Peanut seed specific gene promoter Q6RBV6 and application thereof

Abstract

The invention provides a peanut seed specific gene promoter Q6RBV6 and application thereof, and relates to the technical field of plant genetic engineering. The promoter Q6RBV6 is selected from SEQ ID NO.01, a sequence which is reversely complementary with the SEQ ID NO.01, SEQ ID NO.02, a DNA (deoxyribonucleic acid) or RNA (ribonucleic acid) sequence which is hybridized with the SEQ ID NO.01 or the SEQ ID NO.02, a sequence which is at least 95% consistent with the sequence of the SEQ ID NO.01 or the SEQ ID NO.02, and a DNA or RNA sequence which is complementary with any one of the SEQ ID NO.01 and the SEQ ID NO.02; the promoter Q6RBV6 can be utilized or operated to drive the expression of the target gene in the tissue cells of the peanut seeds, so that the purpose of expressing the target gene in the specific tissue cells of the peanut seeds is achieved.

Description

Technical Field

[0001] The invention relates to the technical field of plant genetic engineering, and in particular to a peanut seed specific gene promoter Q6RBV6 and an application thereof. Background Art

[0002] A promoter is a DNA sequence that RNA polymerase recognizes, binds to, and starts transcription. It contains conserved sequences required for RNA polymerase specific binding and transcription initiation. Most of them are located upstream of the transcription start site of the structural gene, and the promoter itself is not transcribed. However, some promoters (such as tRNA promoters) are located downstream of the transcription start site, and these DNA sequences can be transcribed. The characteristics of promoters were originally identified by mutations that can increase or decrease the transcription rate of genes. Promoters are generally located upstream of the transcription start site.

[0003] With the rapid development of pharmaceutical technology and genetic engineering technology, in order to meet the low cost and high efficiency in biosynthesis fields such as drug production, plant, animal or microbial cells are used as reactors for genetic modification and gene transformation to efficiently produce heterologous proteins. They are often used in the production of products such as medicinal proteins, antigens and vaccines, and in the cultivation of new varieties of crops with high nutritional value, high active ingredient content or other excellent traits.

[0004] Crops bred through genetic engineering can have a variety of excellent traits that are difficult to obtain or stabilize through conventional breeding models, or enhance the expression of various traits themselves, thereby obtaining new crop varieties with excellent disease and pest resistance, lodging resistance, herbicide resistance, high nutritional value, high active ingredient content or other excellent traits. They have significant cost-reduction and efficiency-enhancing capabilities in agricultural production applications and have broad application prospects. However, there are also potential problems such as certain exogenous ingredients that may induce human immune responses or destroy original nutrients, which need to be avoided in gene editing.

[0005] The biggest advantage of transgenic plants as oral vaccine synthesis reactors is that they can use plant cell walls to form natural biological capsules to avoid the protein structure being destroyed by the digestive system after oral administration. Only simple ingestion is needed to allow the active ingredients to enter the intestines, stimulate specific immune responses under the stimulation of the intestinal mucosa, and enable the human body to gain immunity. Such vaccines have greatly changed the production methods, vaccination patterns and economic costs of traditional vaccines, and have important social significance and broad development prospects. In addition, important protein and peptide drugs such as human insulin, hemoglobin, immunoglobulin, and enkephalin have also been industrialized and commercialized in the production and application of plant cell reactors.

[0006] At present, the most prominent problem in the production of exogenous gene expression products by transgenic plant cell reactors is the insufficient gene expression, which is the biggest obstacle to the application of plants to produce medicinal proteins. On the one hand, this problem can be solved by using the characteristics of high metabolic rate and continuous division of stem cells such as callus tissue as reactors to make up for this shortcoming. On the other hand, it is also necessary to increase the expression level of such exogenous genes in single cells. To increase the expression level of target genes, we can start from the molecular biology level, such as using strong promoters, specific promoters or leading sequences to allow the target exogenous genes to have higher transcription and translation activities to increase the yield of target products, or control their high expression in seed tissues and specific external environmental conditions, so that in production practice, seeds can be collected under specific conditions for target product extraction instead of whole plant extraction, which will greatly reduce production costs. Summary of the invention

[0007] In view of the deficiencies in the prior art, the present invention provides a peanut seed-specific gene promoter Q6RBV6 and its application, and utilizes the specific gene promoter Q6RBV6 to drive the expression of a target gene in peanut seed tissue cells, thereby achieving the purpose of expressing the target gene in specific peanut seed tissue cells and cultivating a new high-value crop variety.

