Nano-motor drug-loaded particle as well as preparation method and application thereof

Abstract

The invention belongs to the technical field of biological medicine, and discloses a nano-motor drug-loaded particle and a preparation method and application thereof, the nano-motor drug-loaded particle is formed by loading platinum nanoparticles and a methylene blue drug on a DNA tetrahedral structure; the nano-motor drug-loaded particle can enhance the uptake of tumor cells to a photosensitizer methylene blue (MB) and realize deep penetration to tumors at the same time, can reduce the dosage of drugs required by a conventional system for treating cancers, and is higher in safety and lower in adverse reaction, and the nano-motor drug-loaded particle provided by the invention has a good application prospect. The material is reliable in source, simple to prepare and high in biocompatibility, specifically responds to photodynamic therapy, and efficiently inhibits tumor cell growth.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to a nanomotor drug-loaded particle and a preparation method and application thereof. Background Art

[0002] Nanomotors are devices that can convert other types of sources into mechanical motion to generate autonomous propulsion, which shows great promise in sensing, environmental remediation and even biomedical fields. Especially for cancer treatment, due to its autonomous motion behavior and adjustable functions, the latest progress in micro / nanobiology research has made great progress in minimally invasive surgery, active drug delivery, etc. As an upgraded version of the drug delivery platform, various nanomotors, driven by light, heat, magnetic field, ultrasound, chemical reaction or by living organisms, have been well developed for their self-propulsion and accurate delivery of drugs, and have shown great superiority for cancer treatment. Although chemically driven nanoplatforms can bring revolutionary progress to traditional treatment modes, due to their complex structure and imperfect treatment mode, chemically driven nanoplatforms for in vivo tumor treatment are still in their infancy and are still a long way from clinical application.

[0003] DNA nanostructures are highly programmable and controllable, easy to modify, and have good biocompatibility and biodegradability, which have attracted widespread attention in the biomedical field. Among DNA nanostructures, tetrahedral DNA nanostructures are a mature DNA self-assembly structure with the advantages of simple synthesis and high efficiency. As a drug carrier, it can effectively deliver a variety of drugs such as small molecule drugs, proteins, antisense nucleotide sequences, etc., and shines in the field of drug delivery.

[0004] Photodynamic therapy (PDT) not only directly kills tumors through photothermal effects and cytotoxic reactive oxygen species (ROS) generated by photosensitizers (PS), but also may promote the domino effect of immune cells in the tumor microenvironment (TME) through various mechanisms. In particular, PDT based on nanodrug delivery systems (NDDS) has significantly improved its tumor inhibitory effect. PDT has become a promising tumor modality, and therefore, many nanoparticles (NPs), such as polylactic-co-glycolic acid, chitosan, graphene oxide and other nanomaterials, have been widely reported to specifically load and deliver PS to achieve multiple deliveries for the highest antitumor efficiency, which plays a key role in the construction and design of a new generation of NDDS to fight cancer. However, due to the complexity and malignant characteristics of tumors, the establishment of a simple and versatile PDT strategy is still in its infancy. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a high-efficiency nanomotor drug-loaded particle that can accurately load drugs, and the nanomotor drug-loaded particle can be used to prepare tumor photodynamic therapy drugs.

[0006] In order to solve the above technical problems, the present invention provides the following technical solutions:

[0007] In a first aspect, the present invention provides a nanomotor drug-loaded particle, namely a DNA tetrahedral nanomotor. The nanomotor drug-loaded particle is formed by loading platinum nanoparticles and methylene blue drugs on a DNA tetrahedral structure. The DNA tetrahedral structure is assembled by four DNA single strands, each of which includes an assembly chain block for assembling a tetrahedral main structure to form a DNA double strand through base complementary pairing, and at least three DNA single strands include arm chains. After the four DNA single strands are assembled, the arm chains extend out of a tetrahedral structure for connecting a ssDNA-Pt complex. The methylene blue (MB) drug is loaded on the DNA tetrahedral structure by inserting between the DNA double strands. The methylene blue (MB) drug is inserted between the DNA double strands mainly by binding to the phosphate group of the DNA through the electrostatic action of the MB cation, and then accumulates on the surface of the DNA tetrahedral helix. The ssDNA-Pt complex is a complex formed by modifying platinum nanoparticles (PtNPs) with thiol DNA (ssDNA), and the ssDNA-Pt complex is loaded on the DNA tetrahedral structure through complementary pairing of ssDNA and the arm chains on the tetrahedral structure.

