New application of S100a11 inhibitor and medicine for treating hair aplastic disorder and / or promoting hair regeneration

Abstract

The invention belongs to the technical field of medicines, and particularly relates to novel application of an S100a11 inhibitor and a medicine for treating hair aplastic disorder and / or promoting hair regeneration. According to the invention, it is found for the first time that the S100a11 gene has a close relationship with growth and development regulation of hair follicles; and it is proved that hair regeneration can be promoted by inhibiting the expression of the S100a11 gene. According to the invention, a vector for inhibiting the expression of S100a11 is constructed, and the lentivirus for inhibiting the expression of S100a11 is obtained through cell transfection. In the process of cyclic regeneration of mouse hair, specific inhibition of S100a11 expression can significantly and effectively promote regeneration of back hair and induce hair follicles to be converted from a resting period to a growing period in advance. The invention provides a new potential therapeutic target for related diseases such as alopecia and hair loss or hair follicle and hair aplastic disorder of human or animals, has important significance for research on hair cyclic regeneration, and has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of medical technology, and specifically relates to a new use of a S100a11 inhibitor and its application in treating hair regeneration disorders and / or promoting hair regeneration. Background Art

[0002] With the rapid development of society, hair regeneration disorders have become an increasingly common problem. Hair regeneration disorders are a type of disease that affects hair growth and regeneration, mainly manifested by sparse hair, hair loss, and difficulty in regrowth, including alopecia areata, androgenic alopecia, and scarring alopecia. Hair has the functions of physical protection, temperature regulation, tactile perception, and beauty. If hair regeneration disorders are severe, it will affect appearance and mental health.

[0003] Hair follicles are tiny organs attached to the skin that are responsible for the growth and periodic regeneration of hair. Under normal circumstances, hair follicles undergo continuous cyclical remodeling, including a catagen phase driven by cell apoptosis, a relatively static resting phase, and then a growth phase in which growth activity is restored and the hair shaft is produced. However, hair follicles are affected by complex factors, including endocrine, nutritional or disease factors that cause hair regeneration disorders, pathological abnormalities in hair follicles, and inability to enter the growth phase normally, which ultimately leads to hair follicle atrophy, hair loss and other hair regeneration disorders.

[0004] Existing treatments include medication, surgery, and physical therapy. Although common hair removal drugs such as finasteride and minoxidil can effectively slow down the process of hair removal and promote hair growth to a certain extent, there are still some side effects. For example, finasteride may cause adverse reactions such as sexual dysfunction. In addition, drug treatment must be used for a long time. Although hair transplant surgery can quickly and effectively improve the appearance of hair, it requires patients to have certain hair follicle resources. There are also certain risks in the surgical process, such as infection and bleeding. A certain recovery period is required after surgery, and patients need to comply with strict care requirements. Physical therapy is mainly laser therapy, which can stimulate the activity of hair follicle cells and promote hair growth, but the effect of laser therapy is relatively slow, and long-term use is required to see obvious results. The therapeutic effect is also relatively limited, and the effect may not be ideal for patients with severe hair loss. Therefore, the development of a safe and effective new target for the treatment of hair regeneration disorders and the promotion of hair regeneration has important clinical needs and application prospects.

[0005] S100 protein is a type of calcium-binding protein with a molecular weight of 10-12kD, which is mainly synthesized and secreted by fibroblasts, macrophages, lymphocytes, neutrophils, etc. S100 family proteins are involved in the physiological functions of normal hair follicles and expressed in a tissue-specific manner, playing an important role in hair growth, structural maintenance and regeneration. S100 calcium-binding protein A11 (S100A11) is a member of the S100 protein family and affects processes such as cell proliferation, differentiation and migration. As a multifunctional protein, S100A11 plays an important role in many fields such as skin health and cancer, but there is no research or report on whether S100a11 is involved in the regulation of hair follicle growth and development and its role in hair regeneration. Summary of the invention

[0006] In order to solve the above technical problems, the present invention constructs a vector for inhibiting the expression of S100a11, and obtains a lentivirus for inhibiting the expression of S100a11 through cell transfection. In the process of hair regeneration in mice, specific inhibition of S100a11 expression can significantly and effectively promote the regeneration of back hair, induce hair follicles to switch from the resting phase to the growth phase in advance, and reveal that the S100a11 gene is related to hair regeneration.

