Specific non-coding RNA for determining tissue source and application thereof

Abstract

The invention belongs to the technical field of molecular biotechnology and forensic medicine, and particularly relates to specific non-coding RNA (Ribonucleic Acid) for judging a tissue source and an application of the specific non-coding RNA. Relatively specific non-coding RNA of different tissues is provided, a relatively specific non-coding RNA detection technology is provided for defining the tissue or body fluid source of biological blackspots, and the detection technology has better accuracy and stability, can provide important evidence for determining case properties and performing crime scene reconstruction, and has good application prospects. Therefore, the method has good practical application value.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology and forensic medicine, and in particular relates to specific non-coding RNA for determining tissue origin and application thereof. Background Art

[0002] The information disclosed in the background of the invention is only intended to enhance the understanding of the overall background of the invention and should not be necessarily regarded as an acknowledgment or any form of suggestion that the information constitutes the prior art already known to a person skilled in the art.

[0003] Tissue residues at violent crime scenes are a very representative type of biological specimen, including tissue fragments, knife and gun wipes, or tissue stains attached to clothing. Similarly, traces of body fluids cannot be ignored, such as blood stains, semen stains, saliva stains, etc., which are also the most common forms of biological evidence at crime scenes. In forensic medicine and criminal investigation, correctly identifying the tissue source of biological stains left at the crime scene is crucial to solving the case. In general, tissue residues can be identified by their gross morphology or tissue section observations to identify their source. However, for body fluid scars and severely corrupted tissue residues, determining their source is a major challenge.

[0004] There are many methods for identifying the source of tissues or body fluids in forensic medicine. Traditional identification methods such as enzymatic reactions or immunological tests are simple and fast, but they consume a large amount of biological samples and have low stability and tissue specificity. Spectroscopic identification provides the possibility for non-destructive identification of forensic tissues or body fluids, but it cannot effectively distinguish the complexity of samples at the scene of the case. There may be cross-influences between different tissues of non-biological samples or biological samples and different levels of the same tissue. In recent years, with the advancement of biotechnology, researchers have paid more and more attention to the huge potential of non-coding RNA (ncRNA) in the identification of the source of tissues or body fluids, which is expected to bring new research directions and breakthroughs to the determination of tissues or body fluids of unknown origin in case detection.

[0005] Non-coding RNA refers to functional RNA molecules in the transcriptome that are not translated into proteins. They are widely present in various organisms. Although these RNAs are not directly involved in protein synthesis, they play an important role in gene expression regulation, cell cycle regulation, signal transduction and genome stability maintenance, and are closely related to the occurrence and development of many diseases. Long non-coding RNA (lncRNA), microRNA (miRNA), and circular RNA (circRNA) are important members of non-coding RNA and have unique structural and functional characteristics. In forensic evidence, non-coding RNA has a very broad application prospect. In tissue fragments or body fluid stains such as blood, semen or saliva found at the crime scene, by detecting specific non-coding RNA markers, the source of these stains can be quickly and accurately identified, thereby helping the police narrow the scope of suspects and accelerate the detection of cases. In addition, the detection of non-coding RNA can also be used to confirm the identity of the body, especially when other conventional methods cannot reach a clear conclusion, the analysis of non-coding RNA may provide key clues.

[0006] lncRNA is a non-coding RNA molecule with a length of more than 200 nucleotides, which can regulate gene expression at multiple levels (such as epigenetic regulation, transcriptional regulation, and post-transcriptional regulation). lncRNA is involved in many important regulatory processes such as X chromosome silencing, genomic imprinting, and chromatin modification. The diversity of its functions makes it potentially valuable in determining the source of tissues or body fluids, and related fields need further research.

[0007] miRNA is an endogenous regulatory RNA with a length of about 20-25 nucleotides. It plays an important role in a variety of biological processes. It recognizes target RNA by complementary base pairing and guides the silencing complex to degrade the target RNA or repress the translation of the target RNA according to the degree of complementarity. miRNA is highly conserved in species evolution. The miRNA expression profiles of different tissues and body fluids are different, which makes miRNA another powerful tool for judging tissues or body fluids of unknown origin. By analyzing the expression profiles of miRNAs in different tissues or body fluids, its source can be determined and the potential biological process can be revealed. circRNA is a newly discovered special RNA molecule that does not have a 5' cap and a 3' poly (A) structure and forms a circular molecular structure with covalent bonds. It is produced by reverse splicing after transcription of precursor RNA and participates in gene transcription and post-transcriptional regulation. It plays an important role in organisms. circRNA is widely present in eukaryotes and has high stability and tissue specificity. This characteristic makes circRNA a powerful tool for judging tissues or body fluids of unknown origin. Detecting the types of tissue-specific circRNAs contained in biological stains helps forensic scientists identify the tissue or body fluid source of the biological stains. However, the inventors found that although non-coding RNA has a great advantage in determining the source of tissues, it is often not enough to use only one type of non-coding RNA to accurately determine the source of crime scene tissues. Summary of the invention

[0008] In view of the problems existing in the prior art, the purpose of the present invention is to provide specific non-coding RNA for determining tissue origin and its application. Specifically, the present invention obtains non-coding RNA (including long non-coding RNA, circular RNA and microRNA) by screening and constructing expression profiles in different tissues, which are applied to the tracing of human organ tissues. Based on the above research results, the present invention is completed.