[0008] Furthermore, considering the size of the DNA tetrahedral structure, among the four DNA single strands used for drug delivery, one DNA single strand contains 112 deoxyribonucleotide monomers, and the other three contain 127 deoxyribonucleotide monomers, and the monomer size of the platinum nanoparticles (PtNPs) is 5 to 10 nm.

[0009] Furthermore, in order to maximize the use of the carrier function of the nanoparticles, from the perspective of the principle of economy, the ratio of the amount of DNA tetrahedral structure to methylene blue is 1:1800, and the ratio of the amount of DNA tetrahedral structure to ssDNA-Pt complex is 1:6.

[0010] Preferably, the assembly chains used to assemble the tetrahedral structure are respectively denoted as S1, S2, S3, and S4, and the base sequences of the assembly chains are respectively as follows (5'→3'):

[0011] Assembly chain S1 is SEQ ID NO.1:

[0012] ACATTCCTAAGTCTGAAGAAGAGCCGCCATAGTACGTTCCCTAACCCTAAC

[0013] CCTAAAACTCTGCTCGACGGATTTTACGTAGTGTCGTTATCACCAGGCAGTT

[0014] GATTGCGCG

[0015] Assembly chain S2 is SEQ ID NO.2:

[0016] AAAAAAAAAAAAAAA GGTCCAATACGCACCTGAGACGCGTTACGCATGAC

[0017] GTTTTTCAACATCAGTCTGATAAGCTATTGTTAAGCTGATTCGCGCAATCAA

[0018] CTGCCTGGTGATAACGACACTACGT

[0019] Assembly chain S3, SEQ ID NO.3:

[0020] AAAAAAAAAAAAAAA GCTTGCTACACCAACTAGAATGATCGGCTACAGAC

[0021] GTTCGTACTATGGCGGCTCTTCTTCAGACTTAGGAATGTTTTCAGCTTAACA

[0022] ATAGCTTATCAGACTGATGTTGAAA

[0023] Assembly chain S4, SEQ ID NO.4:

[0024] AAAAAAAAAAAAAAA CGTCTGTAGCCGATCATTCTAGTTGGTGTAGCAAG

[0025] CTTCGTCATGCGTAACGCGTCTCAGGTGCGTATTGGACCTTAATCCGTCGAG

[0026] CAGAGTTTTAGGGTTAGGGTTAGGG

[0027] The ssDNA chain is SEQ ID NO.5: TTTTTTTTTTTTTTT

[0028] In a second aspect, the present invention further provides a preferred method for preparing the nanomotor drug-loaded particles PM@TDN described in the first aspect, such as Figure 1As shown, the preparation steps include: dissolving the above four DNA single strands in ultrapure water, and then mixing the four DNA single strands in a buffer solution at a molar ratio of 1:1:1:1; rapidly heating the mixed solution to 95°C-100°C and maintaining it for at least 10 minutes, rapidly annealing it to 2-4°C and maintaining it for 20-30 minutes to obtain a DNA tetrahedron solution; mixing the DNA tetrahedron solution with a methylene blue solution at a molar ratio of 1:1800, shaking at 300 rpm at room temperature overnight to obtain an MB@TDN solution; mixing the MB@TDN solution with a ssDNA-Pt complex at a molar ratio of 1:6, annealing at 45°C-25°C for 12 hours, and obtaining PM@TDN particles.