[0007] The first aspect of the present invention provides use of a S100a11 inhibitor in the preparation of a drug for treating hair regeneration disorders and / or promoting hair regeneration.

[0008] Furthermore, the S100a11 inhibitor is at least one of the following drugs: a drug for knocking out or silencing the S100a11 gene, and a drug for inhibiting the function of the S100A11 protein.

[0009] Furthermore, the drug for knocking out or silencing the S100a11 gene includes: siRNA, shRNA or a drug for achieving CRISPR gene editing; the drug for inhibiting the function of the S100A11 protein includes: a competitive inhibitor, a non-competitive inhibitor or a regulatory inhibitor.

[0010] Furthermore, the drug for knocking out or silencing the S100a11 gene includes: an S100a11 gene RNA interference fragment, an RNAi vector containing the S100a11 gene RNA interference fragment, or a lentivirus containing an RNAi vector containing the S100a11 gene RNA interference fragment; the S100a11 gene RNA interference fragment is an S100a11 gene RNA interference fragment sh_S100a11 with a nucleotide sequence as shown in SEQ ID NO:4, or other S100a11 gene-specific RNA interference fragment; the RNAi vector containing the S100a11 gene RNA interference fragment is an RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP with a nucleotide sequence as shown in SEQ ID NO:1, or other similar expression vectors that can be used for RNAi.

[0011] Furthermore, the S100a11 gene RNA interference fragment sh_S100a11 has a hairpin structure, and the construction method includes:

[0012] Designing specific shRNA based on mouse S100a11 gene, obtaining an upstream sequence S100a11-F with a nucleotide sequence as shown in SEQ ID NO:6 and a downstream sequence S100a11-R with a nucleotide sequence as shown in SEQ ID NO:7;

[0013] The upstream sequence S100a11-F and the downstream sequence S100a11-R were annealed to form the S100a11 gene RNA interference fragment sh_S100a11 with a nucleotide sequence as shown in SEQ ID NO:4.

[0014] Furthermore, the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP is constructed by:

[0015] The S100a11 gene RNA interference fragment sh_S100a11 with a nucleotide sequence as shown in SEQ ID NO: 4 was connected to the expression vector pCDH-Lgr5-CMV-copGFP to obtain the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP.

[0016] Furthermore, the lentivirus of the RNAi vector containing the RNA interference fragment of the S100a11 gene is obtained by transfecting the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP into tool cells.

[0017] Furthermore, the tool cells are HEK 293T cells or other similar tool cells that are easily transfected.

[0018] Furthermore, the lentivirus regulates the RNAi vector via the Lgr5 promoter to inhibit the expression of the S100a11 gene.

[0019] The second aspect of the present invention provides a drug for treating hair regeneration disorders and / or promoting hair regeneration, which is prepared by using a S100a11 inhibitor as an active ingredient and adding pharmaceutically acceptable excipients or auxiliary ingredients.

[0020] The beneficial effects of the present invention are:

[0021] 1. The present invention promotes the regeneration of hair on the back of mice by inhibiting the expression of S100a11 gene, which provides a new idea for the treatment of hair loss.

[0022] 2. In the process of hair cycle regeneration in mice, the present invention found that the experimental group injected with the lentivirus containing the S100a11 gene RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP entered the hair growth phase earlier than the control group. It is proved that specifically inhibiting the expression of S100a11 can significantly and effectively promote hair regeneration and induce hair follicles to switch from the resting phase to the growth phase in advance. The present invention provides a new potential therapeutic target for related diseases such as hair loss and alopecia or hair follicle hair regeneration disorders in humans or animals, which is of great significance to the research on hair cycle regeneration and has good application prospects.

[0023] 3. The present invention promotes the regeneration of hair on the back of mice by injecting lentivirus, which overcomes the shortcomings of the current traditional surgical and drug treatment methods, such as unstable effects and safety. Through genetic transformation, it provides a new therapeutic target for improving animal hair loss. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 This is a diagram of the construction of the recombinant expression vector pCDH-Lgr5-sh_S100a11-CMV-copGFP.