[0009] Specifically, the technical solution of the present invention is as follows:

[0010] The first aspect of the present invention provides a specific non-coding RNA for determining the tissue origin, wherein the specific non-coding RNA includes long non-coding RNA, circular RNA and micro RNA;

[0011] Among them, the long non-coding RNAs include LINC00702, BANCR, TRDN-AS1, LINC01093, LINC01767, FAM99A, LINC01485, BBOX1-AS1, CADM3-AS1, LINC01645, ATP13A4-AS1, SFTA1P, LINC00968, LINC01863, LINC01187, COMETT, PRKAR1B-AS2, SOX2-OT, LINC02774 and LINC01361;

[0012] The circular RNA includes chr1:141450089-141450272, chr5:123628257-123630682, chrX:133491273-133508778, chr5:90893166-90893973, chr2:73747920-73749113 and chr5:122553865-122555045;

[0013] The microRNAs include miR-1a-3p, miR-133b-3p, miR-208a-3p, miR-499-5p, miR-99a-3p, miR-99a-5p, miR-199a-5p and miR-26a-1-3p, let-7c-5p, miR-18a-5p, miR-19b-3p, miR-155-5p, let-7e-5p, miR-20a-5p, miR-20b-5p, miR-141-3p, miR-192-5p, miR-194-2-3p, miR-200a-3p, miR-124-3p, miR-124-5p, miR-218-2-3p and miR-218-5p.

[0014] The second aspect of the present invention provides the use of a reagent for detecting the above-mentioned specific non-coding RNA in the preparation of a product for determining the tissue origin.

[0015] A third aspect of the present invention provides a system for determining tissue origin, the system comprising:

[0016] An acquisition unit is configured to: acquire the above-mentioned specific non-coding RNA of the sample to be tested;

[0017] The evaluation unit is configured to determine the tissue origin of the sample to be tested according to the expression of the specific non-coding RNA obtained by the acquisition unit.

[0018] Beneficial technical effects of one or more of the above technical solutions:

[0019] The above technical scheme provides relatively specific non-coding RNAs for different tissues. The results show that the candidate single-factor indicative ncRNAs screened out are: heart: miRNA: miR-133b-3p; liver: miRNA: miR-99a-5p; spleen: cirRNA: chrX: 133491273-133508778, miRNA: miR-155-3p; lung: cirRNA: chr19: 9159758-9162413; kidney: lncRNA: PRKAR1B-AS2, LINC01187; brain: cirRNA: chr19: 36323990-3643396. The above technical scheme provides a relatively specific non-coding RNA detection technology for clarifying the tissue or body fluid source of biological stains. The detection technology has better accuracy and stability, and can provide important evidence for determining the nature of the case and reconstructing the crime scene, so it has good practical application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] The accompanying drawings in the specification, which constitute a part of the present invention, are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute improper limitations on the present invention.

[0021] Figure 1 The expression of circRNA in heart, liver, spleen, lung, kidney and brain was detected by RT-PCR of the present invention; wherein, (a) chr2:76695960-76722254, (b) chr1:141450089-141450272, (c) chr5:123628257-123630682, (d) chr5:90893166-90893973, (e) chrX:133491273-133508778, (f) chr4:46482799-4 6484339, (g) chr2:73747920-73749113, (h) chr14:70922421-70923829, (i) chr19:9159758-9162413, (j) chr2:142082256-142086897, (k) chr5:122553865-122555045, (l) chr5:14539409-14540801 and (m) chr13:36323990-3643396.

[0022] Figure 2The present invention is RT-PCR detection of lncRNA expression in heart, liver, spleen, lung, kidney and brain; wherein, (a) miR-1a-3p, (b) miR-133b-3p, (c) miR-208a-3p, (d) miR-499-5p, (e) miR-99a-3p, (f) miR-99a-5p, (g) miR-199a-5p, (h) miR-26a-1-3p, (i) let-7c-5p, (j) miR-18 a-5p, (k)miR-19b-3p, (l)miR-155-5p, (m)let-7e-5p, (n)miR-20a-5p, (o)miR-20b-5p, (p)miR-141-3p, (q)miR-192-5p, (r)miR-194-2-3p, (s)miR-200a-3p, (t)miR-124-5p, (u)miR-218-2-3p and (v)miR-218-5p.

[0023] Figure 3 RT-PCR detection of lncRNA expression in heart, liver, spleen, lung, kidney and brain of the present invention, including (a) LINC00702, (b) BANCR, (c) TRDN-AS1, (d) FAM99A, (e) LINC01093, (f) LINC01767, (g) LINC01485, (h) BBOX1-AS1, (i) CADM3-AS1, (j) LINC01645, (k) SFTA1P, (l) LINC01863, (m) ATP13A4-AS1, (n) LINC00968, (o) LINC01187, (p) MFSD4A-AS1, (q) COMETT, (r) PRKAR1B-AS2, (s) SOX2-OT, (t) LINC01361 and (u) LINC02774.

[0024] Figure 4 The ROC curve of ncRNAs with candidate validation factors in different tissues analyzed by univariate logistics of the present invention is illustrated, including (a) miR-133b-3p, (b) miR-99a-3p, (c) chrX:133491273-133508778, (d) miR-155-5p, (e) chr19:9159758-9162413, (f) PRKAR1B-AS2, (g) LINC01187, and (h) chr19:36323990-3643396. DETAILED DESCRIPTION

[0025] It should be noted that the following detailed descriptions are all illustrative and intended to provide further explanation of the present invention. Unless otherwise specified, all technical and scientific terms used herein have the same meanings as those commonly understood by those skilled in the art to which the present invention belongs.

[0026] It should be noted that the terms used herein are only for describing specific embodiments and are not intended to limit exemplary embodiments according to the present invention. As used herein, unless the context clearly indicates otherwise, the singular form is also intended to include the plural form. In addition, it should be understood that when the terms "comprising" and / or "including" are used in this specification, it indicates the presence of features, steps, operations, devices, components and / or combinations thereof.

