Degenerate primer design method and related equipment thereof

Abstract

The invention discloses a degenerate primer design method and related equipment thereof, and relates to the field of biological detection. According to the degenerate primer design method provided by the invention, multiple degenerate primers are designed through multi-layer clustering of target amplified fragments, the degenerate primers are split, the degenerate degree is reduced, and the specificity and amplification efficiency of the primers are remarkably improved. The specific sequences of multiple pathogens can be accurately enriched, the targeted detection enrichment synthesis cost can be greatly reduced, and the amplified fragment region can be selected.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to a method for designing a degenerate primer and related equipment thereof. Background Art

[0002] Targeted detection requires enrichment of target species-specific sequences, and sequencing analysis to complete species identification, so as to achieve the purpose of clinical pathogen detection. The realization of this purpose requires that the enrichment primers can cover a variety of target species, and the enrichment sequence must have a certain degree of species discrimination, which can be used for subsequent species identification analysis. In the enrichment process, because the targeted enriched sequences have certain base differences in target species of the same genus but different species, it is necessary to design degenerate primers to enrich these intervals. Generally, those skilled in the art will design degenerate primers in the conservative regions of the target species, interrupt the amplified fragments and then sequence them on the machine. In addition, in the degenerate primer design process, if the number of degenerate bases of the primer is higher, the binding ability of the primer to the template is lower, and Tm will also decrease accordingly, resulting in invalid primer amplification. Therefore, the premise for ensuring accurate amplification of multi-pathogen targeted detection is to design degenerate primers in the more conservative regions of the enrichment sequence, and the number of degenerate bases of the degenerate primers must be at a lower level.

[0003] But the current mainstream degenerate primer design method is to confirm the conservative region of the target enrichment sequence by multiple sequence comparison, and then design primers for these conservative regions, if a certain base of the primer has different base situations in the enrichment sequence, just replace with degenerate base. Exemplary, as shown in patent CN114999572A, after screening out conservative fragments by comparison, degenerate primers are designed to it, and the number of degenerate bases is not more than 3, and the degenerate bases and the length of N that are discontinuous, N are lower than 17bp, although amplification primers can be designed, but the method is difficult to design primers in some regions with poor conservativeness, and the primer amplification region cannot be randomly set, which will cause the amplified fragment to be longer, and when sequencing, the amplified fragment needs to be interrupted and put on the machine, which increases the experimental time and cost, and because it is necessary to design primers according to conservativeness at the same time, so candidate primers are less, and the limitation is larger, when amplifying with other primers, if primer dimers occur, it is difficult to realize the replacement of primers.

[0004] Therefore, how to design degenerate primers to achieve specific sequence amplification of multiple target species is the key to achieving targeted detection of target species.

[0005] In view of this, the present invention is proposed. Summary of the invention

[0006] The purpose of the present invention is to provide a method for designing a degenerate primer and related equipment.

[0007] The present invention is achieved in that:

[0008] In a first aspect, an embodiment of the present invention provides a method for designing degenerate primers, the method comprising the steps of performing initial degenerate primer design on target amplification fragments from multiple different sources, the method further comprising the following steps:

[0009] (1) splitting the initial degenerate primers, and calculating the number of mismatches between each primer after the initial degenerate primers are split and the primer binding region of the target amplified fragment from each of multiple different sources, wherein the primer binding region is a region on the target amplified fragment where the target amplified fragment binds to the primer;

[0010] (2) The primer with the least number of mismatches with the target amplified fragments from multiple different sources is used as the first target primer, and the target amplified fragments from different sources are clustered:

[0011] The fragments whose mismatch number with the first target primer is less than or equal to a preset value are regarded as the capable-to-bind fragments, and the first target primers corresponding to the capable-to-bind fragments are placed into the primer pool; or

[0012] The fragments whose mismatch number with the first target primer is greater than the preset value are regarded as failed binding fragments and put into the failed amplification fragment pool;

[0013] (3) Confirm whether there are still fragments in the pool of fragments that failed to be amplified:

[0014] If there is a fragment in the pool of fragments that failed to be amplified, then a candidate degenerate primer is designed for the fragment in the pool of fragments that failed to be amplified:

[0015] Designing the candidate degenerate primers according to the preset number of degenerate bases and the proportion of each base at each site in the primer binding region of the fragment in the pool of fragments that failed to be amplified;

[0016] (4) classifying the fragments in the pool of fragments that failed to be amplified according to the candidate degenerate primers:

[0017] The fragments in the failed amplification fragment pool are respectively compared with the candidate degenerate primers, the fragments that can bind to the candidate degenerate primers are regarded as binding fragments, the binding fragments are removed from the failed amplification fragment pool, and the candidate degenerate primers that can bind to the binding fragments are placed in the primer pool; the fragments that cannot bind to the candidate degenerate primers are regarded as failed binding fragments and retained in the failed amplification fragment pool;

[0018] (5) Repeat steps (3) and (4). If the number of fragments in the fragment pool that failed to be amplified is 0, output the primer pool to obtain the multiple degenerate primers.

