Method for quantitatively detecting nucleic acid of ruminococcus albus in intestinal tracts and application of method

Abstract

The invention provides an intestinal ruminococcus albus nucleic acid quantitative detection method and application. Relates to the technical field of nucleic acid detection. The primer group comprises a primer pair and a probe, wherein the primer pair and the probe have specificity with a ruminococcus albus cel48A gene; the primer pair comprises a forward primer and a reverse primer; the nucleotide sequence of the forward primer is as shown in SEQ ID NO. 1; the nucleotide sequence of the reverse primer is as shown in SEQ ID NO. 2; and the nucleotide sequence of the probe is as shown in SEQ ID NO.3. The primer group provided by the invention has high specificity and sensitivity aiming at the ruminococcus albus cel48A gene, and can accurately detect and quantify target microorganisms. The operation process is simplified, the non-specific reaction risk is reduced, the method is suitable for various sample types, and the application range is widened. In addition, cost is reduced, data reliability is improved, a new tool is provided for disease monitoring, and technical innovation is promoted.

Description

Technical Field

[0001] The present invention relates to the technical field of nucleic acid detection, and in particular to a method and application for quantitative detection of intestinal white Ruminococcus nucleic acid. Background Art

[0002] As an important branch of modern molecular biology, nucleic acid detection technology plays an increasingly important role in medicine, biological research and clinical diagnosis. By detecting and analyzing nucleic acid sequences in biological samples, this technology provides a powerful tool for understanding the genetic information of organisms, disease mechanisms, pathogen identification, etc. Especially in the field of microbiology, nucleic acid detection technology can reveal the structure and function of microbial communities, which is crucial for studying the interaction between hosts and microorganisms.

[0003] Among many microorganisms, Ruminococcus albus, as a Gram-positive bacterium, plays a key role in the host digestion process, especially in the degradation of cellulose and hemicellulose and energy conversion. Its abundance in the intestinal microbial community is closely related to host health, involving immune function, inflammatory response and the occurrence of certain metabolic diseases. Therefore, accurate quantification of the nucleic acid of Ruminococcus albus is crucial to understanding its role in host health. Currently, there are two main technologies for the quantitative detection of nucleic acids: digital PCR technology and qPCR-Taqman probe method.

[0004] Digital PCR technology has attracted attention for its ability to achieve absolute quantification of nucleic acid molecules. This technology divides the sample into a large number of tiny reaction units by physical or chemical segmentation, and each unit is independently PCR amplified, thereby achieving absolute quantification of nucleic acids. This method does not require the establishment of a standard curve and can directly determine the copy number of the target gene in the sample, including target molecules as low as a single copy. However, digital PCR technology also has some limitations. The operation process is complicated, the data processing is cumbersome, it is not suitable for the detection of high-concentration nucleic acids, and the dynamic range is relatively narrow. In addition, this technology usually requires dedicated instruments and reagents, resulting in high costs.

[0005] The qPCR-Taqman probe method is a technology based on the principle of fluorescence resonance energy transfer (FRET), which can quantitatively detect the target DNA sequence by releasing fluorescent signals through enzyme cleavage of specific probes. This technology has the advantages of high specificity, high sensitivity, and closed-tube detection, which can effectively prevent contamination. However, the qPCR technology platform also has some shortcomings, such as the high technical level of the operator, precise experimental design and strict experimental condition control to avoid false positive and false negative results.

[0006] Summarizing the shortcomings of existing technologies, although digital PCR technology has advantages in sensitivity and absolute quantification, its high cost, operational complexity, and throughput limitation limit its applicability in certain application scenarios. The qPCR-Taqman probe method is favored in many applications due to its high specificity and sensitivity, but it also faces the problems of complex operation and sensitivity to experimental conditions. In addition, these two technologies may have difficulty in achieving high specificity and high sensitivity detection of target microorganisms when dealing with complex samples such as fecal samples, especially when it is necessary to distinguish closely related species or strains. Therefore, the development of new nucleic acid quantitative detection technologies to improve the specificity, sensitivity, and ease of operation of detection is of great significance for the accurate quantification of microorganisms such as white Ruminococcus.

[0007] In view of this, the present invention is proposed. Summary of the invention

[0008] The purpose of the present invention is to provide a method and application for quantitative detection of intestinal white Ruminococcus nucleic acid. The primer set provides an effective tool for the research and detection of white Ruminococcus through its high specificity, sensitivity and applicability, and has broad scientific and clinical application prospects.

