Application of OsNLP3 gene

Abstract

The invention discloses application of an OsNLP3 gene, and relates to the technical field of plant genetic engineering, and an amino acid sequence coded by the OsNLP3 gene is shown as SEQ ID NO.2. By constructing an OsNLP3 gene overexpression plant and comparing the OsNLP3 gene overexpression plant with a wild type of the OsNLP3 gene overexpression plant, the increase of the single gene expression quantity of the OsNLP3 gene overexpression plant causes the significant increase of the total protein content of the rice, the invariable characters of the grain length, the grain width, the yield and the like, the genetic effect is significant, and the OsNLP3 gene overexpression plant has huge application potential and prospects for the improvement of the characters of rice varieties and provides a new gene resource for

Description

Technical Field

[0001] The present invention relates to the technical field of plant genetic engineering, and more particularly to the application of OsNLP3 gene. Background Art

[0002] Protein is a fundamental requirement for human life and is widely involved in various life-regulating pathways. Insufficient intake poses a serious threat to human health. Protein, second only to starch in terms of its content as a storage substance, accounts for approximately 7%-10% of the dry weight of rice. Therefore, increasing rice protein content and thus enhancing its nutritional quality is a crucial approach to ensuring food production safety and improving human health.

[0003] Rice proteins are primarily divided into albumins, globulins, alcohol-soluble proteins, and glutenins. Glutenins are the most abundant, primarily found in the endosperm and aleurone layer. Therefore, the content and composition of rice protein directly determine its nutritional quality. The synthesis and metabolism of rice proteins are controlled by complex environmental factors and gene regulatory networks. Research has shown that rice protein content is a quantitative trait controlled by multiple genes and is highly susceptible to environmental influences. Currently, 15 glutelin-encoding genes have been identified in rice, primarily from the Glu family. OsGluA2 has been further confirmed as a positive regulator of rice seed protein content (Yang et al. 2019). Sequencing of the rice genome has revealed the presence of 34 alcohol-soluble protein genes, and further research has identified the amino acid permease OsAAP6. Increased expression of the rice amino acid permease OsAAP6 promotes amino acid absorption and transport in rice roots, accelerating the synthesis and accumulation of glutelins, albumins, alcohol-soluble proteins, and globulins, significantly increasing rice protein content (Peng et al. 2014). However, rice still contains naturally occurring variants and superior genes with high protein content, which are urgently awaiting discovery and application. Furthermore, using rice as a base crop, researchers have recently introduced multiple synthetic genes for important nutrients through synthetic biology and genetic engineering to meet people's nutritional and health needs, demonstrating significant application potential and market demand.

[0004] Therefore, using synthetic biology technology to improve rice protein content and nutritional quality is feasible and has broad application prospects. Summary of the Invention

[0005] In view of this, the present invention provides an application of the OsNLP3 gene.

[0006] In order to achieve the above object, the present invention adopts the following technical solutions:

[0007] Application of OsNLP3 gene: increasing glutenin content in rice;

[0008] The amino acid sequence encoded by the OsNLP3 gene is shown in SEQ ID NO.2.

[0009] Preferably, the nucleotide sequence of the OsNLP3 gene is shown as SEQ ID NO.1.

[0010] Another object of the present invention is to provide an application of a biomaterial for increasing the expression of the OsNLP3 gene, wherein the application is to increase the gluten content in rice;

[0011] The biological material is one of the following:

[0012] a. an expression cassette capable of overexpressing the OsNLP3 gene;

[0013] b. a recombinant vector containing the expression cassette;

[0014] c. a recombinant microorganism containing the expression cassette or the recombinant vector described in b;

[0015] The amino acid sequence encoded by the OsNLP3 gene is shown in SEQ ID NO.2.

[0016] Preferably, the nucleotide sequence of the OsNLP3 gene is shown as SEQ ID NO.1.

[0017] Another object of the present invention is to provide a breeding method for increasing the glutelin content in rice, wherein the method utilizes transgenic means to increase the expression level of the OsNLP3 gene;

[0018] The amino acid sequence encoded by the OsNLP3 gene is shown in SEQ ID NO.2.