[0008] To achieve the above objectives, the technical solution of the present invention is implemented through the following technical solutions:

[0009] A peanut seed-specific gene promoter Q6RBV6, wherein the promoter Q6RBV6 can drive the target gene to be specifically and highly expressed in peanut seed tissue cells, and the DNA nucleotide sequence of the promoter Q6RBV6 is selected from any one of the following sequences:

[0010] (1) The DNA nucleotide sequence shown in SEQ ID NO.01:

[0011] GAATCTAACAAGGTGAAGTTTTCCTTTTTCACGTGATGACCACCGCATTAACTTCTTACCATATTTTTTTTCCCTAAAATTAAAAG CTATGTAAGATGAGAATAAATTTTCCCCCGGAGAAGGTCAGAATGTAGTATAGCATAAGGGATAGCAGTAAAAGCAAATGGATCGACATGTGTCTTGGTTTCCACTAACGTGGCATGAGGGTCGTCATGTGGTAGCCACGTATATTCGGGACAAGTT ACATGCATATCTTCTATTCTTCTCCACCGCCATTGGCTTCTTTGCTCAAGTTATTATAAAGGAATCGATGTTTGCTACCAGGTCTTAAAGTGCCATAGTAAATTAACCTGCTACATACTCTTATCATCACTCGATTGGAAGTTGAAGTGAGGAAACA;

[0012] (2) A sequence that is reverse complementary to the DNA nucleotide sequence shown in SEQ ID NO.01, that is, a single-stranded sequence that can form a complete base pairing with the original sequence to form a double-stranded structure and in the opposite direction, such as the DNA nucleotide sequence shown in SEQ ID NO.02:

[0013] TGTTTCCTCACTTCAACTTCCAATCGAGTGATGATAAGAGTATGTAGCAGGTTAATTTACTATGGCACTTTAAGACCTGGTAGCAAACATCGATTCCTTTATAATAACTTGAGCAAAGAAGCCAATGGCGGTGGAAGAATAGAAGATATGCATGTAACTTGTCCCGAATATACGTGGCTACCACATGACGACCCTCAT GCCACGTTAGTGGAAACCAAGACACATGTCGATCCATTTGCTTTTACTGCTATCCCTTATGCTATACTACATTCTGACCTTTCCGGGGGAAAATTTATTCTCATCTTACATAGCTTTTAATTTTAGGGAAAAAAAATATGGTAAGAAGTTAATGCGGTGGTCATCACGTGAAAAAGGAAAACTTCACCTTGTTAGATTC;

[0014] (3) a nucleic acid DNA or RNA sequence that can hybridize with the sequence of SEQ ID NO.01 or SEQ ID NO.02;

[0015] (4) a sequence having at least 95% sequence identity with the sequence described in (1) or (2);

[0016] (5) A DNA or RNA sequence complementary to any of the sequences described in (1) or (2).

[0017] Preferably, the promoter Q6RBV6 is obtained by PCR amplification technology.

[0018] Preferably, during the PCR amplification process, the following two primers are configured according to the DNA nucleotide sequence shown in SEQ ID NO.01 for amplification:

[0019] (1) SEQ ID NO.03: GAATCTAACAAGGTGAAGTTTTCCT;

[0020] (2) SEQ ID NO. 04: TGTTTCCTCACTTCAACTTCCAATC.

[0021] The specific gene promoter Q6RBV6 is used in peanut seed gene editing or transgenic operation to cultivate new varieties.