[0009] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0010] In a first aspect, the present invention provides a primer set, comprising a primer pair and a probe specific to the cel48A gene of Ruminococcus albus; the primer pair comprises a forward primer and a reverse primer;

[0011] The nucleotide sequence of the forward primer is shown in SEQ ID NO.1;

[0012] The nucleotide sequence of the reverse primer is shown in SEQ ID NO.2;

[0013] The nucleotide sequence of the probe is shown in SEQ ID NO.3.

[0014] In an optional embodiment, the 5' end of the probe is provided with a fluorescent reporter group, and the 3' end is provided with a fluorescent quencher group;

[0015] In an optional embodiment, the fluorescent reporter group is at least one of FAM, ROX, VIC, CY5, HEX and CY3;

[0016] In an optional embodiment, the fluorescence quenching group is at least one of BHQ1, BHQ2, BHQ3 and MGB.

[0017] In a second aspect, the present invention provides a kit comprising a primer set as described in any one of the aforementioned embodiments.

[0018] In an optional embodiment, the concentrations of the primer pairs and probes in the kit are:

[0019] The forward primer, reverse primer and probe were all 5 μM.

[0020] In an optional embodiment, the kit further comprises:

[0021] qPCR reaction amplification reagents, positive controls and negative controls;

[0022] In an optional embodiment, the positive control standard is a recombinant plasmid comprising the cel48A nucleotide fragment of Ruminococcus albus;

[0023] In an optional embodiment, the negative control is nuclease-free water;

[0024] Preferably, the qPCR reaction amplification reagent contains a chemically modified hot start DNA polymerase and Mg 2+ .

[0025] In a third aspect, the present invention provides a method for quantitatively detecting nucleic acid of intestinal white Ruminococcus, comprising:

[0026] The quantitative standards of different concentrations were prepared by the serial dilution method, and the standard curve was obtained by fluorescence quantitative PCR amplification.

[0027] Extracting the target sample to obtain the nucleic acid to be tested;

[0028] Using the nucleic acid to be tested, preparing an amplification reagent containing the primer set as described in any one of the above embodiments;

[0029] performing an amplification reaction on the amplification reagent to obtain an amplification reaction result;

[0030] Based on the amplification reaction result and according to the standard curve, the nucleic acid quantification result corresponding to the target sample is calculated.

[0031] In an optional embodiment, the method of preparing quantitative standards of different concentrations by using a doubling dilution method and obtaining a standard curve by fluorescent quantitative PCR amplification includes:

[0032] Take the reference product and dilute it in multiples according to the labeled concentration to obtain the quantitative standard product of different concentrations;

[0033] Adding the primer pair and probe in the primer set and the quantitative standard product of different concentrations into the amplification reagent to form a reaction system;

[0034] Performing PCR amplification on the reaction system to obtain Ct values ​​corresponding to different concentrations of the quantitative standard product in the reaction system;

[0035] The standard curve is constructed with Ct value as Y and concentration as X.

[0036] In an optional embodiment, after constructing the standard curve with Ct value as Y and concentration as X, it also includes:

[0037] Determining whether the standard curve meets the preset standard;

[0038] If yes, the standard curve is determined to be qualified, so as to use the standard curve to perform detection on the target sample;

[0039] If not, the standard curve is judged to be unqualified, and the reference material is taken again, and diluted in multiples according to the marked concentration to obtain the quantitative standard materials of different concentrations.

[0040] In an optional implementation manner, the preset standard is to simultaneously meet all of the following conditions:

[0041] A.R 2 >0.98;

[0042] B. The amplification efficiency is between 90% and 110%.

[0043] In a fourth aspect, the present invention provides an application of a primer set as described in any of the aforementioned embodiments in the quantitative detection of intestinal white Ruminococcus nucleic acid.

[0044] The primer set provided in the examples of the present application is specially designed for the cel48A gene of white Ruminococcus, has a high degree of specificity, and can accurately detect and quantify the target microorganism, thereby improving the accuracy of molecular diagnosis. This highly specific and sensitive primer set not only simplifies the operation process and reduces the risk of nonspecific reactions, but is also applicable to a variety of sample types, broadening its application in scientific research, clinical diagnosis, agricultural production, environmental protection and other fields. In addition, it also helps to reduce detection costs, improve data reliability, and provide new tools for disease monitoring and management, thereby promoting technological innovation and development in related fields at multiple levels. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0046] Figure 1This is a schematic diagram of the process of the quantitative detection method of intestinal white Ruminococcus nucleic acid in the embodiment of the present application;

[0047] Figure 2 The test results of the specific test in Example 4 of the present application;

[0048] Figure 3 The test result of the sensitivity 5 copise / μL test in Example 5 of the present application;

[0049] Figure 4 The test result of the sensitivity 1 copise / μL test in Experimental Example 5 of this application;

[0050] Figure 5 The standard curve preparation result in Example 6 of the present application;

[0051] Figure 6 This is the amplification curve diagram in Example 7 of the present application. DETAILED DESCRIPTION

[0052] The embodiments of the present invention will be described in detail below in conjunction with the examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially.