[0019] In a second aspect, an embodiment of the present invention provides a method for designing a degenerate primer, comprising:

[0020] (a) obtaining one or more of the following information of initial degenerate primers for the same target amplified fragments from multiple different sources: sequence and position information, multiple alignment result information of the target amplified fragments, and proportion information of each base at each site of the primer binding region of the target amplified fragment;

[0021] (b) splitting the initial degenerate primers into primers without degenerate bases;

[0022] (c) extracting the primer binding region of the target amplified fragment; wherein the primer binding region is a region on the target amplified fragment where the target amplified fragment binds to the primer;

[0023] (d) calculating the number of mismatches between each non-degenerate base primer and the primer binding region of the target amplified fragment from each of the multiple different sources, taking the non-degenerate base primer with the smallest number of mismatches with all the target amplified fragments as the second target primer, and clustering the target amplified fragments:

[0024] The fragments whose mismatch number with the second target primer is less than or equal to a preset value are regarded as capable of binding fragments, and the second target primer corresponding to the capable of binding fragments is placed in a primer pool; or the fragments whose mismatch number with the second target primer is greater than the preset value are regarded as uncombinable fragments, and are placed in a failed amplification fragment pool;

[0025] (e) confirming whether there are still fragments in the pool of fragments that failed to be amplified: if there are fragments in the pool of fragments that failed to be amplified, designing candidate degenerate primers for the fragments in the pool of fragments that failed to be amplified: designing the candidate degenerate primers according to a preset number of degenerate bases and the proportion of each base at each site in the primer binding region of the fragments in the pool of fragments that failed to be amplified;

[0026] (f) classifying the fragments in the failed amplification fragment pool according to the candidate degenerate primers: comparing the fragments in the failed amplification fragment pool with the candidate degenerate primers respectively, treating the fragments that can bind to the candidate degenerate primers as binding fragments, removing the binding fragments from the failed amplification fragment pool, and placing the candidate degenerate primers that can bind to the binding fragments into the primer pool; treating the fragments that cannot bind to the candidate degenerate primers as failed binding fragments and retaining them in the failed amplification fragment pool;

[0027] (g) Repeating steps (e) and (f), if the number of fragments in the fragment pool that failed to be amplified is 0, outputting the primer pool to obtain the multiple degenerate primers.

[0028] In a third aspect, an embodiment of the present invention provides an electronic device, comprising a processor and a memory, wherein the memory is used to store a program, and when the program is executed by the processor, the processor implements the degenerate primer design method described in the above embodiment.

[0029] In a fourth aspect, an embodiment of the present invention provides a computer storage medium, wherein the computer readable medium stores a computer program, and when the computer program is executed by a processor, the degenerate primer design method described in the above embodiment is implemented.

[0030] The present invention has the following beneficial effects:

[0031] This application designs multiple degenerate primers through multi-layer clustering amplification fragments to split the degenerate primers and reduce the degeneracy, significantly increasing the specificity and amplification efficiency of the primers. It can not only accurately enrich the sequences specific to multiple pathogens, but also greatly reduce the cost of targeted detection enrichment synthesis, and can also randomly select amplified fragment regions. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without creative work.

[0033] Figure 1 The design process of the degenerate primers of the present invention is shown;

[0034] Figure 2 The detection results of the degenerate primers designed in Example 1 are shown; wherein, lane M is a 2000bp DNA Marker, lane 1 is a system blank control, lane 2 is a fragment amplified by 7 primers of NS3v2-13, and lane 3 is a fragment amplified by 2 primers of NS3-13;

[0035] Figure 3 The experimental results of the degenerate primer experiment verification in Example 4 are shown; wherein, lane M is a 2000 bp DNA Marker, lane 1 is a fragment amplified by two primers of NS5A-2, lane 2 is a fragment amplified by eight primers of NS5Av2-2, and lane 3 is a blank control of the system;

[0036] Figure 4The experimental results of the degenerate primer experiment verification of Example 6 are shown; wherein, lane M is a 2000 bp DNA Marker, lane 1 is a system blank control, lane 2 is a fragment amplified by two primers of NS5A-4, and lane 3 is a fragment amplified by eight primers of NS5Av2-4. DETAILED DESCRIPTION

[0037] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0038] Definition

[0039] As used in the claims and description, the words "comprising," "having," "including," "having," or "containing" are inclusive or open-ended and do not exclude additional, unrecited elements or method steps.

[0040] Although the disclosure supports a definition of the term "or" as only alternatives as well as "and / or," the term "or" in the claims means "and / or" unless explicitly stated as only alternatives or the alternatives are mutually exclusive.

[0041] The "Hamming distance" in this article refers to the number of different characters in corresponding positions of two strings of equal length, and d(x,y) is used to represent the Hamming distance between strings x and y. From another perspective, the Hamming distance measures the minimum number of replacements required to transform string x into y by replacing characters.

[0042] "Degenerate base pairing rule" in this article: Usually, degenerate bases are used to represent the base types at the position when designing degenerate primers. The base pairing rule is R = A / G, Y = C / T, M = A / C, K = G / T, S = G / C, W = A / T, H = A / T / C, B = G / T / C, V = G / A / C, D = G / A / T, N = A / C / T / G. The " / " here means "or".

[0043] The "degeneracy" in this article refers to the number of types of degenerate primers, which is equal to the product of the number of degenerate bases in the degenerate primer, that is, how many different primers there are in total.

[0044] At present, there is no method for clustering and screening multiple degenerate primers and reducing the degeneracy of degenerate primers. The present invention provides a method for designing multiple degenerate primers that can reduce the degeneracy of degenerate primers. Multiple degenerate primers are designed by multi-layer clustering amplification fragments to achieve the splitting of degenerate primers and reduce the degeneracy, which significantly increases the specificity and amplification efficiency of the primers.