[0027] In a typical embodiment of the present invention, a specific non-coding RNA for determining tissue origin is provided, wherein the specific non-coding RNA includes long non-coding RNA, circular RNA and micro RNA;

[0028] Among them, the long non-coding RNAs include LINC00702, BANCR, TRDN-AS1, LINC01093, LINC01767, FAM99A, LINC01485, BBOX1-AS1, CADM3-AS1, LINC01645, ATP13A4-AS1, SFTA1P, LINC00968, LINC01863, LINC01187, COMETT, PRKAR1B-AS2, SOX2-OT, LINC02774 and LINC01361;

[0029] The circular RNA includes chr1:141450089-141450272, chr5:123628257-123630682, chrX:133491273-133508778, chr5:90893166-90893973, chr2:73747920-73749113 and chr5:122553865-122555045;

[0030] The microRNAs include miR-1a-3p, miR-133b-3p, miR-208a-3p, miR-499-5p, miR-99a-3p, miR-99a-5p, miR-199a-5p and miR-26a-1-3p, let-7c-5p, miR-18a-5p, miR-19b-3p, miR-155-5p, let-7e-5p, miR-20a-5p, miR-20b-5p, miR-141-3p, miR-192-5p, miR-194-2-3p, miR-200a-3p, miR-124-3p, miR-124-5p, miR-218-2-3p and miR-218-5p.

[0031] In another specific embodiment of the present invention, the specific non-coding RNA is a group consisting of miR-133b-3p, miR-99a-3p, chrX:133491273-133508778, miR-155-5p, chr19:9159758-9162413, PRKAR1B-AS2, LINC01187 and chr19:36323990-3643396.

[0032] In the present invention, the tissues include heart, liver, spleen, lung, kidney and brain tissues.

[0033] In another specific embodiment of the present invention, there is provided use of a reagent for detecting the above-mentioned specific non-coding RNA in the preparation of a product for determining the tissue origin.

[0034] The reagents for the above-mentioned specific non-coding RNA include reagents for detecting the above-mentioned specific non-coding RNA based on RT-PCR, real-time (fluorescence) quantitative PCR, in situ hybridization, gene chip and gene sequencing.

[0035] The product includes but is not limited to primers, probes, gene chips, nucleic acid membrane strips, detection kits, detection devices or detection equipment for detecting the expression level of the specific non-coding RNA in the sample to be tested, and is not specifically limited here.

[0036] The tissue source of the sample to be tested may be tissues including heart, liver, spleen, lung, kidney and brain.

[0037] In another specific embodiment of the present invention, a system for determining tissue origin is provided, the system comprising:

[0038] An acquisition unit is configured to: acquire the above-mentioned specific non-coding RNA of the sample to be tested;

[0039] The evaluation unit is configured to determine the tissue origin of the sample to be tested according to the expression of the specific non-coding RNA obtained by the acquisition unit.

[0040] In another specific embodiment of the present invention, the tissue source of the sample to be tested may be tissues including heart, liver, spleen, lung, kidney and brain; the sample to be tested may be a body fluid (scar) sample or a tissue sample, and the tissue sample may be a corrupted residual tissue.

[0041] The present invention has verified that miR-133b-3p is a specific non-coding RNA for heart tissue; miR-99a-3p is a specific non-coding RNA for liver tissue, chrX:133491273-133508778 and miR-155-5p are specific non-coding RNAs for spleen tissue, chr19:9159758-9162413 is a specific non-coding RNA for lung tissue; PRKAR1B-AS2 and LINC01187 are specific non-coding RNAs for kidney tissue; chr19:36323990-3643396 is a non-specific non-coding RNA for brain tissue.

[0042] The present invention is further explained by the following examples, but they are not intended to limit the present invention. It should be understood that these examples are only used to illustrate the present invention and are not intended to limit the scope of the present invention.

[0043] Example

[0044] Experimental methods

[0045] 1. Screening of tissue-specific ncRNA

[0046] 1) Specific screening steps for tissue-specific circRNAs:

[0047] 1. Search for relevant information of tissue-specific circRNA in the Tissue-Specific CircRNA Database (TSCD) (http: / / gb.whu.edu.cn / TSCD / );

[0048] 2. Download the relevant data of circRNA specifically expressed in five tissues: heart, liver, spleen, lung and kidney;

[0049] 3. Perform preliminary screening based on the principle of getting the number of reads as high as possible. The higher the number of reads, the higher the sequence quality;

[0050] 4. In order to design the ideal primers, the reverse primers of circRNA should meet the following criteria: GC content ∈ [40%-60%], Tm value ∈ [57℃-60℃], and amplification product length 50-220bp. According to these criteria, the tissue-specific circRNAs that meet the conditions can be further screened.

[0051] 5. Further narrow the research scope of tissue-specific circRNA by referring to the function of the circRNA source gene.

[0052] 2) Specific screening steps for tissue-specific miRNAs:

[0053] 1: First, in the Tissue Specificity Index (TSI) module of the miRNA Tissue Atlas database, check Tissue and Cell Line (rpmm norm) on TissueAtlas 2025 and download all TSI files. The TSI value range is 0-1, and the file contains the specific names of all miRNAs.

[0054] 2: Further screen out miRNAs with actual sample numbers greater than 10,000 and TSI greater than 0.5 from the downloaded files based on tissue expressed samples count and tissue rawTSI. It is considered that only those with TSI greater than 0.5 have tissue specificity.

[0055] 3: Next, select Tissue Atlas 2025 from the tissue section, Rpmm norm, heart, liver, spleen, lung, kidney, and brain for the Organ system and Tissue options respectively. After submission, record the tissue average expression of each miRNA, search and query the miRNAs in step 2 one by one, and filter out miRNAs with avg-expression greater than 1000 for backup.

