome data were analyzed on the Major Cloud Platform (http: / / www.majorbio.com).
[0040] S2. Screening of candidate reference genes:
[0041] After analyzing the transcriptome data on the Meiji Cloud platform as described in step S1, candidate reference genes were screened according to the following criteria:
[0042] (1) The expression level was greater than 190 in all samples;
[0043] (2) There was no significant difference in expression levels among all samples, i.e., p value > 0.05;
[0044] (3) Calculate the coefficient of variation (CV) of genes in all samples and sort them from small to large. Select the first 12 genes that meet the above conditions as candidate internal reference genes, and introduce Actin A3, which is often used as an internal reference gene, as a reference internal reference gene for subsequent analysis.
[0045] The 12 candidate reference genes are numbered as follows: BGIBMGA002429 (accession number: NM_001043836.1), BGIBMGA000526 (accession number: NM_001043432.1), BGIBMGA006219 (accession number: XM_004929234.4), BGIBMGA007469 (accession number: NM_001044073.1), BGIBMGA002493 (accession number: XM_004931099.4), BGIBMGA010751 (accession number: XM_00104929234.4). 96249.3), BGIBMGA010604 (accession number: NM_001043907.1), BGIBMGA003828 (accession number: XM_004926412.4), BGIBMGA006794 (accession number: XM_062670355.1), BGIBMGA007043 (accession number: XM_004932417.4), BGIBMGA003475 (accession number: NM_001043388.1) and BGIBMGA003608 (accession number: NM_001044045.1).
[0046] Figure 1 Shown are the expression levels and CV values of 12 candidate reference genes and a reference gene (ActinA3) in all samples at all developmental stages of silkworm.
[0047] S3. Design and synthesis of candidate internal reference gene primers:
[0048] Primers were designed using the primer design software Oligo7 (Version: 7.60, USA), and primers were designed in the core coding regions of 12 candidate reference genes and 1 reference reference gene (ActinA3), so that the annealing temperature (Tm) of each primer ranged from 58 to 62°C, and the length of the amplified product ranged from 80 to 300 bp. Each primer was tested and optimized until the amplification efficiency was high, no mismatches occurred, and no nonspecific amplification peaks were generated. A total of 26 specific primers were designed, with primer sequence numbers: SRGF.01 (SEQ ID No: 2) to SRGR.26 (SEQ ID No: 27). The primer synthesis service was commissioned to Shanghai Jierui Bioengineering Co., Ltd. for synthesis, and the primer sequences are shown in Table 1.
[0049] Table 1. Primer sequences
[0050]
[0051] S4. Extraction of samples from all developmental stages of silkworm and template synthesis:
[0052] About 300 diapause eggs from the same batch of silkworms were used for the experiment, of which 50 eggs were used to extract total RNA from eggs, and the remaining 250 eggs were used to hatch into silkworms (i.e., first-instar larvae). Silkworms were raised in an environment of 25°C and 70% humidity, with a photoperiod of 12 hours of darkness and 12 hours of light, and fed with fresh mulberry leaves. During the feeding process, total RNA was extracted from the larval stage of silkworms growing to the first, second, third, fourth, and fifth instars; after the silkworm larvae pupated, total RNA from the pupa stage was extracted; after the pupa turned into a moth, total RNA from the moth stage was extracted. After extracting total RNA from samples of all developmental stages of silkworms, the total RNA content and purity of all samples were measured using the OneDrop device, and the total RNA concentration was diluted to 200 ng / μL using Free-RNase and DNase water. cDNA was synthesized using the HiScriptII 1st Strand cDNA Synthesis Kit (+gDNA wiper) (Vazyme, China), and diluted 3 times with Free-RNase and DNase water as a template for qPCR experiments.
[0053] S5. Real-time fluorescence quantitative PCR reaction of candidate internal reference genes:
[0054] The candidate reference genes and reference genes were amplified using 2×SYBR Green qPCR Mix (SparkJade, China), and three replicates were set for each developmental stage sample. The amplification reaction system was configured according to Table 2. The amplification reaction was performed in the Quanstudio 3 Real-Time PCR System of ThermoFisher using the program in Table 3.
[0055] Table 2. qPCR reaction system configuration
[0056] Components 10μL system Final concentration 2x SYBR qPCR Mix 5.0μL 1x Candidate internal reference gene forward primer (10uM) 0.2μL 0.2μM Candidate internal reference gene reverse primer (10uM) 0.2μL 0.2μM Rox Reference DyeⅡ 0.2μL as required cDNA 1.0μL / RNase FreeWater 3.4μL /
[0057] Table 3. qPCR reaction program
[0058]
[0059] Note: min means minutes, sec means seconds
[0060] The results are as follows Figure 2 As shown in the figure, it can be seen that the Cq values of the 12 candidate internal reference genes and the reference internal reference gene (ActinA3) involved in this embodiment range from 14.5 to 29.6, which belongs to the reasonable range of Cq values, indicating that the primers of the candidate internal reference genes are reasonably designed and the amplification system is effective.