[0029] Preferably, the preparation step of the ssDNA-Pt complex comprises: 6· 6H2O) and polyvinylpyrrolidone (PVP) were added to ethylene glycol, heated to 180°C, maintained for 20 min, cooled to room temperature and dialyzed, and centrifuged at 6000g and an effective centrifugal radius of 5 cm for 20 min using a 10kDA ultrafiltration tube to concentrate Pt nanoparticles to 9-10 mM; among them, chloroplatinic acid hexahydrate (H2PtCl 6· The raw material mass ratio of chloroplatinic acid hexahydrate and ethylene glycol is 203mg:80ml; Pt nanoparticle concentrate and 100μM ssDNA solution are added to 5×TBE, and shaken at 300rpm at room temperature for at least 12h; then NaCl solution with a volume of 0.1 times, 0.2 times, 0.3 times, and 0.4 times that of the Pt nanoparticle concentrate is added to the solution every 30min, and shaken at 300rpm at room temperature overnight to obtain ssDNA-Pt; wherein the volume ratio of Pt nanoparticle concentrate, ssDNA and 5×TBE is 1:1:5.

[0030] In a third aspect, the present invention further provides an application of nanomotor drug-loaded particles in the preparation of tumor photodynamic therapy drugs, wherein the application method is: dissolving the above nanomotor drug-loaded particles as active ingredients in a buffer solution to prepare a liquid drug preparation, or directly using the nanomotor drug-loaded particle solution prepared in the second aspect as a liquid drug preparation, wherein the liquid preparation can be enriched at the tumor site after intravenous injection and directly used to enhance the photodynamic therapy effect of the tumor;

[0031] Preferably, the concentration of the nanomotor drug-carrying particles in the liquid drug preparation is 1 μM; the buffer is 1×TM Buffer or 1×TAE Mg 2+buffer; further preferably, the composition of the 1×TM Buffer is 10mM Tris-HCl, 50mM MgCl2, pH=8.0; or 1×TAE Mg 2+ The composition of the buffer is 40mM Tris-acetate, 1mM EDTA, 12.5mM MgCl2, pH=8.0.

[0032] Compared with the prior art, the present invention has the following beneficial effects:

[0033] 1. Compared with natural nanocarriers, such as the "Brucea javanica exosomes" disclosed in the patent document "Application of Brucea javanica exosomes in the preparation of anti-breast cancer drugs and drugs for inhibiting tumor angiogenesis" with publication number CN 117582460A, firstly, the nanomotor drug-loaded particles PM@TDN constructed in the present invention are used as nanocarriers of tumor photodynamic therapy drugs. The nanomotor carrier constructed in the present invention is more stable in morphology and has controllable and clear morphological characteristics based on base complementary pairing, and its size is precisely controlled to ensure the effectiveness of the preparation of the nanomotor carrier itself; secondly, due to the structural characteristics of the tetrahedron itself, methylene blue (MB) and platinum nanoparticles (Pt NPs) are loaded on the DNA tetrahedron, and the drug loading amount and ratio on the tetrahedron can be precisely controlled, which can be applied to different medication needs and precisely control the dosage;

[0034] 2. Compared with free methylene blue, the cell uptake efficiency is low and the penetration effect on tumors is limited, resulting in poor subsequent photodynamic therapy effect; the nanomotor drug-loaded particles constructed by the present invention load methylene blue (MB) onto the DNA tetrahedral structure through the electrostatic adsorption effect, which can effectively enhance the phagocytic effect of tumor cells on drugs. The presence of high concentrations of hydrogen peroxide (H2O2) in the tumor microenvironment serves as the fuel of the nanomotor. The nanomotor drug-loaded particles catalyze the decomposition of hydrogen peroxide (H2O2) to produce oxygen, thereby generating a driving force to push the nanomotor drug-loaded particles deep into the tumor, while improving the hypoxic microenvironment of the tumor and providing sufficient oxygen for photodynamic therapy. The nanomotor drug-loaded particle structure is easier to be taken up by tumor cells and can achieve deep penetration into the tumor, significantly improving the photodynamic therapy effect of the tumor.