[0056] 4: Then, the miRBase database is queried for comprehensive information such as the miRNA sequence data, annotations, and gene target predictions selected above. miRNAs with diverse functions and those specifically expressed in tissues or that may have certain specific biological functions are further considered.

[0057] 3) Specific screening steps for tissue-specific lncRNA:

[0058] 1: By searching for relevant information about normal tissues and cell lines in the lncExpDB database, we first set the tissue-specific index T value greater than 0.8 and the coefficient of variation less than 3 as screening conditions to screen the data from the protein atlas, i.e., the HPA database, and select genes with gene characteristics as preliminary candidate genes;

[0059] 2: Then the gene ID number is entered into the NCBI and NONCODE databases for search and comparison. Secondary screening is performed again based on the presence or absence of gene information and whether the expression level in the tissue is consistent with the results in the lncExpDB database, and genes with relatively specific expression in a certain tissue are screened out in the three databases;

[0060] 3: Use the NONCODE database to search for the gene sequence after secondary screening, and finally search for the primers used for real-time fluorescence quantitative PCR based on PubMed. Finally, determine the final candidate lncRNA gene based on the presence or absence of primers.

[0061] 2. Extraction of miRNA and lncRNA-enriched fractions in tissues

[0062] 1. Sample processing a. Tissue: Grind the tissue in liquid nitrogen. Add 1 ml of lysis solution MZ for every 30-50 mg of animal tissue or 100 mg of plant tissue, and homogenize it with a homogenizer. The sample volume should not exceed one tenth of the volume of lysis solution MZ. b. Monolayer culture cells: Add lysis solution MZ directly to the culture plate to lyse the cells, and add 1 ml of MZ for every 10 cm2 area. Use a sampler to pump several times. Note: The amount of lysis solution MZ added is determined by the area of ​​the culture bottle, not the number of cells. If the amount is insufficient, DNA contamination may occur in the extracted RNA. c. Cell suspension: Centrifuge at 2,100 rpm (400×g) for 5 min to remove the cells and discard the supernatant. Add 1 ml of lysis solution MZ and mix by shaking with a shaker or pipetting several times. Do not wash the cells before adding lysis solution MZ to avoid degradation.

[0063] 2. Place the homogenized sample at room temperature for 5 minutes to allow the nucleic acid-protein complex to be completely separated.

[0064] 3. Optional step: Centrifuge at 4℃12,000rpm for 5min, take the supernatant and transfer it to a new RNase-free centrifuge tube. Note: If the sample contains a lot of protein, fat, polysaccharide or muscle, plant nodule part, etc., this step can be added to remove them by centrifugation. The precipitate obtained by centrifugation includes cell outer membrane, polysaccharide, high molecular weight DNA, and RNA is present in the supernatant solution.

[0065] 4. Add 200 μl of chloroform, cover the tube, shake vigorously for 15 seconds, and leave at room temperature for 5 minutes.

[0066] 5. Centrifuge at 12,000 rpm for 15 minutes at 4°C. The sample will separate into three layers: a yellow organic phase, an intermediate layer, and a colorless aqueous phase. RNA is mainly in the aqueous phase, and the volume of the aqueous phase is about 50% of the lysis buffer MZ reagent used. Transfer the aqueous phase to a new tube and proceed to the next step.

[0067] 6. Measure the volume of transfer solution, slowly add 0.43 times the volume of anhydrous ethanol (e.g. 500μl of transfer solution plus 215μl of anhydrous ethanol), mix well (precipitate may appear at this time). Transfer the obtained solution and precipitate into the adsorption column miRspin, centrifuge at room temperature 12,000rpm for 30sec. If all the solution and mixture cannot be added to the adsorption column miRspin at one time, please transfer them twice. After centrifugation, discard the adsorption column miRspin and retain the effluent.

[0068] 7. Measure the volume of the effluent, slowly add 0.75 times the volume of anhydrous ethanol (e.g. 700μl of effluent plus 525μl of anhydrous ethanol), and mix well (precipitate may appear at this time). Transfer the obtained solution and precipitate into the adsorption column miRelute, centrifuge at room temperature 12,000rpm for 30sec. If all the solution and mixture cannot be added to the adsorption column miRelute at one time, please transfer them twice. After centrifugation, discard the effluent and keep the adsorption column miRelute.

[0069] 8. Add 500 μl of deproteinized solution MRD to the adsorption column miRelute (please check whether ethanol has been added first), let it stand at room temperature for 2 minutes, centrifuge at 12,000 rpm (~13,400×g) at room temperature for 30 seconds, and discard the waste liquid.

[0070] 9. Add 500 μl of rinse solution RW to the adsorption column miRelute (please check whether ethanol has been added first), let it stand at room temperature for 2 minutes, centrifuge at 12,000 rpm for 30 seconds at room temperature, and discard the waste liquid.

[0071] 10. Repeat step 9.

[0072] 11. Place the miRelute adsorption column in a 2 ml collection tube and centrifuge at 12,000 rpm for 1 min at room temperature to remove the residual liquid. Note: This step is to remove the residual rinse solution in the adsorption column. After centrifugation, place the miRelute adsorption column at room temperature for a while, or place it on a clean bench for ventilation for a while to fully dry. If there is any rinse solution left, it may affect subsequent experimental operations such as RT.