[0061] Example 2: Analysis of expression stability of candidate reference genes at different developmental stages of silkworm
[0062] According to the Cq values of the 12 candidate internal reference genes and the reference internal reference gene (ActinA3) at different developmental stages of silkworms obtained in step S5 of Example 1, the online tool RefFindr (http: / / blooge.cn / RefFinder / ) was used to evaluate the stability of the 12 candidate internal reference genes and the ActinA3 gene by using four algorithms: Comprehensive ranking, delta CT, BestKeeper, and Normfinder. The smaller the value obtained by the four algorithms, the better the stability and the higher the ranking.
[0063] According to the ranking of the four algorithms, among the 12 candidate internal reference genes, the genes ranked higher than ActinA3 at different developmental stages were selected as preferred internal reference genes, totaling 4, namely BGIBMGA002429, BGIBMGA007469, BGIBMGA006794 and BGIBMGA003469 (the evaluation scores of the four algorithms for the preferred internal reference genes are shown in Tables 4 and 5).
[0064] Table 4. The stability evaluation scores of the selected reference genes in Comprehensive and delta CT at different developmental stages of silkworm
[0065]
[0066] Table 5. Stability evaluation scores of the preferred reference genes in BestKeeper and Normfinder at different developmental stages of silkworm
[0067]
[0068] Comparison of qPCR results correction by 4 optimal internal reference genes:
[0069] According to the transcriptome data of the silkworm sample described in step S1 of Example 1, two genes with known expression levels in all developmental stages of silkworm were selected as target genes, and four preferred internal reference genes and one reference internal reference gene were used to correct the results of the two genes with known expression levels. The gene expression level in the egg stage was used as a calibration sample, and the gene expression levels in other developmental stages were divided by the gene expression level in the egg stage. The change trend of the two genes with known expression levels in the egg stage in the first, second, third, fourth, fifth, pupa and moth stages was calculated, and the relative expression levels of the genes (by 2 -△△CqThe method of calculation was used to determine whether the expression trends of the two genes with known expression levels were consistent with those of the four preferred internal reference genes and one reference internal reference gene, and to determine the accuracy of the four preferred internal reference genes and one reference internal reference gene. The two genes with known expression levels were BGIBMGA000526 and BGIBMGA003608 (the expression levels of BGIBMGA000526 in other stages were higher than those in the egg stage compared with the egg stage, while the expression levels of BGIBMGA003608 in other stages were lower than those in the egg stage compared with the egg stage, which was representative), and one reference internal reference gene was ActinA3.
[0070] The gene expression level in the egg stage was used as the expression level calibrator. The expression levels of BGIBMGA000526 and BGIBMGA003608 genes in the whole development stage of silkworm were as follows: Figure 3 As shown in Figure 2, the qPCR results of the expression of BGIBMGA000526 and BGIBMGA003608 genes were corrected by 4 preferred internal reference genes and 1 reference internal reference gene, and the relative expression of the genes was as follows: Figure 4 and Figure 5 As shown, according to the correction results, when only BGIBMGA002429 is used as the internal reference gene, the expression of the two target genes BGIBMGA000526 and BGIBMGA003608 is consistent with the transcriptome sequencing results, indicating that when only BGIBMGA002429 is used as the internal reference gene, the expression of the two target genes BGIBMGA000526 and BGIBMGA003608 can be correctly corrected. The name of the BGIBMGA002429 gene is Cyclophilin A (CYPA), so it is finally determined that CYPA can be used as an internal reference gene for all developmental stages of silkworms. Its nucleotide sequence is shown in SEQ ID No: 1, and its primers are SRGF.01 and SRGR.02 in Table 1. The nucleotide sequence information of the primers is shown in SEQ ID No: 2 and SEQ ID No: 3.