[0035] 3. The nanomotor drug-loaded particles provided by the present invention innovatively anchor platinum nanoparticles (Pt NPs) on the vertices of the DNA tetrahedral framework nucleic acid to prepare nanomotors. The synthesized nanomotor drug-loaded particles can enhance the uptake of the photosensitizer methylene blue (MB) by tumor cells while achieving deep penetration of the tumor, which can reduce the amount of drugs required for conventional systemic cancer treatment, and have higher safety and lower adverse reactions.

[0036] 4. The nanomotor drug-loaded particles provided by the present invention have a reliable source, are simple to prepare, have high biocompatibility, specifically respond to photodynamic therapy, and can effectively inhibit the growth of tumor cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] Figure 1 The following is a flow chart of the preparation and practical application of the DNA nanomotor drug of the present invention;

[0038] Figure 2 The agarose electrophoresis result diagram in Example 1;

[0039] Figure 3 This is an atomic force microscope observation diagram in Example 1;

[0040] Figure 4 This is a transmission electron microscope observation diagram in Example 1;

[0041] Figure 5 Flow analysis and quantitative statistics of drug cell uptake by DNA tetrahedral nanomotor in Example 2;

[0042] Figure 6 This is a laser confocal image of the cell uptake of the DNA tetrahedral nanomotor drug in Example 2;

[0043] Figure 7 This is a statistical chart of cell survival rate in the cell safety experiment of DNA tetrahedron nanomotor drug in Example 3;

[0044] Figure 8 This is the H&E stained section of the safety of the DNA tetrahedron nanomotor drug in mice in Example 3;

[0045] Fig. 9 Flow cytometric analysis and quantitative statistics of in vitro tumor cell apoptosis of the DNA tetrahedral nanomotor drug in Example 4;

[0046] Fig.10 The reactive oxygen species (ROS) production of tumor cells in vitro by the DNA tetrahedral nanomotor drug in Example 5;

[0047] Fig.11 This is an experiment on the penetration depth of the DNA tetrahedral nanomotor drug into 3D tumor spheres in vitro in Example 6. DETAILED DESCRIPTION

[0048] The present invention will be further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the examples given are not intended to limit the present invention. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention herein are only for the purpose of describing specific embodiments and are not intended to limit the present invention. The term "and / or" used herein includes any and all combinations of one or more related listed items.

[0049] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods, and the materials, reagents, etc. used are all available from commercial sources unless otherwise specified.

[0050] Example 1 Synthesis and characterization of nanomotor drug-loaded particles

[0051] The synthesis of the DNA tetrahedron nanomotor in the present invention is divided into three steps. First, four self-assembled DNA single chains are synthesized into a DNA tetrahedron structure, and then methylene blue (MB) is mixed with the DNA tetrahedron. The methylene blue (MB) is loaded onto the DNA tetrahedron by shaking at room temperature to obtain the MB@TDN structure. Finally, ssDNA-Pt is mixed with MB@TDN and annealed to obtain the DNA tetrahedron nanomotor PM@TDN.

[0052] In Example 1, the DNA tetrahedron is mainly composed of one DNA single strand and three DNA single strands with arm extension chains, the molar ratio of the four single strands is 1:1:1:1, the molar ratio of the DNA tetrahedron to methylene blue (MB) is 1:1800, and the molar ratio to ssDNA-Pt is 1:6 as a representative for verification, such as Figure 1 shown.

[0053] The sequences of the four DNA single strands are as follows (5'→3', the underlined part is the extended arm strand):

[0054] DNA tetrahedral chain one is S1, and its sequence is shown in SEQ ID NO.1:

[0055] ACATTCCTAAGTCTGAAGAAGAGCCGCCATAGTACGTTCCCTAACCCTAAC

[0056] CCTAAAACTCTGCTCGACGGATTTTACGTAGTGTCGTTATCACCAGGCAGTT

[0057] GATTGCGCG

[0058] DNA tetrahedral chain 2 is S2, and its sequence is shown in SEQ ID NO.2:

[0059] AAAAAAAAAAAAAAA GGTCCAATACGCACCTGAGACGCGTTACGCATGA

[0060] CGTTTTTCAACATCAGTCTGATAAGCTATTGTTAAGCTGATTCGCGCAATCA

[0061] ACTGCCTGGTGATAACGACACTACGT

[0062] DNA tetrahedral chain three is S3, and the sequence is shown in SEQ ID NO.3:

[0063] AAAAAAAAAAAAAAA GCTTGCTACACCAACTAGAATGATCGGCTACAGAC

[0064] GTTCGTACTATGGCGGCTCTTCTTCAGACTTAGGAATGTTTTCAGCTTAACA

[0065] ATAGCTTATCAGACTGATGTTGAAA

[0066] DNA tetrahedral chain four is S4, and the sequence is shown in SEQ ID NO.4:

[0067] AAAAAAAAAAAAAAA CGTCTGTAGCCGATCATTCTAGTTGGTGTAGCAAG

[0068] CTTCGTCATGCGTAACGCGTCTCAGGTGCGTATTGGACCTTAATCCGTCGAG

[0069] CAGAGTTTTAGGGTTAGGGTTAGGG

[0070] ssDNA chain, the sequence is shown in SEQ ID NO.5:

[0071] TTTTTTTTTTTTTTT

[0072] Preparation method of nanomedicine with the above nanomotor drug-carrying particles as main components:

[0073] (1) Synthesis and preparation of ssDNA-Pt: Accurately weigh chloroplatinic acid hexahydrate (H2PtCl 6·6H2O) 50.75mg, polyvinyl pyrrolidone (PVP) 222mg, added to 20ml ethylene glycol, heated to 180℃, maintained for 20min, cooled to room temperature and dialyzed, centrifuged at 6000g for 20min using a 10kDA ultrafiltration tube to concentrate Pt nanoparticles; 20ul Pt, 20ul 100μM ssDNA were added to 100ul 5×TBE, and shaken at 300rpm at room temperature overnight. On the second day, 2μl, 4μl, 6μl, and 8μl of NaCl solution were added to the solution every 30min, and shaken at 300rpm at room temperature overnight to obtain ssDNA-Pt complex.

[0074] (2) Synthesis and preparation of PM@TDN: The four DNA single strands were dissolved in ultrapure water; the four DNA single strands were mixed in 1×TM Buffer at a molar ratio of 1:1:1:1, wherein the specific components of 1×TM Buffer include: 10 mM Tris-HCl, 50 mM MgCl2, pH = 8.0; the mixed solution was rapidly heated to 95°C and maintained for at least 10 minutes, and rapidly annealed to 4°C and maintained for 20 minutes to obtain a TDN solution.

[0075] (3) The prepared DNA tetrahedron TDN solution and the methylene blue solution were mixed at a molar ratio of 1:1800, and shaken at 300 rpm overnight at room temperature to obtain an MB@TDN solution;

[0076] (4) The MB@TDN solution was mixed with ssDNA-Pt at a molar ratio of 1:6 and annealed at 45°C overnight to room temperature to obtain PM@TDN.

[0077] 6% PAGE gel chromatography analysis: DNA single strands with a concentration of 500 nM were gradually synthesized into samples S1, S1+S2, S1+S2+S3, and TDN, and then mixed with DNA loading buffer and loaded in sequence; Figure 2 The samples from left to right in the figure are standard DNA Marker (500 bp), S1, S1+S2, S1+S2+S3, TDN, using 6% PAGE gel, running at 90V for 80 min, and stained with ethidium bromide. The bands were detected under ultraviolet (UV) using a gel imager. Figure 2 It can be seen from the above that the migration rate of each additional DNA single-stranded sample in the PAGE gel will slow down during the synthesis. According to the test principle that the migration rate of the sample in PAGE gel electrophoresis decreases with the increase of molecular weight, the synthesis of the DNA tetrahedron sample can be determined.