[0053] A primer set is provided in an embodiment of the present application, comprising a primer pair and a probe that are specific to the cel48A gene of Ruminococcus albus; the primer pair comprises a forward primer and a reverse primer; the nucleotide sequence of the forward primer is shown in SEQ ID NO.1; the nucleotide sequence of the reverse primer is shown in SEQ ID NO.2; and the nucleotide sequence of the probe is shown in SEQ ID NO.3.

[0054] The primer set provided in this embodiment can be specifically shown in the following table:

[0055] Table 1. Specific composition and sequence of primer sets

[0056]

[0057] Ruminococcus albus is a Gram-positive bacterium belonging to the phylum Firmicutes that plays an important role in the rumen of ruminants. It plays a key role in the host digestion process, especially in the degradation of cellulose and hemicellulose and energy conversion. Ruminococcus albus affects the host's intestinal health and nutrient absorption through its metabolic activities.

[0058] The cel48A gene is a specific gene in white Ruminococcus, and the enzyme it encodes is involved in the degradation of plant fibers (such as cellulose). This gene and the enzyme it encodes play an important role in the metabolic pathway of white Ruminococcus and is a molecular marker of its function and ecological role.

[0059] The primer set provided in the embodiment of the present application includes primer pairs and probes. Among them, primers and probes specific to the cel48A gene of white Ruminococcus are crucial because they can accurately identify and bind to the target gene sequence, thereby ensuring the accuracy and reliability of the detection. This high specificity helps to reduce cross-reactions with non-target microorganisms or other gene sequences, avoid false positive results, and enable researchers to further explore the role of white Ruminococcus in the host intestinal microbial community and its impact on host health and disease status.

[0060] This highly specific and sensitive primer set not only simplifies the operation process and reduces the risk of nonspecific reactions, but is also applicable to a variety of sample types, broadening its application in scientific research, clinical diagnosis, agricultural production, environmental protection, etc. In addition, it helps to reduce detection costs, improve data reliability, and provide new tools for disease monitoring and management, thereby promoting technological innovation and development in related fields at multiple levels.

[0061] In the examples of the present application, the public database NCBI was used to obtain highly specific regions of white Ruminococcus, and the forward and reverse primers and probes were designed using primer5 software. The primer specificity was checked by blast, and the above-mentioned specific primer probes were screened out by screening.

[0062] In some embodiments, the 5' end of the probe is provided with a fluorescent reporter group, and the 3' end is provided with a fluorescent quencher group.

[0063] In some embodiments, the fluorescent reporter group is at least one of FAM, ROX, VIC, CY5, HEX and CY3.

[0064] In some embodiments, the fluorescence quenching group is at least one of BHQ1, BHQ2, BHQ3 and MGB.

[0065] A kit is provided in an embodiment of the present application, comprising a primer set as described in any one of the aforementioned embodiments.

[0066] In some embodiments, the concentrations of the primer pairs and probes in the kit are:

[0067] The forward primer, reverse primer and probe were all 5 μM.

[0068] In some embodiments, the kit further comprises: qPCR reaction amplification reagents, positive controls, and negative controls.

[0069] In some embodiments, the positive control standard is a recombinant plasmid comprising the Ruminococcus albus cel48A nucleotide fragment.

[0070] In some embodiments, the negative control is nuclease-free water.

[0071] In some embodiments, the qPCR reaction amplification reagent contains a chemically modified hot start DNA polymerase and Mg 2+ .

[0072] As mentioned above, the kit in this embodiment may also include qPCR reaction amplification reagents, positive controls and negative controls. The positive control standard is a recombinant plasmid containing the cel48A nucleotide fragment of white Ruminococcus; the negative control is nuclease-free water; the qPCR reaction amplification reagent contains a chemically modified hot start DNA polymerase, Mg 2+ wait.