[0019] Beneficial Effects: The present invention provides applications of the OsNLP3 gene. Enhanced single-gene expression leads to increased total protein content in rice, while maintaining significant changes in traits such as grain length, grain width, and yield. This significant genetic effect demonstrates significant potential for improving rice cultivars and provides a new genetic resource for rice breeding to enhance protein content and nutritional quality. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are merely embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on the provided drawings without paying any creative work.

[0021] Figure 1The accompanying drawings are plasmid maps of the overexpression vector pU1301 provided by the present invention; wherein A is a linear schematic diagram of the vector; and B is a circular schematic diagram of the vector.

[0022] Figure 2 The accompanying drawings show a comparison of the expression levels of the OsNLP3 gene in transgenic plants overexpressing OsNLP3 in the Kitaake background provided by the present invention. OE-OsNLP3-1 and OE-OsNLP3-2 represent the numbers of two OsNLP3 overexpressing plants, respectively. The same explanation applies to the legends of the following figures.

[0023] Figure 3 The accompanying drawings are statistical graphs of grain shape, 1000-grain weight, and single-plant yield data of transgenic plants overexpressing OsNLP3 in the Kitaake background provided by the present invention; wherein A is a photograph of rice grain shape, B is a photograph of brown rice morphology, C is grain length, D is grain width, E is 1000-grain weight, and F is single-plant yield.

[0024] Figure 4 The accompanying drawing is a statistical diagram of total protein content data of transgenic plants overexpressing OsNLP3 in Kitaake background provided by the present invention.

[0025] Note: In the above figures, ** and * indicate significant differences at the 0.01 and 0.05 levels of the t-test, respectively. No mark indicates no significant difference. DETAILED DESCRIPTION

[0026] The following will clearly and completely describe the technical solutions in the embodiments of the present invention in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative efforts are within the scope of protection of the present invention.

[0027] Example 1 Acquisition and quantitative expression analysis of rice OsNLP3 gene overexpression plants

[0028] 1. Construction of Rice OsNLP3 Gene Overexpression Vector

[0029] Based on the OsNLP3 gene (LOC_Os01g13540) sequence published by the Rice Genome Annotation Project (http: / / rice.plantbiology.msu.edu / ), a pair of specific PCR primers (OsNLP3F: CGGGGTACCATGGAGGTTGACCCATCGTC, SEQ ID NO. 3; OsNLP3R: GCGGGATCC TCAACCTGAGCTTCCACAGG, SEQ ID NO. 4) with a restriction endonuclease KpnI and a BamHI linker were designed. PCR amplification was performed using cDNA from the rice cultivar Kitaake as a template. The reaction system consisted of 25 μL of 2× Taq Mix, 1 μL of cDNA, and 1 μL of primer-F / R, which was then added to 50 μL with water. The PCR reaction program was: 95°C for 3 min, 95°C for 30 sec, 55°C for 30 sec, 72°C for 60 sec, 72°C for 5 min, and 10°C for 5 min, for 35 cycles. The obtained gene OsNLP3 sequence was constructed into the pU1301 expression vector by homologous recombination (see the attached plasmid map). Figure 1 ).

[0030] OsNLP3 gene CDS sequence:

[0031]

[0032] The amino acid sequence of OsNLP3 is:

[0033] MEVDPSSSLPGAGEGGGGGIGGGGGDLWPFDSLTTSLLFSSVSASPQPLPASSSSWLTPPSPLWLFDERQLLPLDMGAPAAPATAPPAEAAAVVEEVHRTRSGNSDTTSKRVDQINSKWQFHLSIDDNTDSSCLFKERLTQALRYFKESTDQHLLVQVWAPVKSGDRYVLTTSGQPFVLDQQSIGLLQYRAVSMMYMFSVDGENAGELGLPGRVYKQKVPEWTPNVQYYSSTEYPRLNHAISYNVHGTVALPVFDPSVQNCIAVVELIMTSKKINYAGEVDKVCKALEAVNLKSTEILDHPNVQICNEGRQSALVEILEILTVVCEEHKLPLAQTWVPCKYRSVLAHGGGVKKSCLSFDGSCMGEVCMSTSDVAFHVIDAHMWGFRDACVEHHLQKGQGVSGKAFIYRRPCFSKDISQFCKLEYPLVHYARMFGLAGCFAICLQSMYTGDDDYILEFFLPPNCRNEDDQNALLESILARMKKCLRTLKVVGNGDTNEVCLQISNVLIIETEDLKTNVHFENSEGCFRESPESNGSQRVHEVDNDGNKVSIMSERHLLADDNSQNNGASVGRPNGSGASDSLHKSNKPPERRRGKAEKTISLDVLQQYFSGSLKNAAKSLGVCPTTMKRICRQHGISRWPSRKINKVNRSLSKLKQVIESVQGSDAAFNLTSITGPLPIPVGPSSDSQNLEKASPNKVAELSNLAVEGDRDSSLQKPIENDNLAILMSQQGFIDANNNLQLEADKASHSRSSSGEGSINSRTSEASCHGSPANQTFVCKPIASTFAEPQLIPEAFTKEPFQEPALPLSRMLIEDSGSSKDLKNLFTSAVDQPFLARSSNLALMQNSGTVTIKASFKEDIVRFRFPCSGSVTALKDEVAKRLRMDVGMFDIKYLDDDHEWVKLACNADLEECMEISGSHVIRLLVSDVAAHLGSSCGSSG*, such as SEQ ID NO.2.