[0025] Figure 2 The pigmentation and hair regeneration of the back of mice injected with empty vector lentivirus containing pCDH-Lgr5-CMV-copGFP in the control group were compared with those of the experimental group injected with recombinant lentivirus containing RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP. The red box indicates the part where the hair of the injected mice changed.

[0026] Figure 3The back pigmentation and hair regeneration of mice injected with empty vector lentivirus containing pCDH-Lgr5-CMV-copGFP in the control group were compared with the back pigmentation and hair regeneration days of mice injected with recombinant lentivirus containing RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP in the experimental group. t test, n=5, *P<0.05, **P<0.01.

[0027] Figure 4 The results of H&E staining of hair follicles of mice in the control group injected with empty vector lentivirus containing pCDH-Lgr5-CMV-copGFP and mice in the experimental group injected with recombinant lentivirus containing RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP. Scale bar = 1 mm. DETAILED DESCRIPTION

[0028] The present invention is described in detail below with reference to embodiments, but the embodiments of the present invention are not limited thereto. The embodiments described below are only some embodiments of the present invention. For those skilled in the art, other similar embodiments obtained without creative work all fall within the protection scope of the present invention.

[0029] Specific techniques or conditions not specified in the examples of the present application can be carried out according to the techniques described in the literature in the field or according to the product instructions. The reagents or instruments used without indicating the manufacturer are all conventional products that can be obtained commercially.

[0030] The main reagents used in the examples: ether was purchased from Changshu Hongsheng Fine Chemical Co., Ltd.; PBS, hematoxylin staining solution, eosin staining solution, and neutral gum mounting medium were purchased from Shenggong Biotechnology (Shanghai) Co., Ltd.; trypsin substitutes were purchased from Thermo Fisher Scientific (China) Co., Ltd. DH5α competent cells and plasmid extraction kit (DP118) were purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd. LipoFiter TM Liposome transfection reagent was purchased from Hanheng Biotechnology (Shanghai) Co., Ltd. DMEM / HIGH GLUCOSE was purchased from Hyclone (USA).

[0031] The experimental animals used in the examples were healthy 8-week-old C57BL / 6J mice, which were randomly divided into an experimental group and a control group, with 5 mice in each group used to observe back pigmentation and hair regeneration after lentivirus injection; and 2 mice in each group used for hair follicle regeneration tissue observation.

[0032] In the prior art, S100A11 affects cell proliferation, differentiation, migration and other behaviors through interaction with other proteins or molecules, thus playing a key role in maintaining tissue homeostasis and participating in the occurrence and development of diseases. As a multifunctional protein, S100A11 plays an important role in many fields such as skin health and cancer, but there is no research or report on whether S100a11 is involved in the regulation of hair follicle growth and development and its role in hair regeneration.

[0033] According to a first aspect of an embodiment of the present invention, there is provided use of a S100a11 inhibitor in preparing a drug for treating hair regeneration disorders and / or promoting hair regeneration.

[0034] The present invention has demonstrated that hair regeneration can be promoted by inhibiting the expression of the S100a11 gene.

[0035] In some embodiments, the S100a11 inhibitor is at least one of the following drugs: a drug that knocks out or silences the S100a11 gene, and a drug that inhibits the function of the S100A11 protein.

[0036] In some embodiments, the drug for knocking out or silencing the S100a11 gene includes: siRNA, shRNA or a drug for achieving CRISPR gene editing; the drug for inhibiting the function of the S100A11 protein includes: a competitive inhibitor, a non-competitive inhibitor or a regulatory inhibitor.

[0037] In some embodiments, the drug for knocking out or silencing the S100a11 gene includes: an S100a11 gene RNA interference fragment, an RNAi vector comprising the S100a11 gene RNA interference fragment, or a lentivirus comprising an RNAi vector comprising the S100a11 gene RNA interference fragment; the S100a11 gene RNA interference fragment is an S100a11 gene RNA interference fragment sh_S100a11 having a nucleotide sequence as shown in SEQ ID NO:4, or other S100a11 gene-specific RNA interference fragment; the RNAi vector comprising the S100a11 gene RNA interference fragment is an RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP having a nucleotide sequence as shown in SEQ ID NO:1, or other similar expression vectors that can be used for RNAi.