[0073] refer to Figure 1 In the present application, a method for quantitatively detecting nucleic acid of intestinal white Ruminococcus is provided, comprising:

[0074] Step S1, preparing quantitative standards of different concentrations by serial dilution method, and obtaining a standard curve by fluorescence quantitative PCR amplification.

[0075] As described above, the reference sample is diluted into a series of quantitative standard samples of different concentrations by the doubling dilution method, and then these standard samples are amplified using fluorescent quantitative PCR (qPCR) to establish a standard curve, so that a series of Ct values ​​of standard samples of different concentrations can be obtained for constructing the standard curve.

[0076] The standard curve provides a means of converting Ct values ​​to nucleic acid concentrations, allowing accurate quantification of the amount of nucleic acid in unknown samples.

[0077] Specifically, a qPCR instrument and a specific primer probe set can be used to perform an amplification reaction.

[0078] This step achieves accurate quantification of standards of different concentrations and provides a benchmark for subsequent sample quantification.

[0079] Step S2, extracting the target sample to obtain the nucleic acid to be tested.

[0080] As described above, nucleic acid is extracted from a target sample (such as a stool sample) to obtain a pure nucleic acid sample, which is ready for qPCR amplification. A pure nucleic acid sample can improve the accuracy and repeatability of qPCR.

[0081] Specifically, a suitable extraction kit can be selected according to the sample type to extract the sample nucleic acid; for example, nucleic acid extraction technologies such as magnetic bead soil & feces genomic DNA extraction kit can be used.

[0082] Step S3, using the nucleic acid to be detected to prepare an amplification reagent containing the primer set as described in any of the above embodiments.

[0083] In the above, the extracted nucleic acid is mixed with the primer set and the probe to prepare a qPCR amplification reagent to obtain a reaction system containing the nucleic acid to be detected, the primer and the probe. The specific combination of the primer set and the probe in this step improves the specificity and sensitivity of the detection.

[0084] This step accurately measures the primers, probes and nucleic acid templates according to the requirements of the qPCR reaction system, providing the necessary reaction components for the qPCR amplification reaction.

[0085] Step S4, performing an amplification reaction on the amplification reagent to obtain an amplification reaction result.

[0086] As described above, an amplification reaction is performed in a qPCR instrument to obtain an amplification reaction result, that is, a Ct value corresponding to each sample. The Ct value can be used to quantitatively analyze the amount of nucleic acid in the sample.

[0087] Step S5, based on the amplification reaction result and according to the standard curve, calculate the nucleic acid quantification result corresponding to the target sample.

[0088] In the above, the Ct value of the sample is compared with the standard curve to calculate the concentration of the nucleic acid in the sample. The accurate quantitative result of the white Ruminococcus nucleic acid in the target sample is obtained. An accurate and rapid nucleic acid quantification method is provided, thereby achieving absolute quantification of the nucleic acid in the target sample.

[0089] In some embodiments, the step S1, preparing quantitative standards of different concentrations by a doubling dilution method, and obtaining a standard curve by fluorescence quantitative PCR amplification, comprises:

[0090] Step S11, taking a reference substance, and diluting it in multiples according to the labeled concentration to obtain the quantitative standard substance of different concentrations.

[0091] As mentioned above, starting from a reference product of known concentration, a series of quantitative standards of different concentrations are prepared by the doubling dilution method. A series of quantitative standards of precise concentrations are obtained for subsequent establishment of a standard curve. By precisely controlling the dilution ratio, a series of standards covering a wide concentration range can be prepared, which is crucial for establishing an accurate standard curve.

[0092] As mentioned above, the reference substance is diluted in multiples according to its labeled concentration, for example, the following steps may be included:

[0093] (1) Take 10 μL of quantitative standard and add it to 90 μL of DNA standard diluent. Vortex and mix for 30 seconds and then centrifuge for 15-30 seconds. Repeat the operation three times.

[0094] (2) Dilute the quantitative standard sample into four concentration gradients according to this doubling dilution method.

[0095] Step S12, adding the primer pair and probe in the primer set, and the quantitative standard of different concentrations into the amplification reagent to form a reaction system.

[0096] As described above, primer pairs, probes and quantitative standards of different concentrations are added to the qPCR reaction amplification reagent to form a complete reaction system. The reaction system containing all reaction components is obtained and can be directly used for qPCR amplification.

[0097] This step ensures that the reaction conditions in each reaction tube are consistent, improving the reproducibility of the experiment.