[0073] 12. Transfer the adsorption column miRelute to a new RNase-Free 1.5ml centrifuge tube, add 15-30μl RNase-Free ddH2O, leave at room temperature for 2min, and centrifuge at 12,000rpm (~13,400×g) for 2min. Note: The volume of elution buffer should not be less than 15μl. Too small a volume will affect the recovery efficiency. And RNA should be stored at -70℃ to prevent degradation. Note: If you want to increase the RNA yield, repeat the above step once.

[0074] 3. Extraction of circRNA-enriched fractions in tissues

[0075] The initial total RNA extraction method refers to the second part of the experimental method. The next steps are:

[0076] 1. RNase R digestion reaction. a. Prepare the following reaction system on ice according to the table below:

[0077] Reagent Volume / Concentration RNA >5 μg 10X RNase R Reaction Buffer 2μl 5μl RNase R (20U / μl) 1-3U / μg RNA 1-3U / μg RNA DEPC-treated Water up to 20μl up to 50μl

[0078] b. Reaction conditions: 37℃ for 10-30min, inactivation at 70℃ for 10min.

[0079] Note: The amount of RNase R and the volume of the reaction system need to be adjusted through experiments according to the specific situation.

[0080] 2. After RNase R digestion reaction, circular RNA and other molecules in the reaction system are purified and recovered.

[0081] a. Phenol / chloroform extraction and ethanol precipitation to purify and recover circular RNA, etc.

[0082] (a) Add Nuclease-free Water to increase the reaction volume to 180 μl, then add 20 μl 3M sodium acetate (pH 5.2) or 20 μl 5M ammonium acetate and mix thoroughly. Add an equal volume of phenol / chloroform mixture (1:1) and extract once (violently vortex for 20-30 seconds, then centrifuge at 12000 rpm for 5-10 minutes to collect the supernatant).

[0083] (b) Add double volume of anhydrous ethanol to precipitate RNA and incubate at -20°C for at least 30 minutes. Then centrifuge at 12000 rpm at 4°C for 5-10 minutes to precipitate RNA.

[0084] (c) Discard the supernatant and wash the precipitate with about 500 μl of pre-cooled 70% ethanol to fully remove salt.

[0085] (d) Resuspend and dissolve the RNA in DEPC-treated water (R0021 / R0022) and store at -80°C.

[0086] b. Use RNA purification columns or RNA purification magnetic beads for purification and recovery. The product after RNase R digestion can be incubated at 70°C for 10 minutes to inactivate the enzyme. Usually, it does not need to be purified and can be directly reverse transcribed for subsequent RT-PCR, qPCR, etc.

[0087] 4. First-strand reverse transcription of miRNA plus A method to synthesize cDNA

[0088] Preparation of reverse transcription system: Thaw 2×miRNA RT Reaction Buffer and mix well. Put miRNA RT Enzyme Mix on ice for later use. Add the following reagents to a total volume of 20 μl in a pre-cooled RNase Free reaction tube on ice (add miRNA RT Enzyme Mix at the end).

[0089] Reagent components volume Final concentration Total RNA* - Up to 2μg 2×miRNA RT Reaction Buffer 10μl 1× miRNART Enzyme Mix 2μl - RNase-Free ddH2O Make up to 20 μl -

[0090] *Total RNA used in the reaction must contain small RNA. Small RNA can also be used as a template in this process, and the recommended amount is 2-5μl. The amount can be determined based on the abundance of the target miRNA, but for low-abundance miRNA samples (such as serum plasma extracts), a maximum volume of 8μl can be added directly.

[0091] 1. Reverse Transcription Procedure

[0092] Gently mix the prepared reaction solution with a pipette, and perform the reverse transcription reaction of miRNA according to the procedure in the following table:

[0093]

[0094]

[0095] The synthesized cDNA reaction solution can be stored at -30 to -15°C; it can also be directly used for downstream fluorescence quantitative detection. When performing downstream fluorescence quantitative detection, in order to avoid the inhibition of the reverse transcription system on the quantitative PCR reaction and obtain a suitable Ct value (between 15 and 30), the cDNA reaction solution can be diluted 10-1000 times before use.

[0096] 5. Reverse transcription of lncRNA and circRNA into cDNA

[0097] 1. Genomic DNA removal Prepare the following mixture in an RNase-free centrifuge tube:

[0098] Mix by gently pipetting. Incubate at 42°C for 2 min.

[0099]

[0100] 2. Prepare the reverse transcription reaction system

[0101] Add 5×HiScript III qRT SuperMix directly to the reaction tube in step 1.

[0102]

[0103] Mix by gently pipetting.

[0104] 3. Perform reverse transcription reaction

[0105]

[0106] * If the template has a complex secondary structure or a high GC region, the reaction temperature can be increased to 50°C to help increase the yield. The product can be used immediately for qPCR reaction, or stored at -20°C and used within six months; for long-term storage, it is recommended to store at -70°C after aliquoting. Repeated freezing and thawing of cDNA should be avoided.

[0107] VI. Fluorescence Quantification of miRNA

[0108] 1. Thaw 2×miRcute Plus miRNAPreMix, 50×ROX Reference Dye and ReversePrimer at room temperature.

[0109] 2. When using, please turn 2×miRcute Plus miRNA PreMix upside down and gently mix it evenly to avoid foaming, and use it after slight centrifugation. Note: If the reagent is not mixed, its reaction performance will be reduced, and do not use an oscillator to mix it.

[0110] 3. Place the reagents on ice and prepare the reaction system according to Table 1: Note: When using ABI's PRISM7000 / 7300 / 7700 / 7900HT, Step one / Step one plus PCR System fluorescence quantitative instrument, sample addition should be performed according to Table 2.