[0038] In some embodiments, the S100a11 gene is inhibited by an S100a11 gene RNA interference fragment; the S100a11 gene RNA interference fragment is constructed by:

[0039] Designing specific shRNA based on mouse S100a11 gene, obtaining an upstream sequence S100a11-F with a nucleotide sequence as shown in SEQ ID NO:6 and a downstream sequence S100a11-R with a nucleotide sequence as shown in SEQ ID NO:7;

[0040] The upstream sequence S100a11-F and the downstream sequence S100a11-R were annealed to form the S100a11 gene RNA interference fragment sh_S100a11 with a hairpin structure.

[0041] The nucleotide sequence of the CDS region (Coding Sequence) of the S100a11 gene is shown in SEQ ID NO:3.

[0042] The nucleotide sequence of the sh_S100a11 is shown in SEQ ID NO:4.

[0043] The present invention can significantly and effectively promote hair regeneration by inhibiting the expression of S100a11 gene, and induce hair follicles to switch from the resting phase to the growth phase ahead of time, which provides a new idea for treating hair loss.

[0044] In some embodiments, the RNAi vector is an RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP whose nucleotide sequence is shown in SEQ ID NO: 1.

[0045] In some embodiments, the construction method of the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP includes:

[0046] The RNA interference fragment sh_S100a11 of the S100a11 gene whose nucleotide sequence is shown in SEQ ID NO:4 is connected to the expression vector pCDH-Lgr5-CMV-copGFP containing the Lgr5 gene promoter to obtain the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP; wherein the nucleotide sequence of the expression vector pCDH-Lgr5-CMV-copGFP is shown in SEQ ID NO:2. The nucleotide sequence containing the Lgr5 gene promoter is shown in SEQ ID NO:5.

[0047] In some embodiments, the lentivirus is obtained by transfecting the RNAi vector into a tool cell. Preferably, the tool cell is a HEK 293T cell or other similar tool cells that are easily transfected.

[0048] Specifically, the recombinant lentivirus containing the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP is prepared by the following steps:

[0049] 1) The RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP was transformed into Escherichia coli competent cells DH5α, and the positive plasmid pCDH-Lgr5-sh_S100a11-CMV-copGFP was extracted;

[0050] 2) The positive plasmid pCDH-Lgr5-sh_S100a11-CMV-copGFP was transfected into HEK 293T cells to obtain a recombinant lentivirus containing the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP.

[0051] In some embodiments, the lentivirus regulates the RNAi vector via the Lgr5 promoter to inhibit the expression of the S100a11 gene.

[0052] Specifically, hair follicle stem cells have the ability to self-renew and reconstruct hair follicles, especially those expressing the Lgr5 gene (Lgr5 + ) hair follicle stem cells are activated first during the hair follicle cycle regeneration process. + An interference sequence specifically targeting S100a11 was expressed in hair follicle stem cells, and an expression vector pCDH-Lgr5-sh_S100a11-CMV-copGFP that specifically inhibits S100a11 was constructed.

[0053] The second aspect of the present invention provides a drug for treating hair regeneration disorders and / or promoting hair regeneration, which is prepared by using a S100a11 inhibitor as an active ingredient and adding pharmaceutically acceptable excipients or auxiliary ingredients.

[0054] In summary, the present invention constructs a vector for inhibiting the expression of S100a11, and obtains a lentivirus for inhibiting the expression of S100a11 by cell transfection. During the hair cycle regeneration process of mice, the lentivirus for specifically inhibiting the expression of S100a11 is subcutaneously injected into the body of mice, which can significantly and effectively promote the regeneration of the hair on the back and induce the hair follicles to switch from the resting phase to the growth phase in advance. The present invention provides a new potential therapeutic target for related diseases such as hair loss and alopecia or hair follicle hair regeneration disorders in humans or animals, which is of great significance to the research on hair cycle regeneration and has good application prospects.

[0055] Example 1 Recombinant lentivirus containing RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP (S100a11 RNAi lentivirus)

[0056] The preparation method is as follows:

[0057] (I) Acquisition of sh_S100a11

[0058] 1. Design and synthesis of shRNA sequences targeting mouse S100a11

[0059] Referring to the nucleotide sequence information of the CDS region of the mouse S100a11 gene (NM_016740.3) in the NCBI database (as shown in SEQ ID NO: 3), the predicted mouse S100a11 nucleotide guide sequence was selected using the sequence-specific alignment tool of the Invitrogen Block-iT RNAi Designer and the NCBI-BLAST website, and the shRNA oligo of S100a11 was designed based on the vector of miR-30, and the restriction site was incorporated into the 5' end of the designed interference sequence with reference to the restriction site information shown in the plasmid map. The designed S100a11-specific shRNA oligo sequences are S100a11-F and S100a11-R, and the DNA sequences of S100a11-F and S100a11-R are as follows. Finally, the oligo sequence was handed over to Sangon Biotech for synthesis.