[0022] Preferably, the application method is to utilize or operate the gene promoter Q6RBV6 to drive the expression of the target gene in the peanut seed tissue cells, thereby utilizing the seed cells as reactors to synthesize related proteins at the molecular biology level.

[0023] Preferably, the specific process of the application is to perform transgenic operation on peanut seeds, use the pCAMBIA2300 plasmid sequence as a vector, construct a DNA double strand of peanut seed-specific gene promoter Q6RBV6-target gene-NOS terminator through enzyme cutting and ligation reaction, and use the plant expression vector to transform the target plant to complete genetic transformation.

[0024] The present invention provides a peanut seed-specific gene promoter Q6RBV6 and its application, which has the following advantages over the prior art:

[0025] The present invention designs a novel peanut seed-specific gene promoter Q6RBV6, and can utilize or operate the peanut seed-specific gene promoter Q6RBV6 to drive the target gene to be expressed in peanut seed tissue cells, thereby achieving the purpose of expressing the target gene in specific peanut seed tissue cells. In the molecular biology level breeding of agricultural production, the peanut seed tissue cells can be used as reactors in this way to carry out genetic modification and gene transformation to efficiently produce heterologous proteins or enhance the expression of self-proteins and produce various nutrients such as fatty acids. It can be used for the production of products such as medicinal proteins, antigens and vaccines, or for the cultivation of varieties with excellent traits such as high nutritional value and high yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the electrophoresis diagram of the PCR amplification of the peanut seed-specific gene promoter Q6RBV6 in Example 1 of the present invention;

[0027] Figure 2 This is a schematic diagram of the fluorescence reaction of seeds of the positive variety of Yuhua 9326 genetic transformation in Example 2 of the present invention;

[0028] Figure 3 This is a schematic diagram showing that the seeds of the untransformed variety Yuhua 9326 in Example 2 of the present invention have no fluorescent reaction. DETAILED DESCRIPTION

[0029] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention is clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0030] Embodiment 1:

[0031] PCR amplification of peanut seed-specific gene promoter Q6RBV6:

[0032] 1. Select the DNA nucleotide sequence shown in SEQ ID NO.01 as the peanut seed-specific gene promoter Q6RBV6 sequence;

[0033] GAATCTAACAAGGTGAAGTTTTCCTTTTTCACGTGATGACCACCGCATTAACTTCTTACCATATTTTTTTTCCCTAAAATTAAAAGCTATGTAAGATGAGAATAAATTTTCCCCCGGAGAAGGTCAGAATGTAGTATAGCATAAGGGATAGCAGTAAAAGCAAATGGATCGACATGTGTCTTGGTTTCCACTAACGTGGC ATGAGGGTCGTCATGTGGTAGCCACGTATATTCGGGACAAGTTACATGCATATCTTCTATTCTTCTCCACCGCCATTGGCTTCTTTGCTCAAGTTATTATAAAAGGAATCGATGTTTGCTACCAGGTCTTAAAGTGCCATAGTAAATTAACCTGCTACATACTCTTATCATCACTCGATTGGAAGTTGAAGTGAGGAAACA;

[0034] 2. Configure two primers (length 25bp) according to the above sequence:

[0035] SEQ ID NO.03:GAATCTAACAAGGTGAAGTTTTCCT

[0036] SEQ ID NO.04: TGTTTCCTCACTTCAACTTCCAATC;

[0037] 3. Prepare a DNA amplification system based on DNA polymerase, taking the total volume of the system as 50 μL as an example:

[0038] (1) dd H2O 30.5μL

[0039] (2) 10× Buffer 5 μL

[0040] (3) dNTP (10mmol / L) 1μL

[0041] (4)SEQ ID NO.03 (10μmol / L) 5μL

[0042] (5)SEQ ID NO.04 (10μmol / L)5μL

[0043] (6) MgCl2 (50mmol / L) 0.5μL

[0044] (7) Peanut genomic DNA 2μL

[0045] (8) DNA polymerase 1 μL;

[0046] 4. Run the PCR amplification program:

[0047] Place the above amplification system into a PCR thermal cycler and perform the following thermal cycle steps:

[0048] (1) 98°C, 5 min

[0049] (2) 98°C, 30 seconds

[0050] (3) 55°C, 30 seconds

[0051] (4) 72°C, 3 min, repeat steps (2)-(4) for 20 cycles

[0052] (5) 72°C, keep warm for 20 min;

[0053] 5. Run the gel electrophoresis to recover a DNA fragment with a length of 0.40 kb;

[0054] 6. Use pEASY-Blunt to perform blunt-end ligation, transform DH5α Escherichia coli competent cells, and complete sequencing.