[0078] Atomic force microscopy characterization: The synthesized DNA tetrahedron and the DNA tetrahedron loaded with methylene blue were diluted to 2 nM. 5-10 μl of the sample was added dropwise onto a clean mica sheet and adsorbed for 3 minutes; the atomic force microscope was used for observation and analysis. The results are shown in Figure 3 As shown in the figure, (a) shows pure tetrahedron (TDN), (b) shows drug-loaded DNA tetrahedron (MB@TDN), and (c) shows the height variation of TDN and MB@TDN. The synthesized MB@TDN is evenly distributed, and the insertion of small molecule drug MB has no obvious effect on the size of DNA tetrahedron structure.

[0079] Transmission electron microscopy characterization: The synthesized PM@TDN samples were separated and purified by 1% agarose gel electrophoresis, running at 100V for 30min, and the band where PM@TDN was located was cut and recovered. The band was then dialyzed at 100V to obtain the purified PM@TDN. 10μl was added to a copper mesh, and after natural drying, it was observed and analyzed using a transmission electron microscope. The results are shown in Figure 4 The circled structure is the PM@TDN structure, and the synthesized PM@TDN is evenly distributed.

[0080] Example 2 Study on Cellular Uptake Efficiency

[0081] In order to evaluate the uptake efficiency of DNA tetrahedral nanomotors by CT26 tumor cells, non-nanomotor structures MB@TDN and nanomotors PM@TDN were prepared according to the method of Example 1. CT26 tumor cells containing 100 μM H2O2 were co-incubated with MB@TDN and PM@TDN loaded with 5 μM methylene blue (MB) for 1 h, 2 h and 4 h, respectively. The phagocytosis at different time points was detected by flow cytometry and the phagocytosis of CT26 tumor cells after 4 h of co-incubation was studied by laser confocal microscopy. The results are shown in Figure 1. Figure 5 and Figure 6 As shown, Figure 5 (a) shows the histogram of CT26 tumor cell phagocytosis at different co-incubation times. Figure 5 The quantitative data shown in (b) show that the nanomotor structure PM@TDN is more phagocytosed by CT26 tumor cells than the non-nanomotor structure MB@TDN. Figure 6 Figure (a) shows the fluorescence staining results, where green is the fluorescence of methylene blue and blue is the cell nucleus. The results show that after the same incubation for 4 hours, the statistical results in Figure (b) show that compared with MB@TDN, CT26 tumor cells have taken up a large amount of PM@TDN.

[0082] Example 3 Safety Study

[0083] In order to evaluate the safety of DNA tetrahedral nanomotors after being taken up by CT26 tumor cells, PM@TDN was prepared according to the method of Example 1. CT26 tumor cells were incubated with PM@TDN loaded with different concentrations of MB overnight, where the different concentrations of MB were 0, 1, 3, 5, 7, 10, 15 and 20 uM; the effect of DNA tetrahedral nanomotors on the survival rate of CT26 tumor cells was detected by MTT method. The results are shown in Figure 7 As shown, the results prove that the nanomotor structure PM@TDN does not have a significant killing effect on tumor cells without 660nm laser irradiation.

[0084] The safety of DNA nanomotors in mice was then evaluated. The mice were injected with the same dose of 100 μl of 1xPBS and 100 μl of 1 μM PM@TDN. After 24 hours, the organs of the mice were removed and sliced ​​for H&E staining. Figure 8 As shown, it can be seen that PM@TDN has good biosafety.

[0085] Example 4 DNA tetrahedral nanomotor induces cell apoptosis

[0086] 2×10 5 CT26 cells / well were seeded in a 12-well plate for 12 h, and then divided into a blank group (50 ul of water only), a 1xPBS group (50 ul of 1xPBS only), an MB@TDN group (50 ul of 100 nM MB@TDN only), and a PM@TDN group (50 ul of 100 nM PM@TDN only), and then incubated for 4 h, followed by 660 nm laser irradiation (100 mW cm -2 ) for 15 minutes and further cultured in a normoxic incubator or anoxic incubator for another 4 hours. Then, live and dead cells were collected and stained with Annexin V-FITC / PI. After incubation in the dark for 20 minutes, apoptosis was analyzed by flow cytometry. The results are shown in Figure 2. Fig. 9 As shown in Figure (a), under normoxic conditions, PM@TDN exhibited a stronger ability to induce cell apoptosis than MB@TDN, and even under hypoxic conditions, PM@TDN also exhibited excellent ability to induce cell apoptosis; Fig. 9 Figure (b) is a quantitative statistical chart of the percentages of different degrees of cell apoptosis in Figure (a).