[0060] S100a11-F

[0061] CTAGGAAGGTATATTGCTGTTGACAGTGAGCGCGCTATAGCGTGCCATGATTCTTA GTGAAGCCACAGATGTAAGAATCATGGCACGCTATAGCTTGCCTACTGCCTCGG

[0062] S100a11-R

[0063] GATCCCGAGGCAGTAGGCAAGCTATAGCGTGCCATGATTCTTACATCTGTGGCTTC ACTAAGAATCATGGCACGCTATAGCGCGCTCACTGTCACAGCAATATACCTTC

[0064] 2. Annealing of shRNA oligo

[0065]

[0066]

[0067] The annealing conditions were 95°C, 75°C, 55°C, 35°C, and 15°C in a gradient manner, and each temperature condition lasted for 10 min.

[0068] After annealing, an RNA interference fragment of the S100a11 gene with a hairpin structure (sh_S100a11) was obtained.

[0069] The nucleotide sequence of the sh_S100a11 is shown in SEQ ID NO:4.

[0070] (II) Construction of RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP

[0071] 1. Double restriction digestion of pCDH-Lgr5-CMV-copGFP vector

[0072] The constructed pCDH-Lgr5-CMV-copGFP empty vector containing the Lgr5 gene promoter was double-digested, BamHⅠ and XbaI were selected as restriction sites, and the cloning vector was linearized with restriction endonucleases.

[0073]

[0074] The PCR instrument was set to 37°C and the reaction was carried out for 4 hours.

[0075] The samples after the reaction were run on gel and recovered by gel recovery kit (Tiangen), see the instructions for details. After the enzyme digestion product was recovered, the purity and concentration of DNA were detected by spectrophotometer.

[0076] 2. Ligation of shRNA targeting S100a11 and pCDH-Lgr5-CMV-copGFP linearized plasmid product

[0077] The shRNA annealing sequence sh_S100a11 targeting S100a11 and the vector pCDH-Lgr5-CMV-copGFP after enzyme digestion were connected and connected with T4 ligase to obtain a recombinant plasmid, namely the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP.

[0078]

[0079] The reaction was continued at 4°C for 12 h.

[0080] 3. Transform the recombinant plasmid pCDH-Lgr5-sh_S100a11-CMV-copGFP into E. coli competent cells DH5α

[0081] The above ligation products were transformed into E. coli competent cells DH5α, and a single colony was picked and sent to the company for bacterial liquid sequencing. By comparing the designed and synthesized S100a11 interference sequence (sh_S100a11) with the sequencing sequence, the results showed that the sequences were consistent, and the S100a11 gene RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP regulated by the Lgr5 promoter was obtained. The positive bacterial liquid that was successfully sequenced was used for plasmid extraction.

[0082] (III) Synthesis of recombinant lentivirus containing RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP

[0083] 1) Add the auxiliary plasmids PSPAX, PMD and pCDH-Lgr5-CMV-copGFP or pCDH-Lgr5-sh_S100a11-CMV-copGFP recombinant plasmids to HEK 293T cells at a volume ratio of 1:2:3. For specific steps, refer to the liposome transfection operation manual (Hanheng Biotechnology). 48h and 72h after adding the transfection plasmid, collect the cell culture fluid containing lentiviral particles.

[0084] 2) Filter the virus stock solution collected in the previous step through a 0.45 μm filter membrane and centrifuge at 72,000 × g for 2.5 h at 4°C to concentrate the virus. Discard the supernatant to retain the virus particle precipitate, add 500 μL of pre-cooled PBS culture medium to resuspend the virus particles, shake slowly at 150 r / min in an ice bath for 1 h, pipet evenly, and then aliquot and store at -80°C to obtain pCDH-Lgr5-CMV-copGFP and pCDH-Lgr5-sh_S100a11-CMV-copGFP lentiviruses.