[0098] For example, the specific steps may be as follows: add an appropriate amount of primer probe to the amplification reagent, then add 2 μL of each of the four quantitative standards with concentration gradients, and use ultrapure water to make up to 20 μL. In addition, in each PCR reaction, in addition to the sample to be tested, a negative control should be added.

[0099] Step S13, performing PCR amplification on the reaction system to obtain Ct values ​​corresponding to the quantitative standard products of different concentrations in the reaction system.

[0100] As described above, the reaction system is amplified in the qPCR instrument and the fluorescence signal is monitored in real time. The Ct value of each standard product with different concentrations is obtained, which reflects the number of cycles at which the fluorescence signal exceeds the threshold. The Ct value is inversely proportional to the concentration of the standard product and can be used to construct a standard curve, realizing real-time monitoring of standards of different concentrations and obtaining Ct values.

[0101] Specifically, the reaction system can be placed in a real-time fluorescence quantitative PCR instrument for amplification and fluorescence signal monitoring.

[0102] Step S14, constructing the standard curve with Ct value as Y and concentration as X.

[0103] As described above, the obtained Ct values ​​and the corresponding standard sample concentrations are used to construct a standard curve by graphical or mathematical methods, thereby obtaining a standard curve that can be used to convert the Ct values ​​into nucleic acid concentrations.

[0104] The standard curve provides a means of quantifying the concentration of nucleic acid in an unknown sample. The data points can be fitted using graphical software or a mathematical model.

[0105] In summary, the method for quantitative detection of intestinal white Ruminococcus nucleic acid described in this embodiment achieves accurate quantification of target nucleic acid through a series of synergistic steps and has broad application prospects.

[0106] In some embodiments, after constructing the standard curve with Ct value Y and concentration X, step S14 further includes:

[0107] Step S15, determining whether the standard curve meets the preset standard;

[0108] Step S16: If yes, the standard curve is determined to be qualified, so as to use the standard curve to detect the target sample;

[0109] Step S17, if not, the standard curve is determined to be unqualified, and the reference material is taken again, and multiple dilutions are performed according to the marked concentration to obtain the quantitative standard materials of different concentrations.

[0110] In some embodiments, the preset standard is to simultaneously meet all of the following conditions:

[0111] A.R 2 >0.98; B. Amplification efficiency is between 90% and 110%.

[0112] In this embodiment, the standard curve is evaluated by the above method, and the standard curve R 2 >0.98, and the amplification efficiency is between 90% and 110%, which is qualified; otherwise, the test is invalid and needs to be retested. Its purpose is to ensure the accuracy and reliability of nucleic acid quantitative detection. By evaluating the correlation coefficient of the standard curve (R 2 ) and amplification efficiency, can ensure the quality of curve fitting, thereby ensuring the accuracy of subsequent sample quantitative results. As a quality control method, this method helps to identify and eliminate errors or variations that may occur during the experiment and reduce the risk of false positives and false negatives. In addition, this method reflects the rigor of experimental design and meets the strict requirements for accuracy and reliability of results in scientific research and clinical diagnosis. It also avoids wasting more time and resources in subsequent sample analysis and improves experimental efficiency.

[0113] In an embodiment of the present application, a primer set as described in any one of the aforementioned embodiments is provided for use in quantitative detection of intestinal white Ruminococcus nucleic acid.

[0114] The present invention is further described below by means of specific examples, but it should be understood that these examples are only used for more detailed description and should not be construed as limiting the present invention in any form.

[0115] Example 1: Primer set design and kit construction

[0116] This embodiment provides a primer set for quantitatively detecting white Ruminococcus nucleic acid, including a forward primer, a reverse primer and a probe.

[0117] In this example, the genome sequence of Ruminococcus albus cel48A was downloaded from the genbank database, and primers were designed for the gene.

[0118] The primer probe sequences designed in this embodiment are as follows:

[0119] (1) Forward primer: Rumi-CF:

[0120] 5`TTCGAGTCCATCCGTACTATGT 3`(SEQ ID NO:1);

[0121] (2) Reverse primer: Rumi-CR:

[0122] 5`AAGCTCTGCCTGACCTTCA 3`(SEQ ID NO:2);

[0123] (3) Probe: Rumi-CP:

[0124] 5'CGTCAGAAGCGGAGTACTTGCTTGT 3' (SEQ ID NO: 3).

[0125] The 5' end of the Ruminococcus albus cel48A gene probe is labeled with a fluorescent reporter group FAM, and the 3' end is labeled with a fluorescent quencher group BHQ1.