[0111] Table 1

[0112]

[0113]

[0114] Table 2

[0115]

[0116] Note: The amount of miRNA first-strand cDNA added should not exceed 1 / 10 of the volume of Real-time PCR. High-concentration cDNA is prone to non-specific amplification, so the cDNA can be appropriately diluted (10 times or 100 times). In Table b, the final concentration of ROX in PreMix and the additional ROX is 5× after mixing.

[0117] The PCR reaction program was set up as follows:

[0118]

[0119] VII. Fluorescence Quantification Detection of lncRNA and circRNA

[0120] 1. Prepare the following mixture in a qPCR tube

[0121]

[0122] 2. Perform qPCR reaction according to the following conditions

[0123]

[0124] This pre-denaturation condition is suitable for most amplification reactions. If the template structure is complex, the pre-denaturation time can be extended to 5 minutes to improve the pre-denaturation effect. The standard program selects 10 seconds; the shortest option for the rapid program is 3 seconds. The standard program selects 30 seconds; the rapid program: for amplicons within 200bp, the shortest extension time can be set to 10 seconds; for amplicons over 200bp, the recommended extension time is 30 seconds. Fluorescence signal acquisition.

[0125] 8. qPCR detection of non-coding RNA expression

[0126] qPCR Primers:

[0127] U6 internal reference Forward primer: CTCGCTTCGGCAGCACA

[0128] U6 internal reference Reverse primer: AACGCTCACGAATTTGCGT

[0129] circRNA upstream and downstream primer sequences:

[0130] chr1:141450089-141450272

[0131] Forward primer: AATGGAAAGTGGTCTGAGCC

[0132] Reverse primer: GGTAACGACAAGGAGGTGATG

[0133] chr5:123628257-123630682

[0134] Forward primer:AGGTGAAGTTTGCTGTGCTG

[0135] Reverse primer:AATTTTGGCGCCCCGTTC

[0136] chr5:90893166-90893973

[0137] Forward primer:GCCCCAGAACTTCTTTACTATGC

[0138] Reverse primer:ACTTCATGCAAATAGTGTCCCA

[0139] chr5:122553865-122555045

[0140] Forward primer:TATGTCCGGGAGATGCTGAC

[0141] Reverse primer:TGGTCTCTTCAGGATCAGCC

[0142] chr2:76695960-76722254

[0143] Forward primer:ACCTGCTCCCGAAGAAAAGA

[0144] Reverse primer:AGGGCGAATCTCACGGTTAT

[0145] chr14:70922421-70923829

[0146] Forward primer:GTGGTGATTGTAGGGGCTCT

[0147] Reverse primer:GAGAAGGCGTTTGAGGTGC

[0148] chr19:9159758-9162413

[0149] Forward primer: TGGTTATGTGGCATCCCTGA Reverse primer: GATGTCCGAAGAAGCTGAGC chr4: 46482799 - 46484339 Forward primer: GGGAGGAAGAAGAATTTGGACA Reverse primer: CGCTGACTTCATCCTCATCA chrX: 133491273 - 133508778 Forward primer: TGATCATGGTTCTAGTGGGC Reverse primer: CCTAGAGGCATGACTGTCAGG chr2: 73747920 - 73749113 Forward primer: GCATCAGTGTTATCTCGGCC Reverse primer: AACATCTTTCTTCCTGGCGG chr2: 142082256 - 142086897 Forward primer: CCCAGCTTCCGAAGACAAAG Reverse primer: CATCTGCTTCTTGGCTCTGC chr5: 14539409 - 14540801 Forward primer: CTCCCAACTTCAACACCTGC Reverse primer: AGGTGATTTGCTGGCTGTTG chr13: 36323990 - 3643396 Forward primer: TCCTGACATCCGCCTTTTCT Reverse primer: CTCCATGGTGTGTGTCTCCT

[0150] miRNA upstream primer (5'→3'):

[0151] miR-1a-3p: TGTAAACATCCTACAC

[0152] miR-133b-3p: CGCCGTCTGGCTCCGTGTCTT

[0153] miR-208a-3p: ATAAGACGAGCAAAAAGCTTGT miR-499-5p: GCCGAGTTTGGTCCTTC

[0154] miR-99a-3p: ACCCTGTATGTATGTTTTGCTG

[0155] miR-99a-5p: TGGCATAAACCCGTAGATCC

[0156] miR-199a-5p:CTCAACTGGTGTCGTGGAGTCGmiR-26a-1-3p:CGTCCTTCAAGTAATCCAGGAlet-7c-5p:CCAGCTGGGTGAGGTAGTAGGTTGT

[0157] miR-18a-5p:CGCTGGGGTAGTGTGTGGTT

[0158] miR-19b-3p:ACACTCCAGCTGGGTGAGGTAGTAGGTTGT

[0159] miR-155-5p:TTAATGCTAATCGTGATAGGGGT

[0160] let-7e-5p:CCAGCTGGGTGAGGTAGGAGGTTGT

[0161] miR-20a-5p:GCGGATGGACGTGATACTCG

[0162] miR-20b-5p:ACACTCCAGCTGGGTGAGGTAGTAGGTTGT

[0163] miR-141-3p:TGTAAACATCCTACAC

[0164] miR-192-5p:CCAGCTGGGTGAGGTAGT

[0165] miR-194-2-3p:CCAGCTGGGTGAGGTAGT

[0166] miR-200a-3p:GAGAGAAACGGTACAAA

[0167] miR-124-5p:ATGGCGGATGAAGTAATCGCG

[0168] miR-218-2-3p:CATGGTTCTGTCAAGCACCGCG

[0169] miR-218-5p:CATGGTTCTGTCAAGCACCGCG

[0170] Reverse Primer: The reverse primer is universal and matches the specific sequence of the stem-loop primer and is independent of the miRNA.