[0045] The present invention introduces a primer mismatch mechanism, which allows a certain amount of mismatch between the primer and the template to reduce the demand for degenerate bases and also allows the degenerate primer to have a higher fault tolerance rate. The degenerate primers are mainly designed through cyclic clustering / classification. The clustering / classification method is mainly to divide the amplified fragments through the mismatch mechanism. Specifically, whether the primer can amplify the target fragment is judged by the number of mismatches between the primer and the target amplified fragment. Degenerate primers with a low number of degenerate bases are designed for all target fragments that cannot be amplified for multiple times to reduce the number of target fragments that cannot be amplified until the number is reduced to 0, and finally a degenerate primer pool with a low degree of degeneracy is output.

[0046] The method of the present invention can design primers for non-conservative amplification regions of multiple pathogens, and has more primer binding position options than traditional degenerate primer design. The method of the present application is specifically applicable to the detection of multiple environmental microorganisms and different viral subtypes of infectious diseases, that is, it is applicable to microorganisms and diseases with high sequence identity that need to distinguish subtypes during detection.

[0047] The term "multiple pathogens" herein includes multiple microorganisms (viruses, bacteria, actinomycetes, mycoplasmas, chlamydia, fungi).

[0048] Specific technical solutions

[0049] In one aspect, an embodiment of the present invention provides a method for designing degenerate primers, the method comprising the steps of performing initial degenerate primer design on target amplification fragments from multiple different sources, and the method further comprising the following steps:

[0050] (1) splitting the initial degenerate primers, and calculating the number of mismatches between each primer after the initial degenerate primers are split and the primer binding region of the target amplified fragment from each of multiple different sources, wherein the primer binding region is a region on the target amplified fragment where the target amplified fragment binds to the primer;

[0051] (2) The primer with the least number of mismatches with the target amplified fragments from multiple different sources is used as the first target primer, and the target amplified fragments from different sources are clustered: the fragments with the number of mismatches with the first target primer being less than or equal to a preset value are regarded as capable of binding fragments, and the first target primer corresponding to the capable of binding fragments is placed in a primer pool; or the fragments with the number of mismatches with the first target primer being greater than the preset value are regarded as uncombinable fragments and placed in a failed amplification fragment pool;

[0052] (3) confirming whether there are still fragments in the pool of fragments that failed to be amplified: if there are fragments in the pool of fragments that failed to be amplified, designing candidate degenerate primers for the fragments in the pool of fragments that failed to be amplified: designing the candidate degenerate primers according to a preset number of degenerate bases and the proportion of each base at each site in the primer binding region of the fragments in the pool of fragments that failed to be amplified;

[0053] (4) classifying the fragments in the failed amplification fragment pool according to the candidate degenerate primers: comparing the fragments in the failed amplification fragment pool with the candidate degenerate primers respectively, treating the fragments that can bind to the candidate degenerate primers as binding fragments, removing the binding fragments from the failed amplification fragment pool, and placing the candidate degenerate primers that can bind to the binding fragments into the primer pool; treating the fragments that cannot bind to the candidate degenerate primers as failed binding fragments and retaining them in the failed amplification fragment pool;

[0054] (5) Repeat steps (3) and (4). If the number of fragments in the fragment pool that cannot be amplified is 0, output the primer pool to obtain the multiple degenerate primers.

[0055] In some embodiments, the fragments in the pool of fragments that failed to be amplified are a collection of the fragments that failed to bind in the previous step.

[0056] In some embodiments, the method for performing initial degenerate primer design on the same target amplified fragments from multiple different sources is a conventional degenerate primer design method or an existing degenerate primer design method, such as HYGEN, SCPrimer, Primer3.

[0057] In some embodiments, the “plurality” in the plurality of different sources may be: two or more.

[0058] The method of the present invention has no limit on the length of the target amplified fragment. However, according to the read length characteristics of current sequencers, the shorter the amplified fragment, the higher the detection accuracy. Currently, the second-generation sequencers generally limit the detection length to 300bp, and few second-generation sequencers can guarantee detection of more than 500bp (sequencing scar problem). Illumina can measure up to 600bp at most. In some embodiments, the length of the target amplified fragment is 50 to 600bp, and in other embodiments, the length of the target amplified fragment is 50 to 300bp.

[0059] On the other hand, an embodiment of the present invention further provides a method for designing a degenerate primer, comprising:

[0060] (a) obtaining one or more of the following information of initial degenerate primers for the same target amplified fragments from multiple different sources: sequence and position information, multiple alignment result information of the target amplified fragments, and proportion information of each base at each site of the primer binding region of the target amplified fragment;

[0061] (b) splitting the initial degenerate primers into primers without degenerate bases;

[0062] (c) extracting the primer binding region of the target amplified fragment; wherein the primer binding region is the region on the target amplified fragment where the target amplified fragment binds to the primer;

[0063] (d) calculating the number of mismatches between each non-degenerate base primer and the primer binding region of the target amplified fragment from each of the multiple different sources, taking the non-degenerate base primer with the smallest number of mismatches with all target amplified fragments as the second target primer, and clustering the target amplified fragments: taking the fragments with a number of mismatches with the second target primer that is less than or equal to a preset value as capable of binding fragments, and placing the second target primer corresponding to the capable of binding fragments into a primer pool; or taking the fragments with a number of mismatches with the second target primer that is greater than the preset value as uncombinable fragments, and placing them into a failed amplification fragment pool;