[0126] In this example, the above primer set was used to construct a kit for quantitative detection of Ruminococcus albus nucleic acid.

[0127] The kit also includes qPCR reaction amplification reagents, quantitative standards, positive controls and negative controls.

[0128] The quantitative standard is 1.0×10 7 copies / μL of the recombinant plasmid containing the nucleotide fragment of the cel48A gene of Ruminococcus albus;

[0129] The positive control standard was a recombinant plasmid containing the nucleotide fragment of the cel48A gene of Ruminococcus albus;

[0130] The negative control is nuclease-free water;

[0131] The qPCR reaction amplification reagent contains a chemically modified hot start DNA polymerase, Mg 2+ , dNTPs, PCR enhancers, etc.

[0132] The concentrations of the upstream primer, the downstream primer and the probe in the kit are 5 μM, 5 μM and 5 μM respectively.

[0133] Example 2: Construction of a standard curve

[0134] In this example, serial dilutions of the plasmid reference were performed and a standard curve was constructed.

[0135] Experimental methods:

[0136] (1) Centrifuge the plasmid powder at 5000 r / min for 120 seconds, add 200 μL DNA diluent to dissolve, vortex mix for 1 min, centrifuge at 3000 r / min for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as Rumi-C_1;

[0137] (2) 2 μL Rumi-C_1 + 198 μL DNA dilution buffer, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as Rumi-C_2;

[0138] (3) 2 μL Rumi-C_2 + 198 μL DNA diluent, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as Rumi-C_3;

[0139] (4) 2 μL Rumi-C_3 + 198 μL DNA diluent, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as Rumi-C_4;

[0140] (5) 10 μL Rumi-C_4 + 90 μL DNA dilution solution, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as Rumi-C_5;

[0141] (6) 10 μL Rumi-C_5 + 90 μL DNA dilution solution, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as Rumi-C_6;

[0142] (7) 10 μL Rumi-C_6 + 90 μL DNA dilution solution, vortex mix for 1 min, centrifuge at 3000 rpm for 30 s, repeat the mixing and centrifugation operation three times, and mark the tube as Rumi-C_7.

[0143] The reference product was quantified using a digital PCR instrument (Zhenzhun Biotech), and the results are as follows:

[0144] Table 2. Specific parameters of quantitative standards

[0145] Serial number template Actual copy number (copies / μL) 1 NTC 0 2 Rumi-C_4 35245.2 3 Rumi-C_5 348.98 4 Rumi-C_6 36.31 5 Rumi-C_7 3.3

[0146] Example 3: Nucleic acid extraction and detection

[0147] Experimental methods:

[0148] 1. Extract nucleic acid from samples according to the operating procedures of the Ezup column-based free DNA extraction kit.

[0149] (1) Fecal lysis: Weigh 200 mg of solid fecal sample, add 600 μL Buffer CZ and 60 μL Buffer SDS, oscillate and mix for 3 min, incubate at 65°C in a water bath for 20 min, and mix occasionally;

[0150] (2) Centrifuge at 12000 rpm for 3 min at room temperature and transfer the supernatant to a clean 2 mL centrifuge tube;

[0151] (3) Add 1 / 4 volume of Buffer SP and 200 μL Buffer HTC, vortex to mix, and place at -20°C for 15 min, mixing occasionally;

[0152] (4) Centrifuge at 12000 rpm for 5 min at room temperature and transfer the supernatant to a clean 2 mL centrifuge tube;

[0153] (5) Add 900 μL Buffer GA and 40 μL PureMag Beads, mix thoroughly, and allow to bind for 3 min at room temperature, mixing occasionally;

[0154] (6) Place the centrifuge tube on the magnetic rack for 1 min. After the PureMag Beads are completely absorbed to the tube wall, discard the supernatant and remove the centrifuge tube from the magnetic rack.