[0085] 3) Lentiviral titer detection

[0086] The virus titer of the successfully packaged and purified lentivirus was tested by well-by-well dilution method. According to the titer calculation formula, the virus titers of pCDH-Lgr5-sh_S100a11-CMV-copGFP and pCDH-Lgr5-CMV-copGFP were 3.5×10 10 TU / mL, 3.75×10 10 TU / mL, the lentivirus was packaged successfully and the virus titer met the requirements of subsequent experiments.

[0087] Example 2 Application of S100a11 gene suppression expression vector in promoting hair regeneration (I) Establishment of mouse hair regeneration model

[0088] 1) Inhalation anesthesia: Dip a large cotton ball in ether and quickly put it into a sealed evaporation container to allow it to evaporate. Then put the test mouse into the container. After 3-5 minutes, depending on the depth of anesthesia, shave the back of the mouse when it is deeply anesthetized to the point of systemic paralysis.

[0089] 2) Soak the hair with gauze dipped in sterile water, and use a shaving tweezer to cut off the skin hair along the direction of the hair.

[0090] 3) Use a brush dipped in warm soapy water to soak the shaved area, and carefully trim the remaining short hair on the back.

[0091] (II) Effects of RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP knockdown expression lentivirus on hair regeneration in mice

[0092] In order to observe the effect of specific inhibition of S100a11 expression on hair regeneration in mice, 10 8-week-old mice were randomly divided into two groups and their backs were shaved. Starting from the day of shaving, subcutaneous injections were performed in a fixed area of ​​the mouse back skin every other day, for a total of 3 injections, with 100uL injected per mouse. The virus injected into the experimental group was the recombinant lentivirus containing the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP prepared in Example 1, and the virus injected into the control group was the empty vector lentivirus containing pCDH-Lgr5-CMV-copGFP. Photos were taken daily to record and observe skin color changes, back pigmentation and hair regeneration. The results are shown in the figure. Figure 2 and Figure 3 .

[0093] Depend on Figure 2 It can be seen that compared with the control group, the back skin of the experimental group mice with knockdown of S100a11 underwent pigmentation earlier and entered the growth phase of hair follicles. The experimental group mice showed obvious pigmentation on the back from day 15 to day 17 (D15-D17), while the control group mice began to show slight changes in skin color after day 22 (D22). This observation indicates that inhibiting the expression of S100a11 accelerates the skin pigmentation process, which is an early feature of the hair follicles entering the growth phase. Moreover, 3 days apart, the experimental group mice can observe regenerated hair protruding from the epidermis from day 18 to day 20 (D18-D20), indicating rapid hair growth. In contrast, the control group mice can only observe regenerated hair protruding from the epidermis after day 28 (D28), indicating that hair growth is relatively slow. This finding suggests that inhibiting the expression of S100a11 promotes the transition of hair follicles from the resting phase to the growth phase and accelerates the hair regeneration process. The time when the hair of the mice in the experimental group and the control group entered the growth phase was statistically analyzed, and it was found that the hair of the mice in the experimental group entered the growth phase significantly earlier than that of the control group (*p<0.05, Figure 3 ), therefore, in the process of hair regeneration in mice, specifically inhibiting the expression of S100a11 can significantly and effectively promote hair regeneration and induce hair follicles to switch from the resting phase to the growth phase ahead of time.

[0094] (III) Paraffin sections and H&E staining

[0095] 1. Paraffin section

[0096] 1) Four 8-week-old mice were randomly divided into two groups, with 2 mice in each group. Lentivirus injection was performed as described above, and back skin tissues were obtained on the 17th and 25th days after shaving.

[0097] 2) Spread the obtained skin sample on a plate and wash it 2-3 times with saline to remove impurities on the surface of the skin sample. Operate gently to avoid damaging the sample.

[0098] 3) Place the cleaned skin on the filter paper to fully absorb moisture, flatten the skin, and place the dermis face down and close to the filter paper. Use ophthalmic scissors to cut the skin sample together with the filter paper. Place the cut skin sample in pre-cooled tissue fixative and fix it overnight at 4°C.