[0055] Embodiment 2:

[0056] The peanut seed-specific gene promoter Q6RBV6 obtained in Example 1 above was used for crop genome integration operation:

[0057] The pCAMBIA2300 plasmid sequence was used as a vector, and a double-stranded DNA sequence of peanut seed-specific gene promoter Q6RBV6, GFP fluorescent protein gene, and NOS terminator was constructed through enzyme digestion and ligation reaction. The plant expression vector was used to transform the target plant to complete genetic transformation.

[0058] Tissue culture and subsequent differentiation induction were performed on the callus of Yuhua 9326 peanut in MB medium to obtain 20 complete plants of the original Yuhua 9326 variety peanut and 20 complete plants of the transgenic Yuhua 9326 variety peanut (genetic transformation positive variety) in which the GFP fluorescent protein gene was inserted using the peanut seed-specific gene promoter Q6RBV6-GFP fluorescent protein gene-NOS terminator plasmid sequence. The plants were planted under normal greenhouse conditions for 120 days until the plants matured and bore fruit. The seeds of the two plants were collected and the cotyledons and embryos were separated separately. The two peanut seeds were observed for the presence and intensity of fluorescence under ultraviolet light to investigate the enhanced expression of the GFP fluorescent protein gene. The results are as follows: Figure 2-3 As shown, the peanut seed-specific gene promoter Q6RBV6 can enhance the expression of the GFP fluorescent protein gene in peanut seed tissue cells.

[0059] The remaining parts of the original Yuhua 9326 peanut variety obtained after the above planting and the transgenic Yuhua 9326 peanut variety (genetic transformation positive variety) in which the GFP fluorescent protein gene is inserted using the peanut seed-specific gene promoter Q6RBV6-GFP fluorescent protein gene-NOS terminator plasmid sequence, i.e., the protein extracts of the roots, stems, leaves, and shells and the protein extracts of the seeds are observed for the presence and intensity of fluorescence under ultraviolet light conditions to examine the enhanced expression of the GFP fluorescent protein gene;

[0060] The final test showed that except for the seeds, no fluorescence was found in the protein extracts of the roots, stems, leaves and shells of the intact peanut plants of the genetically transformed positive varieties. That is, the promoter had no obvious effect on promoting the expression of the GFP fluorescent protein gene in parts other than the seeds in the two plants.

[0061] Embodiment 3:

[0062] Peanut seed-specific gene promoter Q6RBV6 for crop gene editing:

[0063] Peanut protein contains 8 essential amino acids for the human body and is a plant protein with high nutritional value. Compared with soy protein, it has the advantages of being easy to digest, containing less bloating factors, and having no beany smell; compared with rapeseed and cottonseed proteins, it contains less toxic substances and is an ideal basic raw material for the food industry. Among them, the content of glutamic acid and aspartic acid is higher than that of rice, flour and corn, and its effective utilization rate is as high as 98.4%. The protein content in peanuts is 24% to 36%. According to the solubility characteristics of peanut protein, it is divided into two major categories, namely water-soluble protein and salt-soluble protein. About 10% of the protein is water-soluble protein, called albumin, and the remaining 90% is salt-soluble protein. It is generally believed that the increase of water-soluble protein in food is conducive to the hydrolysis of protein by digestive enzymes, which is conducive to the digestion and absorption of protein components by animals or humans, and significantly increases the digestibility and utilization rate of protein. Therefore, increasing the content of water-soluble protein (albumin) in food or feed has always been an important topic in the food and feed industry. For peanuts, we can consider utilizing their own 2s albumin synthesis ability and using gene editing methods to increase the expression of 2s albumin synthesis genes to increase the albumin output of peanut tissues.