[0064] (e) confirming whether there are still fragments in the failed amplification fragment pool: if there are fragments in the failed amplification fragment pool, designing candidate degenerate primers for the fragments in the failed amplification fragment pool: designing the candidate degenerate primers according to a preset number of degenerate bases and the proportion of each base at each site in the primer binding region of the fragments in the failed amplification fragment pool;

[0065] (f) classifying the fragments in the failed amplification fragment pool according to the candidate degenerate primers: comparing the fragments in the failed amplification fragment pool with the candidate degenerate primers respectively, treating the fragments that can bind to the candidate degenerate primers as binding fragments, removing the binding fragments from the failed amplification fragment pool, and placing the candidate degenerate primers that can bind to the binding fragments into the primer pool; treating the fragments that cannot bind to the candidate degenerate primers as failed binding fragments and retaining them in the failed amplification fragment pool;

[0066] (g) Repeating steps (e) and (f), if the number of fragments in the fragment pool that failed to be amplified is 0, outputting the primer pool; to obtain the multiple degenerate primers.

[0067] In some embodiments, the fragments in the pool of fragments that failed to be amplified are a collection of the fragments that failed to bind in the previous step.

[0068] In some embodiments, the criteria for comparing the fragments in the pool of failed amplification fragments with the candidate degenerate primers (judging whether the fragments in the pool of failed amplification fragments are capable of binding or uncapable of binding) include: calculating the number of mismatches between the candidate degenerate primers and the primer binding region of the fragment; if the number of mismatches is less than or equal to the set value, the fragment is regarded as a capable of binding fragment; if the number of mismatches is greater than the preset value, the fragment is regarded as a uncapable of binding fragment.

[0069] In some embodiments, the preset value is 3-5.

[0070] In some embodiments, the preset value is 4.

[0071] In some embodiments, the method for obtaining the number of mismatches between each primer and the primer binding region of the amplified fragment is: calculating the Hamming distance between the primer and the primer binding region of the amplified fragment, and using the Hamming distance as the number of mismatches.

[0072] The calculation of "Hamming distance" in this article is compatible with the existence of degenerate bases, that is, when the base of the primer is a degenerate base, the degenerate base will be split into basic base combinations according to the degenerate base pairing principle, and then compared with the sequence of the primer binding region to determine whether there is a mismatch. For example, when the degenerate base is W, it can be split into A and T, and there is no mismatch between the degenerate base and all amplified fragments with A or T at this site.

[0073] In some embodiments, the splitting criteria for splitting the initial degenerate primers into non-degenerate base primers include: based on the same target amplification fragments from different sources, splitting the initial degenerate primers into non-degenerate base primers that can respectively amplify the same target amplification fragments from different sources.

[0074] In some embodiments, the non-degenerate base primer includes at least one of a non-degenerate base primer with the highest SNP frequency and a non-degenerate base primer with the second highest SNP frequency. The non-degenerate base primer with the highest SNP frequency refers to a primer obtained by replacing the degenerate base at the site where the degenerate base exists in the initial degenerate primer with the base with the highest SNP frequency at the site in the target amplified fragments from different sources; the non-degenerate base primer with the second highest SNP frequency refers to a primer obtained by replacing the degenerate base at the site where the degenerate base exists in the initial degenerate primer with the base with the second highest SNP frequency at the site in the target amplified fragments from different sources.

[0075] In some embodiments, the criteria for designing candidate degenerate primers include: designing degenerate primers in the direction of the 3' to 5' ends of the sequence.

[0076] In some embodiments, the criteria for designing candidate degenerate primers also include: for sites where multiple bases exist, degenerate bases are designed according to the highest and second highest frequency bases in the target amplified fragments from different sources or the fragments in the pool of unamplified fragments, until a preset number of degenerate bases is set.

[0077] In some embodiments, the criteria for designing candidate degenerate primers also include: after setting to a preset number of degenerate bases, if there are still sites of multiple bases in the primer, the base with the highest frequency in the target amplified fragments from different sources or the fragments of the fragment pool that failed to be amplified is selected for primer design.

[0078] In some embodiments, the presence of multiple bases refers to the presence of two or more bases, which can be specifically understood as: the number of bases that account for greater than or equal to 25% is ≥2.

[0079] In some embodiments, the criterion for designing candidate degenerate primers also includes: no degenerate base is designed at the 3' end of the candidate degenerate primer. The present invention ensures the conservation of the 3' end of the degenerate primer, allows the primer to better bind to the template, makes the degenerate primer more specific, and allows the design position of the degenerate primer to have a greater tolerance for errors.

[0080] In some embodiments, the preset number of degenerate bases is 3 to 7, specifically any one of 3, 4, 5, 6, 7 or a range between any two of them, preferably 7.

[0081] In some embodiments, the design method further comprises the following steps:

[0082] (h) Optimizing the primers in the primer pool: based on the order in which the primers in the primer pool are placed, the primers are extracted one by one in the order from both ends to the middle, and placed in the optimized primer pool until the total number of fragments that can be amplified (fragments that can be bound) by the extracted primers covers all target amplified fragments;

[0083] Calculate the number of mismatches between each primer in the optimized primer pool and the primer binding region of the target amplicon from each source:

[0084] If the minimum number of mismatches is greater than the threshold, the primers are extracted one by one in the order of extraction from both ends to the middle until the minimum number of mismatches is less than or equal to the threshold;

[0085] If the minimum number of mismatches is less than or equal to the threshold, the optimized primer pool is output;

[0086] To obtain the multiple degenerate primers.