[0171] lncRNA upstream and downstream primer sequences:

[0172] Name Primer 5'→3'

[0173] LINC00702 F: ACCTTCCAAACTTGTGTCTTACC

[0174] R: TCTCCTTTCTTTTTTCAATCATC

[0175] BANCR F: AAACUACUAGGUAAAGGCACUUUU

[0176] R: GATAAAUUUAAAGCUCUGUGCC

[0177] TRDN-AS1 F: TCTCATGTGCCGAGGAAAAG

[0178] R: CTGAAGATGAAGCCCCGAAG

[0179] LINC01093 F: GTGAGCTTGCCCTGAGGA

[0180] R: AGGGCTCCAGTCTCTTTCCA

[0181] LINC01767 F: GCTAAGGGATTTGCCACTGC

[0182] R: GGTTGGAGGATGGACGTTGA

[0183] FAM99A F: GGCCCACGACATCAGGTAAA

[0184] R: TACGAAATGTCTCGGCGGTC

[0185] LINC01485 F: CCGCATGCCAATGTGAAACT

[0186] R: AAGACCCTCCTCAGCAAAGC

[0187] SFTA1P F: CAGCATTCCAGGACTCCTCA

[0188] R: TCAAGGGCAATATTCCGGGT

[0189] LINC01187 F: GTCAAGGCAAGCCGTAG AAG

[0190] R: TGGAGAGTCTGGCTGGAGTT

[0191] MFSD4A-AS1 F:GGCCGAAGCTGAAGAAGACG

[0192] R:TTGTGCCTGTGAATAGCCACTG

[0193] COMETT F:ATCAAATGGCTGTGGAGGAATG

[0194] R:AGTGGGACCTCAAAGCCTATG

[0195] PRKAR1B-AS2 F:TTGGACACTGCCCATCTT-CC

[0196] R:TGCAGCCACGGGATGTTT-AT

[0197] SOX2-OT F:GCT CGT GGC TTA GGA GAT TG

[0198] R:CTG GCA AAG CAT GAG GAA CT

[0199] BBOX1-AS1 F:GATGGGCACATTTGGAAGTT

[0200] R:CAGCGTTAGGTTTGGAGTTG

[0201] CADM3-AS1 F:AGAGGCTCAGGTCAGACAATACAG

[0202] R:CACCAACTGCGATGATTAGGC

[0203] LINC01645 F:ACATCTGGGAACTACCGCCA

[0204] R:TCATCACCACTGCACTCTTCC

[0205] ATP13A4-AS1 F:TGCTATAGGAACAGACTCGGTG

[0206] R:GGAGAGAAGCACCATGCACT

[0207] LINC00968 F:CCAGACTCCTCAGCCTGAAAT

[0208] R:GTCCCAAACGCAGACCATTTT

[0209] LINC01361 F:ACAGTGCAGGTGGTTCAAGAAG

[0210] R:GCTCGCTTCGGCAGCACATATAC

[0211] LINC02774 F:ACATTGGAGACAGCATGGAG

[0212] R:TCTAAGGTGTTGGAGCTGCT

[0213] LINC01863 F:CTCCTGGGTCCAGCTTGTTT

[0214] R:GATGCTTTGCCCACGGATTC

[0215] Set up the PCR reaction steps according to the instructions.

[0216] After the reaction is completed, the relative expression value of the target gene in this template is calculated according to the melting curve and Ct value according to 2-ΔΔCT and then analyzed.

[0217] IX. Statistical Analysis

[0218] The RT-PCR results were obtained from at least three independent experiments with three replicates each time. Unpaired t-test and one-way ANOVA analysis were used to analyze the statistical differences using GraphPad Prism 5.0 statistical software, and P < 0.05 was considered statistically significant.

[0219] Experimental Results

[0220] Through extensive database screening, primer design and synthesis, and RT-qPCR detection, 49 ncRNAs that are relatively specifically expressed in six tissues, including heart, liver, spleen, lung, kidney, and brain, were screened and verified, and binary logistics regression was used to analyze all differentially expressed ncRNAs.

[0221] Specifically, RT-PCR experiments were used to screen candidate lncRNAs, miRNAs, and circRNAs. The results of qPCR tests showed that, relative to the expression levels in the other five tissues, the sequences specifically expressed in the heart included: lncRNAs (LINC00702, BANCR, and TRDN-AS1), miRNAs (miR-1a-3p, miR-133b-3p, miR-208a-3p, and miR-499-5p); the sequences specifically expressed in the liver included: lncRNAs (LINC01093, LINC01767, FAM99A, and LINC0 1485), miRNA (miR-99a-3p, miR-99a-5p, miR-199a-5p and miR-26a-1-3p), circRNA (chr1:141450089-141450272 and chr5:123628257-123630682); sequences relatively specifically expressed in spleen: lncRNA (BBOX1-AS1, CADM3-AS1 and LINC01645), miRNA (let-7c-5p, miR-18a-5p, miR-19b-3p and miR-155-5p ), circRNA (chrX:133491273-133508778 and chr5:90893166-90893973); sequences relatively specifically expressed in the lung include: lncRNA (ATP13A4-AS1, SFTA1P, LINC00968 and LINC01863), miRNA (let-7e-5p, miR-20a-5p, miR-20b-5p and miR-141-3p), circRNA (chr2:73747920-73749113); sequences relatively specifically expressed in the kidney include: lncRNA (LINC01187, MFSD4A-AS1, COMETT and PRKAR1B-AS2), miRNA (miR-192-5p, miR-194-2-3p and miR-200a-3p); the sequences relatively specifically expressed in the brain include: lncRNA (SOX2-OT, LINC02774 and LINC01361), miRNA (miR-124-5p, miR-218-2-3p and miR-218-5p), circRNA (chr5:122553865-122555045).