[0064] 1. Using the pCAMBIA2300 plasmid sequence as a vector, a DNA double strand of peanut seed-specific gene promoter Q6RBV6, Salmonella typhi Ty21a antigen gene, and NOS terminator was constructed through enzyme digestion and ligation reactions, and the plant expression vector was used to transform the target plant to complete genetic transformation;

[0065] 2. Tissue culture and subsequent differentiation induction were carried out on the callus of Yuhua 47 peanut in MB medium to obtain 20 complete plants of the original Yuhua 47 peanut variety and the transgenic Yuhua 47 (genetic transformation positive variety) peanut variety in which the 2s albumin expression gene was inserted using the peanut seed-specific gene promoter Q6RBV6-2s albumin synthesis gene-NOS terminator plasmid sequence. The plants were planted in normal greenhouse conditions for 120 days until the plants matured and bore fruit. The seeds of the two plants were collected and the seed parts were separated separately. The proportion of albumin in the total protein content detected in the seed part was used as an indicator to examine the enhanced expression of the 2s albumin gene.

[0066] 3. When testing the peanut albumin content, 3 groups of samples were prepared for each of the genetically transformed positive varieties and the untransformed variety Yuhua 47 for experiment. The peanut seed fragments of each group of samples that had been treated with biofilm enzymatic hydrolysis were mixed and divided into sample A and sample B. Sample A was used to determine the total amount of protein by the Kjeldahl method. Sample B was preliminarily precipitated with 65% ammonium sulfate solution to obtain the required peanut albumin, and purified with a DEAE-52 column to obtain peanut albumin. The total amount of albumin was determined, and the relative content of albumin to the total protein was obtained as shown in Table 1:

[0067] Table 1

[0068]

[0069] From the above tests, it can be seen that the relative content of albumin in the seeds of Yuhua 47 (genetically transformed positive variety) is greatly increased compared with that of Yuhua 47 (untransformed variety).

[0070] 4. The albumin and total protein contents of the remaining parts of the intact plants of the original Yuhua 47 variety peanut obtained after the above planting and the transgenic Yuhua 47 variety peanut (genetic transformation positive variety) variety peanut in which the 2s albumin expression gene is inserted using the peanut seed specific gene promoter Q6RBV6-2s albumin synthesis gene-NOS terminator plasmid sequence, i.e., the roots, stems, leaves, shells, and seed coats are crushed and the mixture is subjected to the same determination as the seed part. That is, when testing the peanut albumin content, the peanut seed fragments treated with biofilm enzymatic hydrolysis are mixed and divided into samples A and B. Sample A is used to determine the total protein content by the Kjeldahl method, and sample B is used to preliminarily precipitate the required peanut albumin with a 65% ammonium sulfate solution, and the peanut albumin is purified with a DEAE-52 column to obtain the peanut albumin, and the total albumin content is determined. The data obtained are shown in Table 2 below:

[0071] Table 2

[0072]

[0073] From the above tests, it can be seen that there is no obvious increase in the synthesis of 2s albumin in the remaining plant cells except seeds of both Yuhua 47 (untransformed variety) and Yuhua 47 (genetically transformed positive variety), that is, the expression of 2s albumin synthesis genes has not been enhanced.

[0074] Based on the above experiments, it can be concluded that the albumin content in the seed tissue cells of 47 peanut species of Yuhua inserted with the peanut seed-specific gene promoter Q6RBV6 - 2s albumin synthesis gene - NOS terminator plasmid sequence was significantly increased compared with the untreated peanut species under the same growth conditions, while no significant change was found in the albumin content in the rest of the plant. Therefore, the peanut seed-specific gene promoter Q6RBV6 has obvious tissue specificity and expression enhancement effects on the expression of 2s albumin synthesis gene in seed tissue cells when used for gene editing.