[0099] 4) The next day, discard the tissue fixative. Place the skin sample in a centrifuge tube containing 50% ethanol solution and shake the sample in a shaker at 4°C for 1.5 hours to gradually remove moisture from the skin tissue, which will facilitate subsequent chemical treatment and paraffin embedding.

[0100] 5) The skin samples were sequentially placed in centrifuge tubes containing 75%, 85%, and 95% ethanol solutions, each time shaken in a shaker at 4°C for 1.5 h to ensure that the moisture in the skin tissue was completely removed and that the tissue would not be damaged due to rapid changes in ethanol concentration.

[0101] 6) Place the skin sample in a centrifuge tube containing anhydrous ethanol and shake it in a shaker at 4°C for 30 minutes. Repeat this step once to further ensure complete dehydration of the skin tissue.

[0102] 7) The skin samples were placed in a solution of ethanol and xylene mixed in a 1:1 ratio and then shaken on a shaker at room temperature for 30 min to allow for adequate mixing and penetration, making the tissue transparent for subsequent paraffin embedding.

[0103] 8) The sample was transferred into pure xylene and shaken in a shaker at room temperature for 15 min. This step was repeated once.

[0104] 9) After the clearing treatment, the skin sample was placed in completely liquefied paraffin for 6 hours. After that, the wax was replaced with fresh wax and the soaking step was repeated twice to ensure that the skin tissue was fully soaked in paraffin.

[0105] 10) Embed the embedded skin sample in a paraffin block. After the paraffin is completely solidified, use a sharp knife to trim it into a suitable shape and size, and accurately cut the wax block into slices with a thickness of 15-20 μm along the direction perpendicular to the skin.

[0106] 11) The cut wax slices are gently placed on the surface of 42°C warm water. After they are naturally flattened, they are attached with anti-slip slides to ensure that the slices are flat and free of bubbles.

[0107] 12) Place the slides containing the paraffin sections on a 42°C drying machine and dry them for 6 hours to ensure that the sections are completely fixed in preparation for subsequent microscopic observation or staining.

[0108] 2. H&E staining

[0109] 1) Paraffin sections are first placed in xylene and shaken to remove the paraffin on the sections. This step is repeated once to ensure that the paraffin is completely removed.

[0110] 2) Dewaxed sections should be placed in ethanol solutions in a concentration gradient (absolute ethanol, 95%, 85%, 75%, 50%, 25%). Shake for 2 minutes at each concentration to gradually remove the residual organic solvent in the sections and allow water molecules to gradually penetrate into the tissue.

[0111] 3) The sections are shaken in deionized water to further remove ethanol and other chemicals. This step is repeated once to ensure that the sections are fully rehydrated.

[0112] 4) The rehydrated sections are placed in a staining box, and hematoxylin dye is added to stain the cell nuclei. After standing for a period of time, they are rinsed with running water.

[0113] 5) Add hydrochloric acid ethanol to the surface of the slice to make the staining clearer and highlight the structure of the cell nucleus.

[0114] 6) Rinse again with running water to remove the hydrochloric acid and ethanol.

[0115] 7) The sections were placed in PBS solution to make the staining more uniform.

[0116] 8) Rinse the slices again with running water and remove PBS.

[0117] 9) Wash the sections briefly with 95% ethanol to remove excess water and residue.

[0118] 10) Add eosin dye to the slices to stain the cytoplasm.

[0119] 11) Place the slices in a histochemical cup and wash with 95% ethanol to remove excess eosin dye. Repeat this step once to ensure that the slices are clean.

[0120] 12) The slices were treated with anhydrous ethanol and xylene in turn to remove the residual water on the slices and prepare for sealing.

[0121] 13) Add an appropriate amount of neutral resin and cover the slide. Avoid creating bubbles during this process to ensure that the slices are smooth and clear.

[0122] 14) Observe and analyze the structure of skin tissue under a microscope.