[0155] (7) Add 700 μL of Buffer P3 to the centrifuge tube, vortex to mix, place the centrifuge tube on the magnetic rack for 1 min, wait until the PureMag Beads are completely absorbed to the tube wall, discard the supernatant, and remove the centrifuge tube from the magnetic rack;

[0156] (8) Add 700 μL of 70% ethanol to the centrifuge tube, shake and mix, place the centrifuge tube on the magnetic rack for 1 min, wait until the PureMag Beads are completely absorbed to the tube wall, discard the supernatant, and remove the centrifuge tube from the magnetic rack;

[0157] (9) Repeat step 8 once, dry the tube with the lid open at room temperature for 15-20 min or in a 55°C constant temperature oven for 5-7 min until there is no liquid left in the tube;

[0158] (10) Add 50 μL TE Buffer (pH 8.0) and elute at 65°C for 5 min, mixing occasionally;

[0159] (11) Take out the centrifuge tube and place it on a magnetic rack for 1 min. After the PureMag Beads are completely absorbed onto the tube wall, transfer the supernatant to a new sterile centrifuge tube to obtain genomic DNA.

[0160] 3. Preparation of amplification reagents: The qPCR reaction system of the kit is 2×qPCR SuperMix for qPCR 10μL, 1μL of each 5μM primer probe, and the volume of the template is 2μL. Add 5μL of sterile water to make the PCR system 20μL.

[0161] In each PCR reaction, positive and negative quality control samples should be added in addition to the sample to be tested.

[0162] 2. The PCR reaction conditions of the kit are: 94℃ pre-denaturation for 30s, 94℃ for 5s, 60℃ for 34s. In this step, fluorescence is collected, and the fluorescence value of the FAM channel is collected. A total of 40 cycles are performed. After completion, the results are analyzed using a real-time fluorescence quantitative PCR instrument.

[0163] 3. Result analysis:

[0164] (1) Negative control: There is no exponential amplification curve in the FAM detection channel.

[0165] (2) Positive control: The FAM detection channel has an exponential amplification curve and Ct≤25.

[0166] If the test results of the negative control and the positive control meet the above requirements, the test is valid, otherwise the test is invalid and needs to be retested.

[0167] Example 4: Specificity Investigation

[0168] In this example, the specificity of the reagent for quantitative detection of intestinal white Ruminococcus nucleic acid was verified.

[0169] Experimental methods:

[0170] The kit of the present invention is used to amplify nucleic acids containing genomic nucleic acids of Bacteroides, Bifidobacterium, Lactobacillus and Enterococcus as templates, white Ruminococcus plasmid as a positive control, and nuclease-free water as a negative control.

[0171] Experimental results:

[0172] The results are as follows Figure 2As shown, only the positive control containing white Ruminococcus can be amplified well (blue line), and the Ct value is less than 25. No amplification curve was produced for the others, indicating that this method has a certain degree of conservatism and strong specificity for detecting white Ruminococcus.

[0173] Example 5: Sensitivity Study

[0174] In this implementation, the sensitivity of the reagent for quantitative detection of intestinal white Ruminococcus nucleic acid was verified.

[0175] Experimental methods:

[0176] The above plasmid reference was diluted according to the results of digital PCR, and the plasmid was diluted to a quantitative concentration of 1000 copies / μL, 50 copies / μL, 10 copies / μL, 5 copies / μL and 1 copy / μL for sensitivity testing. Each concentration was repeated 15 times and amplified according to the above detection method steps.

[0177] Experimental results:

[0178] As the template concentration decreases, the fluorescence signal value gradually decreases. When the concentration is 5 copies / reaction, there is an amplification curve and the positive detection rate is 100%. Figure 3 As shown; when the template concentration is 1 copies / reaction, there is still an amplification curve, but the positive detection rate is only 80%, such as Figure 4 As shown in the results, it can be seen that the detection limit of the kit of the present invention for white Ruminococcus nucleic acid is 5 copies / reaction.

[0179] Example 6: Sensitivity Study

[0180] In this implementation, a reagent standard curve for quantitative detection of intestinal white Ruminococcus nucleic acid was established.

[0181] Experimental methods:

[0182] According to the quantitative standard dilution method, the quantitative standard of white Ruminococcus was diluted, and the concentrations of the four quantitative standards were 107 copies / μL, 106 copies / μL, 105 copies / μL, and 104 copies / μL, which were used as templates for the preparation of standard curves. Each concentration was repeated 3 times, and nuclease-free water was used as a negative control to prepare the standard curve.

[0183] Experimental results:

[0184] The results are as follows Figure 5 As shown, a standard curve was established based on the Ct values ​​of white Ruminococcus at different concentrations and a regression equation within the corresponding linear range was obtained:

[0185] y = -3.268x + 38.765;

[0186] R 2 =0.998; the amplification efficiency is 102.279%.

[0187] From the PCR test results, it can be seen that there is a good linear relationship between the template amount and the Ct value, the correlation coefficient is greater than 0.99, and the amplification efficiency is 102.279%, which meets the preset standard.