[0087] The "extracting primers one by one from both ends to the middle" described in this article includes two situations:

[0088] The first method is to start with the first primer and extract the primers one by one according to the extraction direction; for example, the primers are numbered 1 to 7 according to the order of insertion, and the extraction number sequence in this case is: 1, 7, 2, 6, 3, 5, 4;

[0089] The second method is to start with the last primer inserted and extract the primers one by one in the extraction direction; for example, the primers are numbered 1 to 7 in the order of insertion, and the extraction numbering sequence in this case is: 7, 1, 6, 2, 5, 3, 4.

[0090] In some embodiments, the “extracting primers one by one from both ends toward the middle” is not limited to the above two situations.

[0091] In some embodiments, the threshold is 3-5.

[0092] In some embodiments, the threshold is 4.

[0093] In some embodiments, the primers in the degenerate primers include: an upstream primer and / or a downstream primer. It is understood that the upstream primer and the downstream primer are the same as the forward primer and the reverse primer.

[0094] On the other hand, an embodiment of the present invention further provides an electronic device, which includes a processor and a memory, wherein the memory is used to store a program, and when the program is executed by the processor, the processor implements the degenerate primer design method described in any of the aforementioned embodiments.

[0095] An electronic device may include a memory, a processor, a bus, and a communication interface, wherein the memory, the processor, and the communication interface are electrically connected to each other directly or indirectly to achieve data transmission or interaction. For example, these components may be electrically connected to each other via one or more buses or signal lines.

[0096] The memory can be, but is not limited to, random access memory (RAM), read only memory (ROM), programmable read-only memory (PROM), erasable programmable read-only memory (EPROM), electrically erasable read-only memory (EEPROM), etc.

[0097] The processor can be an integrated circuit chip with signal processing capabilities. The processor 120 can be a general-purpose processor, including a central processing unit (CPU), a network processor (NP), etc.; it can also be a digital signal processor (DSP), an application specific integrated circuit (ASIC), a field programmable gate array (FPGA) or other programmable logic devices, discrete gate or transistor logic devices, discrete hardware components.

[0098] The electronic device can be a server, a cloud platform, a mobile phone, a tablet computer, a laptop computer, an ultra-mobile personal computer (UMPC), a handheld computer, a netbook, a personal digital assistant (PDA), a wearable electronic device, a virtual reality device, etc. Therefore, the embodiments of the present application do not limit the type of electronic device.

[0099] In addition, an embodiment of the present invention further provides a computer storage medium, wherein the computer readable medium stores a computer program, and when the computer program is executed by a processor, the degenerate primer design method described in any of the above embodiments is implemented.

[0100] The computer-readable medium may be a general storage medium, such as a mobile disk, a hard disk, and the like.

[0101] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0102] Example 1 Forward and reverse degenerate primer optimization

[0103] 1. Materials:

[0104] The primer samples in this embodiment are derived from the (initial) degenerate primers and templates of the HBV NS3 1925_2136 region, wherein the degenerate primers include: the forward primer is CCNCCDTVKTGGGAYVARATGTGGA (SEQ ID NO: 3), and the reverse primer is GCBAGVGCBGCDAGGACHCCVCC (SEQ ID NO: 4).

[0105] 2. Methods

[0106] The specific operation process is as follows Figure 1 shown.

[0107] (1) Input the multiple alignment results of the target amplified fragment to be amplified (HBV NS3 1925_2136 region, recorded as BV NS3 region), the position information of the degenerate primers (forward primer and reverse primer), the degenerate primer sequences and the result file of the proportion of each base at each site in the HBV NS3 region. Refer to Table 1.

[0108] Table 1 The position information and base ratio of each site in the degenerate primer binding region of HBV NS3 1925_2136

[0109]

[0110]

[0111] Note: The second column from left to right in the table is the base with the highest base frequency at each site.

[0112] (2) Extracting the primer binding region of the target amplified fragment; the primer binding region is the region on the target amplified fragment where the target amplified fragment binds to the primer.

[0113] According to the degenerate base pairing rules, the degenerate primers are split into two non-degenerate base primers with the highest and second highest SNP frequencies. The non-degenerate base primer with the smallest number of mismatches with all target amplified fragments (target HBV NS3 region sequences) is used as the second target primer, and the target amplified fragments are clustered: fragments with a mismatch number with the second target primer less than or equal to a preset value (the preset value is 4) are regarded as capable of binding fragments, and the second target primers corresponding to the capable of binding fragments are placed in the primer pool; fragments with a mismatch number with the second target primer greater than the set value are regarded as uncombining fragments and placed in the unamplified fragment pool.

[0114] If there are fragments in the fragment pool that cannot be amplified, design candidate degenerate primers for the fragments in the fragment pool that cannot be amplified: calculate the base proportion of each site in the interval where each fragment in the fragment pool that cannot be amplified binds to the primer; design degenerate primers in the direction of the 3' to 5' end of the sequence, and for sites where the number of bases with a proportion greater than 25% is greater than or equal to 2, design degenerate bases based on the highest and second highest frequency bases in the fragment that cannot be amplified (degenerate bases are not designed at the 3' end of the candidate degenerate primers) until the number of degenerate bases is set to 4. If there are still sites where the number of bases with a proportion greater than 25% is greater than or equal to 2, select the base with the highest frequency in the fragment that cannot be amplified for primer design.