[0123] To further verify that inhibiting the expression of S100a11 can significantly and effectively promote hair regeneration, paraffin sections of the back skin of mice in the experimental group and the control group were compared and analyzed at two times during the hair growth process. The results showed that on the 17th day, the hair follicles in the experimental group had an oval shape and the hair shaft had grown out of the epidermis. According to published articles, at this time, the hair follicles were at the beginning of the growth phase VI ( Figure 4 A). The hair bulb of the control group was round, and the hair shaft did not reach the epidermis, only growing to the bulge. The hair follicles were in the growth phase III-IV ( Figure 4 B). The experimental results on the 25th day of hair growth showed that the hair bulb of the experimental group had retracted, but was still oval, and the hair matrix cells no longer completely wrapped the hair papilla and showed a tendency to separate. This was the end of the VI phase of the growth period ( Figure 4 C). The morphology of the hair follicles in the control group at this time is similar to that of the hair follicles in the experimental group on the 17th day, which have just entered the beginning of the VI phase of the hair growth phase ( Figure 4 D). The above results show that the hair follicles in the experimental group entered the anagen phase earlier than those in the control group. Specifically inhibiting the expression of S100a11 can significantly and effectively promote hair regeneration and induce the hair follicles to switch from the resting phase to the anagen phase in advance.

[0124] It is easy for those skilled in the art to understand that, under the premise of no conflict, the above-mentioned advantageous methods can be freely combined and superimposed. The above are only preferred embodiments of the present application and are not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application. The above are only preferred implementation methods of the present application. It should be pointed out that for ordinary technicians in this technical field, several improvements and variations can be made without departing from the technical principles of the present application, and these improvements and variations should also be regarded as the protection scope of the present application.

Claims

1. Use of S100a11 inhibitors in the preparation of drugs for treating hair regeneration disorders and / or promoting hair regeneration.

2. The use according to claim 1, characterized in that The S100a11 inhibitor is at least one of the following drugs: a drug for knocking out or silencing the S100a11 gene, and a drug for inhibiting the function of the S100A11 protein.

3. The use according to claim 2, characterized in that The drugs for knocking out or silencing the S100a11 gene include: siRNA, shRNA or drugs for achieving CRISPR gene editing; the drugs for inhibiting the function of the S100A11 protein include: competitive inhibitors, non-competitive inhibitors or regulatory inhibitors.

4. The use according to claim 3, characterized in that The drug for knocking out or silencing the S100a11 gene includes: an S100a11 gene RNA interference fragment, an RNAi vector containing the S100a11 gene RNA interference fragment, or a lentivirus containing the RNAi vector containing the S100a11 gene RNA interference fragment; the S100a11 gene RNA interference fragment is an S100a11 gene RNA interference fragment sh_S100a11 with a nucleotide sequence as shown in SEQ ID NO:4, or other S100a11 gene-specific RNA interference fragments; the RNAi vector containing the S100a11 gene RNA interference fragment is an RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP with a nucleotide sequence as shown in SEQ ID NO:1, or other similar expression vectors that can be used for RNAi.

5. The use according to claim 4, characterized in that The S100a11 gene RNA interference fragment sh_S100a11 has a hairpin structure, and the construction method includes: Designing specific shRNA based on mouse S100a11 gene, obtaining an upstream sequence S100a11-F with a nucleotide sequence as shown in SEQ ID NO:6 and a downstream sequence S100a11-R with a nucleotide sequence as shown in SEQ ID NO:7; The upstream sequence S100a11-F and the downstream sequence S100a11-R were annealed to form the S100a11 gene RNA interference fragment sh_S100a11 with a nucleotide sequence as shown in SEQ ID NO:

4.

6. The use according to claim 4, characterized in that The RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP is constructed by: connecting the S100a11 gene RNA interference fragment sh_S100a11 with a nucleotide sequence as shown in SEQ ID NO:4 to the expression vector pCDH-Lgr5-CMV-copGFP to obtain the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP.

7. The use according to claim 4, characterized in that The lentivirus of the RNAi vector containing the RNA interference fragment of the S100a11 gene is obtained by transfecting the RNAi vector pCDH-Lgr5-sh_S100a11-CMV-copGFP into tool cells.

8. The use according to claim 7, characterized in that The tool cells are HEK 293T cells or other similar tool cells that are easy to transfect.

9. The use according to claim 7 or 8, characterized in that The lentivirus regulates the RNAi vector through the Lgr5 promoter to inhibit the expression of the S100a11 gene.

10. A drug for treating hair regeneration disorders and / or promoting hair regeneration, characterized in that: The invention is prepared by taking the S100a11 inhibitor as the active ingredient and adding pharmaceutically acceptable excipients or auxiliary ingredients.

Images