[0071] SEQ ID No: 1:
[0072] atgtctctaccacgagtattcttcgacgtcactgttgacgatgccccactgggaaaaattgttatgagctgagaagtgacgtcactcccaagacgtgtgaaaacttccgtgccctgtgcactg gcgagaaaggcttcggttacaagggctccattttccatcgtgtcatccccaatttcatgctgcaaggaggggacttcaccaaccataacggcactgggggaaagtccatctacggcaataagttt gaagacgagaatttcacccttaagcacactggacctggcatcctctccatggctaatgccggtgctgatactaatggttcccagttcttcatcaccactgtcaagacctcctggctggatggca gacatgttgtctttgggaatgttgttgaaggcatggaagttgtcaagcagattgagacctttggcagccagtctgggaagacctctaagagaatcgttatcaaagactgtggtcagattgcctaa
[0073] Example 3: Application of CYPA as an internal reference gene
[0074] Using CYPA as an internal reference gene, the expression levels of the silkworm reproductive development-related genes Siwi (accession number: NM_001104596.2) and Ago (accession number: NM_001104597.2) in all developmental stages of silkworms were detected. Siwi and Ago genes contribute to the sexual differentiation and wing development of silkworms and are key genes in the reproductive development of silkworms. Moreover, Siwi and Ago genes can function as synergistic proteins, and their expression patterns are the same, that is, their expression is the same at different developmental stages of silkworms.
[0075] The qPCR reaction system was configured according to Table 2, and the experimental amplification program was set according to Table 3. The egg stage was used as a calibrator sample, and the gene expression was measured using 2 -△△Cq The expression levels of Siwi and Ago genes in the whole development stage of silkworm were calculated by the formula. Figure 6 Compared with the egg development stage, the expression levels of Siwi and Ago genes decreased from the first to the fifth instar, while in the pupa and moth stages, the expression levels of Siwi and Ago genes increased significantly. The expression of the two genes was the same in each developmental stage of B. mori, indicating that CYPA as an internal reference gene is suitable for expression analysis of related genes in each developmental stage of B. mori.
[0076] As described above, it is only a description of the real-time scheme of the CYPA internal reference gene of the present invention. The present invention screens out the CYPA gene stably expressed in all developmental stages of silkworm through transcriptomics, which can be used as an internal reference gene in qPCR experiments at all developmental stages of silkworm to perform expression analysis on related genes.
[0077] Although the embodiments of the present invention have been disclosed as above, they are not limited to the applications listed in the specification and the implementation modes, and they can be fully applied to various fields suitable for the present invention. For those familiar with the art, additional modifications can be easily implemented. Therefore, without departing from the general concept defined by the claims and the scope of equivalents, the present invention is not limited to the specific details and the illustrations shown and described herein.
Claims
1. An internal reference gene for gene expression analysis at all developmental stages of silkworm, characterized in that: The internal reference gene is the Cyclophilin A (CYPA) gene, and its nucleotide sequence is shown in SEQ ID No:
1.
2. The internal reference gene according to claim 1, characterized in that The full developmental stages of the silkworm include: eggs, larvae, pupae and adults, wherein the larval stage includes the first instar, the second instar, the third instar, the fourth instar and the fifth instar.
3. The internal reference gene according to claim 1, characterized in that The primer sequences of the internal reference gene are shown in SEQ ID No: 2 and SEQ ID No:
3.
4. Primers for gene expression analysis of reference genes in all developmental stages of silkworm, characterized in that: The primer sequences are shown in SEQ ID No: 2 and SEQ ID No:
3.
5. A kit for analyzing gene expression in all developmental stages of silkworm, comprising the primers according to claim 4.
6. Use of the internal reference gene according to any one of claims 1 to 3, the primer according to claim 4, or the kit according to claim 5 in gene expression analysis at all developmental stages of silkworm.
7. The method for screening the internal reference gene according to any one of claims 1 to 3, characterized in that: The method comprises: (1) Based on the transcriptome data of silkworms at different developmental stages, candidate reference genes were screened and qPCR primers were designed; (2) taking silkworm samples at different developmental stages, extracting RNA and reverse transcribing cDNA, using the obtained cDNA as a template, and performing qPCR experiments on the candidate internal reference candidate genes with the primers designed in step (1) to obtain the Cq value of each candidate internal reference gene at different developmental stages of silkworm; (3) Evaluate the stability of candidate reference genes at different developmental stages of silkworm; (4) The candidate reference genes were compared with reference genes in terms of expression level and stability, and finally the reference genes suitable for all developmental stages of silkworm were selected.
8. The screening method according to claim 7, characterized in that The transcriptome data described in step (1) include stable expression levels during developmental stages, no significant differences (p>0.05), expression levels greater than 190, and a small coefficient of variation.
9. The screening method according to claim 7, characterized in that Four online tools, namely Comprehensive ranking, deltaCT, BestKeeper and Normfinder, were used to evaluate the stability of candidate reference genes in different developmental stages of silkworm.
10. The screening method according to claim 7, characterized in that The reference gene in step (4) is the ActinA3 gene.