[0222] SPSS was used to screen out the ncRNAs with differences in each tissue site and its control group after normal distribution test, independent sample T test and non-parametric test analysis of the relatively specific ncRNAs expressed in each tissue site detected by RT-PCR. Then, the screened ncRNAs were subjected to univariate regression analysis based on actual tissue samples. Finally, it was verified that the area under the ROC curve AUC greater than 0.8 could predict the ncRNAs of specific tissues, including:

[0223] Heart: miRNA: miR-133b-3p (AUC = 0.872; sensitivity = 80%; specificity = 100%; diagnostic efficacy > 0.782);

[0224] Liver: miRNA: miR-99a-3p (AUC = 0.832; sensitivity = 82%; specificity = 80%; diagnostic efficacy > 0.836);

[0225] Spleen: cirRNA: chrX: 133491273-133508778 (AUC = 0.864; sensitivity = 80%; specificity = 100%, diagnostic efficacy > 0.800), miRNA: miR-155-5p (AUC = 0.94; sensitivity = 96%; specificity = 80%; diagnostic efficacy > 0.608);

[0226] Lung: cirRNA: chr19: 9159758-9162413 (AUC = 0.864; sensitivity = 100%; specificity = 80%, diagnostic efficacy > 0.201);

[0227] Kidney: lncRNA: PRKAR1B-AS2 (AUC = 0.820; sensitivity = 70%; specificity = 100%; diagnostic efficacy > 0.884), LINC01187 (AUC = 0.800; sensitivity = 72.5%; specificity = 100%; diagnostic efficacy > 0.769);

[0228] Brain: cirRNA: chr19: 36323990-3643396 (AUC = 0.945; sensitivity = 90%; specificity = 100%; diagnostic efficacy > 0.734.

[0229] The study shows that by detecting three types of non-coding RNA and combining them, tissues of unknown origin can be judged more accurately, providing a strong basis for determining tissue origin in forensic medicine, and is expected to provide a new and powerful tool for criminal investigation and forensic identification.

[0230] Matters not covered by the present invention are known technologies.

[0231] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. Determine the specific non-coding RNA of tissue origin, characterized in that: The specific non-coding RNA includes long non-coding RNA, circular RNA and micro RNA; Among them, the long non-coding RNAs include LINC00702, BANCR, TRDN-AS1, LINC01093, LINC01767, FAM99A, LINC01485, BBOX1-AS1, CADM3-AS1, LINC01645, ATP13A4-AS1, SFTA1P, LINC00968, LINC01863, LINC01187, COMETT, PRKAR1B-AS2, SOX2-OT, LINC02774 and LINC01361; The circular RNA includes chr1:141450089-141450272, chr5:123628257-123630682, chrX:133491273-133508778, chr5:90893166-90893973, chr2:73747920-73749113 and chr5:122553865-122555045; The microRNAs include miR-1a-3p, miR-133b-3p, miR-208a-3p, miR-499-5p, miR-99a-3p, miR-99a-5p, miR-199a-5p and miR-26a-1-3p, let-7c-5p, miR-18a-5p, miR-19b-3p, miR-155-5p, let-7e-5p, miR-20a-5p, miR-20b-5p, miR-141-3p, miR-192-5p, miR-194-2-3p, miR-200a-3p, miR-124-3p, miR-124-5p, miR-218-2-3p and miR-218-5p.

2. The specific non-coding RNA for determining tissue origin according to claim 1, characterized in that The specific non-coding RNA is a group consisting of miR-133b-3p, miR-99a-3p, chrX:133491273-133508778, miR-155-5p, chr19:9159758-9162413, PRKAR1B-AS2, LINC01187 and chr19:36323990-3643396.

3. Use of a reagent for detecting the specific non-coding RNA according to claim 1 or 2 in the preparation of a product for determining tissue origin.

4. The use according to claim 3, characterized in that The detection reagents include reagents for detecting the specific non-coding RNA based on RT-PCR, real-time (fluorescence) quantitative PCR, in situ hybridization, gene chip and gene sequencing.

5. The use according to claim 3, characterized in that The product includes primers, probes, gene chips, nucleic acid membrane strips, detection kits, detection devices or detection equipment for detecting the expression level of the specific non-coding RNA in the sample to be tested.

6. The use according to claim 5, characterized in that The tissue sources of the sample to be tested include heart, liver, spleen, lung, kidney and brain tissues.

7. A system for determining tissue origin, characterized in that: The system comprises: An acquisition unit, which is configured to: acquire the specific non-coding RNA according to claim 1 or 2 of the sample to be tested; The evaluation unit is configured to determine the tissue origin of the sample to be tested according to the expression of the specific non-coding RNA obtained by the acquisition unit.

8. The system according to claim 7, characterized in that: The tissue sources of the sample to be tested include tissues of the heart, liver, spleen, lung, kidney and brain; the sample to be tested is a body fluid (scar) sample or a tissue sample, and the tissue sample is a corrupted residual tissue.

9. The system according to claim 7, characterized in that: miR-133b-3p is a specific non-coding RNA for heart tissue; miR-99a-3p is a specific non-coding RNA for liver tissue, chrX:133491273-133508778 and miR-155-5p are specific non-coding RNAs for spleen tissue, chr19:9159758-9162413 are specific non-coding RNAs for lung tissue; PRKAR1B-AS2 and LINC01187 are specific non-coding RNAs for kidney tissue; chr19:36323990-3643396 is a non-specific non-coding RNA for brain tissue.

10. The system according to claim 7, characterized in that: The determination is an auxiliary determination.

Images