[0188] Example 7: Quantitative investigation of samples

[0189] In this embodiment, a fecal DNA (target sample) was quantitatively investigated.

[0190] Experimental methods:

[0191] The primer set provided in the examples of the present application was used to quantify a fecal DNA that was confirmed to contain white Ruminococcus. The DNA was first quantified by digital PCR using a digital PCR instrument (Zhenzhun Biotech), and its concentration was found to be 224 copies / μL. The qPCR quantification was then tested according to the above-mentioned detection method.

[0192] Experimental results:

[0193] The results are as follows Figure 6 As shown, the positive control Ct value is less than 25, and the negative control has no Ct value. The Ct value obtained for the sample is 30.01. According to its Ct value and the standard curve, it can be concluded that the copy number is 210 copies / μL. This shows that the invention has the same advantage as ddPCR in the quantification of real samples.

[0194] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer set, characterized in that: It comprises a primer pair and a probe specific to the cel48A gene of white Ruminococcus; the primer pair comprises a forward primer and a reverse primer; The nucleotide sequence of the forward primer is shown in SEQ ID NO.1; The nucleotide sequence of the reverse primer is shown in SEQ ID NO.2; The nucleotide sequence of the probe is shown in SEQ ID NO.

3.

2. The primer set according to claim 1, characterized in that: The 5' end of the probe is provided with a fluorescent reporter group, and the 3' end is provided with a fluorescent quencher group; Preferably, the fluorescent reporter group is at least one of FAM, ROX, VIC, CY5, HEX and CY3; Preferably, the fluorescence quenching group is at least one of BHQ1, BHQ2, BHQ3 and MGB.

3. A kit, characterized in that: Comprising the primer set as described in any one of claims 1-2.

4. The kit according to claim 3, characterized in that The concentrations of the primer pairs and probes in the kit are: The forward primer, reverse primer and probe were all 5 μM.

5. The kit according to claim 3, characterized in that The kit also includes: qPCR reaction amplification reagents, positive controls and negative controls; Preferably, the positive control standard is a recombinant plasmid comprising the cel48A nucleotide fragment of Ruminococcus albus; Preferably, the negative control is nuclease-free water; Preferably, the qPCR reaction amplification reagent contains a chemically modified hot start DNA polymerase and Mg 2+ .

6. A method for quantitative detection of intestinal white Ruminococcus nucleic acid, characterized in that: include: The quantitative standards of different concentrations were prepared by the serial dilution method, and the standard curve was obtained by fluorescence quantitative PCR amplification. Extracting the target sample to obtain the nucleic acid to be tested; Using the nucleic acid to be tested to prepare an amplification reagent containing the primer set according to any one of claims 1 to 2; performing an amplification reaction on the amplification reagent to obtain an amplification reaction result; Based on the amplification reaction result and according to the standard curve, the nucleic acid quantification result corresponding to the target sample is calculated.

7. The method for quantitative detection of intestinal white Ruminococcus nucleic acid according to claim 6, characterized in that: The method of preparing quantitative standards of different concentrations by using a doubling dilution method and obtaining a standard curve by fluorescent quantitative PCR amplification includes: Take the reference product and dilute it in multiples according to the labeled concentration to obtain the quantitative standard product of different concentrations; Adding the primer pair and probe in the primer set and the quantitative standard product of different concentrations into the amplification reagent to form a reaction system; Performing PCR amplification on the reaction system to obtain Ct values ​​corresponding to the quantitative standard products of different concentrations in the reaction system; The standard curve is constructed with Ct value as Y and concentration as X.

8. The method for quantitative detection of intestinal white Ruminococcus nucleic acid according to claim 7, characterized in that: After constructing the standard curve with Ct value as Y and concentration as X, the method further comprises: Determining whether the standard curve meets the preset standard; If yes, the standard curve is determined to be qualified, so as to use the standard curve to perform detection on the target sample; If not, the standard curve is judged to be unqualified, and the reference material is taken again, and diluted in multiples according to the marked concentration to obtain the quantitative standard materials of different concentrations.

9. The method for quantitative detection of intestinal white Ruminococcus nucleic acid according to claim 8, characterized in that: The preset standard is to meet all the following conditions at the same time: A、R 2 >0.98; B. The amplification efficiency is between 90% and 110%.

10. Use of the primer set according to any one of claims 1 to 2 in quantitative detection of intestinal white Ruminococcus nucleic acid.

Images