[0075] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A peanut seed-specific gene promoter Q6RBV6, characterized in that: The promoter Q6RBV6 can drive the target gene to be specifically and highly expressed in peanut seed tissue cells, and the DNA nucleotide sequence of the promoter Q6RBV6 is selected from any one of the following sequences: (1) The DNA nucleotide sequence shown in SEQ ID NO.01: GAATCTAACAAGGTGAAGTTTTCCTTTTTCACGTGATGACCACCGCATTAACTTCTTACCATATTTTTTTTCCCTAAAATTAAAAGCTATGTAAGATGAGAATAAATTTTCCCCCGGAGAAGGTCAGAATGTAGTATAGCATAAGGGATAGCAGTAAAAGCAAATGGATCGACATGTGTCTTGGTTTCCACTAACGTGGC ATGAGGGTCGTCATGTGGTAGCCACGTATATTCGGGACAAGTTACATGCATATCTTCTATTCTTCTCCACCGCCATTGGCTTCTTTGCTCAAGTTATTATAAAAGGAATCGATGTTTGCTACCAGGTCTTAAAGTGCCATAGTAAATTAACCTGCTACATACTCTTATCATCACTCGATTGGAAGTTGAAGTGAGGAAACA; (2) A sequence that is reverse complementary to the DNA nucleotide sequence shown in SEQ ID NO.01, that is, a single-stranded sequence that can form a complete base pairing with the original sequence to form a double-stranded structure and in the opposite direction, such as the DNA nucleotide sequence shown in SEQ ID NO.02: TGTTTCCTCACTTCAACTTCCAATCGAGTGATGATAAGAGTATGTAGCAGGTTAATTTACTATGGCACTTTAAGACCTGGTAGCAAACATCGATTCCTTTATAATAACTTGAGCAAAGAAGCCAATGGCGGTGGAAGAATAGAAGATATGCATGTAACTTGTCCCGAATATACGTGGCTACCACATGACGACCCTCAT GCCACGTTAGTGGAAACCAAGACACATGTCGATCCATTTGCTTTTACTGCTATCCCTTATGCTATACTACATTCTGACCTTTCCGGGGGAAAATTTATTCTCATCTTACATAGCTTTTAATTTTAGGGAAAAAAAATATGGTAAGAAGTTAATGCGGTGGTCATCACGTGAAAAAGGAAAACTTCACCTTGTTAGATTC; (3) a nucleic acid DNA or RNA sequence that can hybridize with the sequence of SEQ ID NO.01 or SEQ ID NO.02; (4) a sequence having at least 95% sequence identity with the sequence described in (1) or (2); (5) A DNA or RNA sequence complementary to any of the sequences described in (1) or (2).

2. The peanut seed-specific gene promoter Q6RBV6 according to claim 1, characterized in that: The promoter Q6RBV6 is obtained by PCR amplification technology.

3. The peanut seed-specific gene promoter Q6RBV6 according to claim 2, characterized in that: In the PCR amplification process, the following two primers are configured according to the DNA nucleotide sequence shown in SEQ ID NO.01 for amplification: (1) SEQ ID NO.03: GAATCTAACAAGGTGAAGTTTTCCT; (2) SEQ ID NO. 04: TGTTTCCTCACTTCAACTTCCAATC.

4. An application of the peanut seed-specific gene promoter Q6RBV6 according to any one of claims 1 to 3, characterized in that: The specific gene promoter Q6RBV6 is applied to peanut seed gene editing or transgenic operation to cultivate new varieties.

5. The use according to claim 4, characterized in that: The application method is to use or operate the gene promoter Q6RBV6 to drive the target gene to express in peanut seed tissue cells, thereby using the seed cells as reactors to synthesize related proteins at the molecular biology level.

6. The use according to claim 5, characterized in that: The specific process of the application is to perform transgenic operation on peanut seeds, use the pCAMBIA2300 plasmid sequence as a vector, construct a DNA double chain of peanut seed specific gene promoter Q6RBV6-target gene-NOS terminator through enzyme cutting and ligation reaction, and use the plant expression vector to transform the target plant to complete genetic transformation.

Images