[0115] The fragments in the failed amplification fragment pool are classified according to the candidate degenerate primers: the fragments in the failed amplification fragment pool are respectively compared with the candidate degenerate primers, the fragments that can bind to the candidate degenerate primers are regarded as capable fragments, the capable fragments are removed from the failed amplification fragment pool, and the candidate degenerate primers that can bind to the capable fragments are placed in the primer pool; the fragments that cannot bind to the candidate degenerate primers are regarded as uncapable fragments and retained in the failed amplification fragment pool. Among them, the criteria for judging whether the fragments in the failed amplification fragment pool are capable fragments or uncapable fragments include: calculating the number of mismatches between the candidate degenerate primers and the binding regions of the fragments in the failed amplification fragment pool, if the number of mismatches is less than or equal to the set value (the mismatch set value is 4), the fragment is regarded as capable fragments, and if the number of mismatches is greater than the set value, the fragment is regarded as uncapable fragments.

[0116] Repeat the steps of designing candidate degenerate primers and classifying the fragments in the fragment pool that failed to be amplified according to the candidate degenerate primers. If the number of fragments in the fragment pool that failed to be amplified is 0, output the primer pool.

[0117] (3) Optimizing the primers in the primer pool: extracting the primers one by one from both ends to the middle (in this embodiment, the first primer to be placed is taken as the starting end) according to the order in which the primers are placed in the primer pool, and placing them in the optimized primer pool until the total number of fragments that can be amplified (fragments that can be bound) by the extracted primers covers all target amplified fragments, and calculating the number of mismatches between each primer in the optimized primer pool and the primer binding region of the target amplified fragment from each source. If the minimum number of mismatches is less than or equal to a threshold, output the optimized primer pool; if the minimum number of mismatches is greater than the threshold (the threshold is 4), continue to extract the primers one by one according to the extraction order until the minimum number of mismatches is less than or equal to the threshold.

[0118] 3. Experimental Results

[0119] The results are shown in Table 2. By splitting, the degeneracy of the forward primer was reduced from 96 to 37, and the number of degenerate primers increased from one to three. The degeneracy of the reverse primer increased from 729 to 361, and the number of degenerate primers increased from one to four.

[0120] Table 2 Split primer result information table

[0121]

[0122]

[0123] Note: F is the forward primer and R is the reverse primer.

[0124] Example 2 Degenerate Primer Experiment Verification

[0125] 1. Materials

[0126] PCR reaction system: filtration sterilized ultrapure water, MultiPlex Polymerase (Guangdong Feipeng Biological Co., Ltd., 5U / μL), Multiplex buffer (Guangdong Feipeng Biological Co., Ltd.), positive plasmid template (1000000 copies / reaction); two sets of primers, 500nM each primer

[0127] Instruments: PCR instrument, pipette, microcentrifuge, oscillating mixer, UV gel imaging analysis system (for agarose gel electrophoresis analysis);

[0128] Reagents: agarose, 1xTAE solution, low-toxic high-sensitive dye (pre-electrophoresis staining / gel staining method is recommended for agarose gel electrophoresis), 2000 bp DNA marker, nuclease-free water ddH2O;

[0129] Consumables: sterile 0.2ml centrifuge tubes, sterile pipette tips of various models, and marker pens.

[0130] 2. Methods

[0131] 1. Prepare three multiplex PCR reaction systems by adding filtered sterilized ultrapure water, MultiPlex Polymerase (Guangdong Feipeng Biological Co., Ltd., 5U / μL), and Multiplex buffer (Guangdong Feipeng Biological Co., Ltd.) into three sterile 0.2mL centrifuge tubes (numbered 1, 2, and 3, respectively);

[0132] 2. Add NS3v2-13 primer mix and filtered sterilized ultrapure water (negative template) to tube No. 1 (system negative control); add NS3v2-13 primer mix and positive plasmid template (1000000 copies / reaction, positive template) to tube No. 2; add NS3-13 primer mix and positive plasmid template (1000000 copies / reaction, positive template) to tube No. 3.

[0133] 3. After preparation, vortex to mix, centrifuge briefly, and run the amplification program in the same PCR instrument.

[0134] 4. After completion, perform 2% agarose gel electrophoresis analysis containing highly sensitive dye (a 2000bp DNA marker needs to be selected as a size control for the amplified product during electrophoresis)

[0135] 3. Experimental Results

[0136] like Figure 2 As shown, pipeline No. 1 is a negative control of the system, and the absence of a target band indicates that there is no problem with the reagents used; pipeline No. 2 uses the NS3v2-13 primer set (see Example 1), and there is a target amplification band (211bp); pipeline No. 3 uses the NS3-13 degenerate primer pair (see Example 1), and there is no target amplification band; in summary, the present invention can achieve amplification of the target band by splitting the degenerate primer into multiple degenerate base primers to reduce the degree of degeneracy.

[0137] Example 3 Forward Primer Optimization

[0138] 1. Materials:

[0139] The primer samples in this example are derived from the (initial) degenerate primers and templates of the HBV NS5A 190_214 region, wherein the degenerate primers include: a forward primer of CAAGYCCTTGYAVCRGHTVHTGGYT (SEQ ID NO: 14), and a reverse primer of TTGATGGGGAAAGTACCGTGCCACATAT (SEQ ID NO: 15).

[0140] 2. Methods

[0141] The specific operation process is as follows Figure 1 shown.