[0087] Example 5 DNA tetrahedral nanomotor produces reactive oxygen species (ROS)

[0088] In order to study the generation of reactive oxygen species (ROS) after adding PM@TDN to cells in vitro, 2×10 5CT26 cells / well were seeded in 12-well plates for 12 h and then incubated with medium containing 1xPBS (50 ul), MB@TDN (50 ul 100 nM) and PM@TDN (50 ul 100 nM) for 4 h. -2 ) for 15 minutes and further cultured in a normoxic incubator or anoxic incubator for another 4 hours. Subsequently, the original culture medium was replaced with a culture medium containing DCFH-DA (10 μM) at 37°C for another 1 hour, and CLSM imaging was performed with an excitation wavelength of 488 nm. Quantitative analysis of the fluorescence images was performed simultaneously using ImageJ. The results are shown in Fig.10 As shown, (a) is the fluorescence staining result of the reactive oxygen species (ROS) production experiment under normoxic conditions, (b) is the fluorescence staining result of the reactive oxygen species (ROS) production experiment under hypoxic conditions, and (c) is the statistical result of the reactive oxygen species (ROS) production experiment under normoxic and hypoxic conditions. Green is the fluorescence of DCFH-DA, and blue is the cell nucleus. The results show that under normoxic conditions, PM@TDN can produce more reactive oxygen species inside the tumor compared with MB@TDN, and even under hypoxic conditions, the PM@TDN group shows a reactive oxygen production ability that is not weaker than that under normoxic conditions.

[0089] Example 6 DNA tetrahedral nanomotor achieves deep tumor penetration

[0090] In order to study the penetration ability of PM@TDN and MB@TDN after adding them to cells in vitro, CT26 cells were inoculated into 96-well plates containing 1.5wt% agarose gel and incubated for 72h to obtain relatively dense tumor spheres. Then, 3D tumor spheres of similar size were selected and incubated with culture medium containing MB@TDN (5ul 100nM) and PM@TDN (5ul 100nM) for 4 hours to evaluate their ability to penetrate tumors and observe them using CLSM. ImageJ was used to simultaneously perform quantitative analysis of fluorescence images. The results are shown in Figure 2. Fig.11 As shown, it can be clearly observed from the z-stack CLSM images that the PM@TDN motor group exhibited deeper penetration than the non-motor group MB@TDN. These results suggest that PM@TDN can produce better penetration and accumulation in tumors.

[0091] In summary, the present invention provides a DNA tetrahedral nanomotor for tumor photodynamic therapy, which can effectively enhance the drug uptake efficiency of tumor cells and achieve deep penetration of tumor cells, thereby effectively increasing the production of ROS during tumor photodynamic therapy and achieving effective killing of tumor cells.

Claims

1. A nanomotor drug-loaded particle, characterized in that: The nanomotor drug-loaded particles are formed by loading platinum nanoparticles and methylene blue drugs on a DNA tetrahedral structure. The DNA tetrahedral structure is assembled by four DNA single strands, each of which includes assembly chain blocks for assembling a tetrahedral main structure to form a DNA double strand through base complementary pairing, and at least three DNA single strands contain arm chains. After the four DNA single strands are assembled, the arm chains extend out of the tetrahedral structure for connecting ssDNA-Pt complexes, and the methylene blue MB drug is loaded on the DNA tetrahedral structure by inserting between the DNA double strands; the ssDNA-Pt complex is a complex formed by modifying platinum nanoparticles, i.e. PtNPs, with thiol DNA, i.e. ssDNA, and the ssDNA-Pt complex is loaded on the DNA tetrahedral structure through complementary pairing of ssDNA and the arm chains on the tetrahedral structure.