[0034] 2. Acquisition of overexpressing plants of rice OsNLP3 gene

[0035] The resulting 1301-pUbi::OsNLP3 overexpression vector was transformed into rice plants via Agrobacterium-induced transformation. The specific transformation procedure is as follows: Thaw a competent Agrobacterium culture at -80°C on ice, add 10 μL of the 1300-pUbi::OsNLP3 plasmid to 100 μL of the competent Agrobacterium culture, and gently swirl the culture with a pipette to mix thoroughly. Place the culture on ice for 20 minutes, then quickly freeze in liquid nitrogen for 5 minutes and incubate in a 37°C water bath for 5 minutes. After another 2-minute ice bath, add 1 mL of antibiotic-free LB solution and incubate on a shaker at 28°C for 2-4 hours. Centrifuge at 8000 rpm for 1 minute at room temperature, discard the supernatant, and resuspend 100-200 μL of the pellet. Plate the pellet onto solid LB medium (100 mg / L Kan, 125 mg / L Rif) and incubate at 28°C for 2-3 days. Once a single colony has grown, perform PCR screening to identify positive engineered bacteria. Finally, Kitaake callus was transformed through Agrobacterium-mediated transformation to obtain T0 generation transgenic plants.

[0036] 3. Identification of Rice Plants Overexpressing the OsNLP3 Gene

[0037] Quantitative expression analysis in various tissues of rice Kitaake

[0038] Fresh field rice seed samples of Kitaak, OE-OsNLP3-1, and OE-OsNLP3-2 were collected and placed in liquid nitrogen in an RNase-free centrifuge tube. The mortar and pestle were pre-sterilized with alcohol and pre-chilled. An appropriate amount of liquid nitrogen was poured into the mortar to reduce the sample to a powder. After adding 1 mL of Trizol and vortexing, the sample was allowed to stand at room temperature for 20 minutes. After adding 200 μL of chloroform and vortexing, the sample was centrifuged at 13,000 rpm at 4°C for 10 minutes. Approximately 700 μL of the supernatant was transferred to a new 1.5 mL RNase-free centrifuge tube. An equal volume of isopropanol was added to each tube and the tube was mixed by inversion. The tubes were centrifuged at 13,000 rpm at 4°C for 10 minutes. The supernatant was discarded, and the pellet was washed with 75% ethanol (treated with DEPC·H2O) and centrifuged at 13,000 rpm at 4°C for 5 minutes. Discard the supernatant, centrifuge for 1 minute, remove excess liquid, dry in a ventilated kitchen for 1 minute (not too long), add 30μL DEPC H2O to dissolve RNA, and store at -80℃. cDNA (complementary DNA) synthesis uses TOYOBO's reverse transcription kit, aspirate 1μg RNA for reverse transcription, and store at -20℃ after the reaction is completed. The expression of OsNLP3 gene was quantitatively detected by real-time fluorescence quantitative qPCR (quantitative PCR) using Power qPCRSYBR Green MasterMix. The results showed that compared with rice Kitaak, the overexpression plants OE-OsNLP3-1 and OE-OsNLP3-2 were positive plants (see Appendix Figure 2 ).