[0142] (1) Input the multiple alignment results of the target amplified fragment to be amplified (HBV NS5A 190_214 region, recorded as BV NS5A region), the position information of the degenerate primers (forward primer and reverse primer), the degenerate primer sequence and the result file of the proportion of each base at each site in the HBV NS5A region.

[0143] Table 3 Position information and base ratio of each site in the degenerate primer binding region of HBV NS5A 190_472

[0144]

[0145]

[0146] (2) The subsequent steps are the same as steps (2) and (3) in Example 1.

[0147] 3. Experimental Results

[0148] The results are shown in Table 4. The degeneracy of the forward primer was reduced from 1296 to 324 by splitting, the number of degenerate primers was increased from one to seven, and the reverse primer was not replaced.

[0149] Table 4 Split primer result information table

[0150]

[0151]

[0152] Example 4 Degenerate Primer Experiment Verification

[0153] 1. Materials

[0154] Materials are the same as those in Example 2

[0155] 2. Methods

[0156] The method is the same as that of Example 2

[0157] 3. Experimental Results

[0158] like Figure 3 As shown, pipeline 1 uses the NS5A-2 degenerate primer pair and has no target amplification band; pipeline 2 uses the NS5Av2-2 primer set and has a target amplification band (282bp); pipeline 3 is a negative control of the system, and the absence of a target band indicates that there is no problem with the reagents used; in summary, the present invention can achieve amplification of the target band by splitting the degenerate primer into multiple degenerate base primers to reduce the degree of degeneracy.

[0159] Example 5 Reverse Primer Optimization

[0160] 1. Materials:

[0161] The primer samples in this example are derived from the (initial) degenerate primers and templates of the HBV NS5A 535_831 region, wherein the degenerate primers include: a forward primer of GTGTGCCTCAGGCAGTTATGTCGA (SEQ ID NO: 25), and a reverse primer of CTGTGATGTGDGVWGGRTCTSKBAACAKBGA (SEQ ID NO: 26).

[0162] 2. Methods

[0163] The specific operation process is as follows Figure 1 shown.

[0164] (1) Input the multiple alignment results of the target amplified fragment to be amplified (HBV NS5A 535_831 region, recorded as BV NS5A region), the position information of degenerate primers (forward primer and reverse primer), the degenerate primer sequence and the result file of the proportion of each base at each site in the HBV NS5A region.

[0165] Table 5 The position information and base ratio of each site in the degenerate primer binding region of HBV NS5A 535_831

[0166]

[0167]

[0168] (2) The subsequent steps are the same as steps (2) and (3) in Example 1.

[0169] 3. Experimental Results

[0170] The results are shown in Table 6. The forward primer was not replaced, and the degeneracy of the reverse primer was reduced from 2592 to 872 by splitting, and the number of degenerate primers increased from one to seven.

[0171] Table 6 Split primer result information table

[0172]

[0173]

[0174] Example 6 Degenerate Primer Experiment Verification

[0175] 1. Materials

[0176] Materials are the same as those in Example 2

[0177] 2. Methods

[0178] The method is the same as that of Example 2

[0179] 3. Experimental Results

[0180] like Figure 4 As shown, pipeline No. 1 is the negative control of the system, and the absence of the target band indicates that there is no problem with the reagents used; pipeline No. 2 uses the NS5A-2 degenerate primer pair, and there is no target amplification band; pipeline No. 3 uses the NS5Av2-2 primer set, and there is a target amplification band (296bp); in summary, the present invention can achieve the amplification of the target band by splitting the degenerate primer into multiple degenerate base primers to reduce the degree of degeneracy.

[0181] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for designing multiple degenerate primers, comprising the steps of designing initial degenerate primers for target amplification fragments from multiple different sources, characterized in that: The design method further comprises the following steps: (1) splitting the initial degenerate primers, and calculating the number of mismatches between each primer after the initial degenerate primers are split and the primer binding region of the target amplified fragment from each of multiple different sources, wherein the primer binding region is a region on the target amplified fragment where the target amplified fragment binds to the primer; (2) The primer with the least number of mismatches with the target amplified fragments from multiple different sources is used as the first target primer, and the target amplified fragments from different sources are clustered: The fragments whose mismatch number with the first target primer is less than or equal to a preset value are regarded as the capable-to-bind fragments, and the first target primers corresponding to the capable-to-bind fragments are placed into the primer pool; or The fragments whose mismatch number with the first target primer is greater than the preset value are regarded as failed binding fragments and put into the failed amplification fragment pool; (3) Confirm whether there are still fragments in the pool of fragments that failed to be amplified: If there is a fragment in the pool of fragments that failed to be amplified, then a candidate degenerate primer is designed for the fragment in the pool of fragments that failed to be amplified: Designing the candidate degenerate primers according to a preset number of degenerate bases and the proportion of each base at each site in the primer binding region of the fragment in the pool of fragments that failed to be amplified; (4) classifying the fragments in the pool of fragments that failed to be amplified according to the candidate degenerate primers: The fragments in the failed amplification fragment pool are respectively compared with the candidate degenerate primers, the fragments that can bind to the candidate degenerate primers are regarded as binding fragments, the binding fragments are removed from the failed amplification fragment pool, and the candidate degenerate primers that can bind to the binding fragments are placed in the primer pool; the fragments that cannot bind to the candidate degenerate primers are regarded as failed binding fragments and retained in the failed amplification fragment pool; (5) repeating steps (3) and (4), and if the number of fragments in the fragment pool that failed to be amplified is 0, outputting the primer pool; To obtain the multiple degenerate primers.