2. The nanomotor drug-loaded particle according to claim 1, characterized in that: Among the four DNA single strands used for drug delivery, one DNA single strand contains 112 deoxyribonucleotide monomers, and the other three DNA single strands contain 127 deoxyribonucleotide monomers, and the size of the platinum nanoparticles (PtNPs) monomers is 5 to 10 nm.

3. The nanomotor drug-loaded particle according to claim 1, characterized in that: The ratio of the amount of the DNA tetrahedral structure to the amount of methylene blue is 1:1800, and the ratio of the amount of the DNA tetrahedral structure to the amount of the ssDNA-Pt complex is 1:

6.

4. The nanomotor drug-loaded particle according to claim 1, characterized in that: The assembly chains used to assemble the tetrahedral structure are respectively denoted as S1, S2, S3, and S4, the base sequences of the assembly chains are respectively shown as SEQ ID NO.1 to SEQ ID NO.4, and the ssDNA chain sequence is shown as SEQ ID NO.

5.

5. A method for preparing nanomotor drug-loaded particles, comprising the following steps: The four DNA single strands described in claim 1 are dissolved in ultrapure water, and then the four DNA single strands are mixed in a buffer solution at a molar ratio of 1:1:1:1; the mixed solution is quickly heated to 95°C to 100°C and maintained for at least 10 minutes, and quickly annealed to 2 to 4°C and maintained for 20 to 30 minutes to prepare a DNA tetrahedron solution; the DNA tetrahedron solution is mixed with a methylene blue solution at a molar ratio of 1:1800, and shaken at 300 rpm overnight at room temperature to obtain an MB@TDN solution; the MB@TDN solution is mixed with a ssDNA-Pt complex at a molar ratio of 1:6, and annealed at 45°C to 25°C for 12 hours to obtain PM@TDN particles.

6. The method for preparing nanomotor drug-loaded particles according to claim 5, characterized in that: The steps of preparing the ssDNA-Pt complex include: 6· 6H2O) and polyvinylpyrrolidone (PVP) were added to ethylene glycol, heated to 180°C, maintained for 20 min, cooled to room temperature and dialyzed, and centrifuged at 6000g and an effective centrifugal radius of 5 cm for 20 min using a 10kDA ultrafiltration tube to concentrate Pt nanoparticles to 9-10 mM; among them, chloroplatinic acid hexahydrate (H2PtCl 6· The raw material mass ratio of chloroplatinic acid hexahydrate and ethylene glycol is 203mg:80ml; Pt nanoparticle concentrate and 100μM ssDNA solution are added to 5×TBE, and shaken at 300rpm at room temperature for at least 12h; then NaCl solution with a volume of 0.1 times, 0.2 times, 0.3 times, and 0.4 times that of the Pt nanoparticle concentrate is added to the solution every 30min, and shaken at 300rpm at room temperature overnight to obtain ssDNA-Pt; wherein the volume ratio of Pt nanoparticle concentrate, ssDNA and 5×TBE is 1:1:

5.

7. Use of the nanomotor drug-loaded particles according to claim 1 in the preparation of drugs for photodynamic therapy of tumors.

8. The use according to claim 7, characterized in that: The application method is: dissolving the nanomotor drug-loaded particles described in any one of claims 1 to 4 as active ingredients in a buffer solution to prepare a liquid drug preparation, or directly using the nanomotor drug-loaded particle solution prepared by the preparation method described in any one of claims 5 to 6 as a liquid drug preparation, and the liquid preparation is intravenously injected for photodynamic therapy.

9. The use according to claim 8, characterized in that: The concentration of the nanomotor drug-loaded particles in the liquid drug preparation is 1 μM, and the buffer is 1×TM Buffer or 1×TAE Mg 2+ buffer.

10. The use according to claim 8, characterized in that: The specific steps of the photodynamic therapy are: irradiation with 660nm laser for 15 minutes.

Images