[0039] Example 2 Comparison of agronomic traits of OsNLP3 overexpressing strains

[0040] All obtained materials were planted in the experimental fields of the Fuyang Base of the China National Rice Research Institute. Individual plants were planted with a row spacing of 19.8 cm and a plant spacing of 16.5 cm. All field experiments were managed uniformly according to normal field production methods. Yield trait assessment: After rice maturity, 10 of the 12 individual plants of the OsNLP3 overexpressing lines were harvested. The grains were naturally dried and then stored at room temperature for at least 3 months to ensure grain dryness and relatively consistent moisture content among the lines. Grain shape, 1000-grain weight, and yield per plant were evaluated. The number of panicles per plant was calculated by dividing the total number of effective panicles by the number of plants. The number of filled grains per panicle was calculated by dividing the total number of filled grains by the total number of panicles. The 1000-grain weight was calculated by converting the weight of two 300-filled kernels. The yield per plant was calculated by dividing the weight of all filled kernels by the number of plants. Compared with the wild type, the grain length, 1000-grain weight, and yield of the OsNLP3 overexpressing plants did not change significantly (see Appendix). Figure 3 ).

[0041] Example 3 Identification of protein content in OsNLP3 overexpressing plants

[0042] Rice protein primarily consists of gluten and alcohol-soluble proteins. To determine the total protein content of brown rice, total protein was extracted from wild-type and transgenic brown rice. The procedure was as follows: Brown rice, removed from the greenish part of the rice at maturity, was ground into powder using a mill. The rice was then dried in an 80°C oven to a constant weight and allowed to cool to room temperature in a desiccator. 25 mg of brown rice powder was weighed and placed in a 2 mL RNase-free centrifuge tube. 700 μL of seed total protein extract (125 mM Tris-HCl (pH 6.8), 4% w / v SDS, 4 M Urea) was added. 5% β-mercaptoethanol was added before use. The brown rice powder and protein extract were thoroughly vortexed to prevent clumping. The samples were incubated in a 50°C metal bath for 6 hours, with samples removed and vortexed every 30 minutes. Centrifuge at 13,000 rpm for 8 minutes, and collect the supernatant for protein content determination. Specifically, 0.1 ml of the extract was added to a 10 ml graduated test tube, followed by 5 ml of Coomassie Brilliant Blue G-250 reagent and mixing. After standing for 2 minutes, the OD value was measured at a wavelength of 595 nm in a 10 mm optical path cuvette and recorded. Finally, the corresponding protein concentration was calculated based on the standard curve. Compared with the wild type, the total protein (glutenin and alcohol-soluble protein) content of the OsNLP3 overexpressing plants was significantly increased (see Appendix). Figure 4 ).

[0043] The various embodiments in this specification are described in a progressive manner, and each embodiment focuses on the differences from other embodiments. The same or similar parts between the various embodiments can be referenced to each other.

[0044] The above description of the disclosed embodiments is intended to enable one skilled in the art to implement or use the present invention. Various modifications to these embodiments will be readily apparent to one skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention is not limited to the embodiments shown herein but is intended to conform to the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The application of OsNLP3 gene is characterized by: The application is: Increase the total protein content of rice; The amino acid sequence encoded by the OsNLP3 gene is shown in SEQ ID NO.

2.

2. The use of the OsNLP3 gene according to claim 1, characterized in that: The nucleotide sequence of the OsNLP3 gene is shown in SEQ ID NO.

1.

3. Application of biomaterials for increasing the expression of OsNLP3 gene, characterized in that: The application is: Increase the total protein content of rice; The biological material is one of the following: a. an expression cassette capable of overexpressing the OsNLP3 gene; b. a recombinant vector containing the expression cassette described in a; c. a recombinant microorganism containing the expression cassette described in a or the recombinant vector described in b; The amino acid sequence encoded by the OsNLP3 gene is shown in SEQ ID NO.

2.

4. The use of the biomaterial for increasing the expression of the OsNLP3 gene according to claim 3, characterized in that: The nucleotide sequence of the OsNLP3 gene is shown in SEQ ID NO.

1.

5. A breeding method for increasing the glutenin content of rice, characterized in that: Using transgenic methods to increase the expression of the OsNLP3 gene; The amino acid sequence encoded by the OsNLP3 gene is shown in SEQ ID NO.2.

Images