2. A method for designing multiple degenerate primers, characterized in that: It includes the following steps: (a) obtaining one or more of the following information of initial degenerate primers for the same target amplified fragments from multiple different sources: sequence and position information, multiple alignment result information of the target amplified fragments, and proportion information of each base at each site of the primer binding region of the target amplified fragment; (b) splitting the initial degenerate primers into primers without degenerate bases; (c) extracting the primer binding region of the target amplified fragment; wherein the primer binding region is a region on the target amplified fragment where the target amplified fragment binds to the primer; (d) calculating the number of mismatches between each non-degenerate base primer and the primer binding region of the target amplified fragment from each of the multiple different sources, taking the non-degenerate base primer with the smallest number of mismatches with all the target amplified fragments as the second target primer, and clustering the target amplified fragments: The fragments whose mismatch number with the second target primer is less than or equal to a preset value are regarded as the capable-to-bind fragments, and the second target primers corresponding to the capable-to-bind fragments are put into the primer pool; or The fragments whose mismatch number with the second target primer is greater than the preset value are regarded as failed binding fragments and put into the failed amplification fragment pool; (e) confirming whether there are still fragments in the pool of fragments that failed to be amplified: If there are fragments in the failed amplification fragment pool, designing candidate degenerate primers for the fragments in the failed amplification fragment pool: designing the candidate degenerate primers according to a preset number of degenerate bases and the proportion of each base at each site in the primer binding region of the fragments in the failed amplification fragment pool; (f) classifying the fragments in the pool of fragments that failed to be amplified according to the candidate degenerate primers: The fragments in the failed amplification fragment pool are respectively compared with the candidate degenerate primers, the fragments that can bind to the candidate degenerate primers are regarded as binding fragments, the binding fragments are removed from the failed amplification fragment pool, and the candidate degenerate primers that can bind to the binding fragments are placed in the primer pool; the fragments that cannot bind to the candidate degenerate primers are regarded as failed binding fragments and retained in the failed amplification fragment pool; (g) repeating steps (e) and (f), and if the number of fragments in the fragment pool that failed to be amplified is 0, outputting the primer pool; To obtain the multiple degenerate primers.

3. The design method according to claim 2, characterized in that: The splitting criteria for splitting the initial degenerate primers into non-degenerate base primers include: based on the same target amplification fragments from different sources, splitting the initial degenerate primers into non-degenerate base primers that can respectively amplify the same target amplification fragments from different sources; Optionally, the non-degenerate base primers include at least one of a non-degenerate base primer with the highest SNP frequency and a non-degenerate base primer with the second highest SNP frequency.

4. The design method according to any one of claims 1 to 3, characterized in that: The criteria for designing candidate degenerate primers include: designing degenerate primers in the direction of the 3' to 5' ends of the sequence; Optionally, the criterion for designing candidate degenerate primers further includes: for sites with multiple bases, designing degenerate bases according to the bases with the highest and second highest frequencies in the target amplified fragments from different sources or the fragments in the pool of unamplified fragments, until a preset number of degenerate bases is set; Optionally, the criterion for designing candidate degenerate primers further includes: after setting to a preset number of degenerate bases, if there are still sites of multiple bases in the primers, selecting the base with the highest frequency in the target amplified fragments from different sources or the fragments in the fragment pool that failed to be amplified for primer design; Optionally, the standard for designing candidate degenerate primers also includes: no degenerate base is designed at the 3' end of the candidate degenerate primer.

5. The design method according to claim 4, characterized in that: The preset number of degenerate bases is 3-7.

6. The design method according to any one of claims 1 to 3, characterized in that: The criteria for comparing the fragments in the failed amplified fragment pool with the candidate degenerate primers include: Calculating the number of mismatches between the candidate degenerate primer and the primer binding region of the fragment, if the number of mismatches is less than or equal to the preset value, the fragment is regarded as a fragment that can bind, if the number of mismatches is greater than the preset value, the fragment is regarded as a fragment that cannot bind; Optionally, the method for obtaining the number of mismatches between each primer and the primer binding region of the amplified fragment is: calculating the Hamming distance between the primer and the primer binding region of the amplified fragment, and using the Hamming distance as the number of mismatches; Optionally, the preset value is 3-5.

7. The design method according to any one of claims 1 to 5, characterized in that: The design method further comprises the following steps: (h) Optimizing the primers in the primer pool: Based on the order in which the primers are placed in the primer pool, the primers are extracted one by one in the extraction order from both ends to the middle, and are placed in the optimized primer pool until the total number of fragments that can be amplified by the extracted primers covers all target amplified fragments; Calculate the number of mismatches between each primer in the optimized primer pool and the primer binding region of the target amplified fragment from each source: If the minimum number of mismatches is greater than the threshold, the primers are extracted one by one in the order of extraction from both ends to the middle until the minimum number of mismatches is less than or equal to the threshold; If the minimum number of mismatches is less than or equal to the threshold, the optimized primer pool is output; To obtain the multiple degenerate primers.

8. The design method according to claim 7, characterized in that: The threshold is 3-5.

9. An electronic device, characterized in that: The invention comprises a processor and a memory, wherein the memory is used to store a program. When the program is executed by the processor, the processor implements the method for designing multiple degenerate primers according to any one of claims 1 to 8.

10. A computer storage medium, characterized in that: The computer readable medium stores a computer program, and when the computer program is executed by a processor, the method for designing multiple degenerate primers according to any one of claims 1 to 8 is implemented.

Images