Primer probe combination, kit and detection method for identifying macadamia nut honey

Abstract

The invention provides a primer probe combination, a kit and a detection method for identifying macadamia nut honey, and belongs to the technical field of plant-derived component detection. The primer probe combination comprises an upstream primer, a downstream primer and a probe, the sequence of the upstream primer is as shown in SEQ ID NO: 1, the sequence of the downstream primer is as shown in SEQ ID NO: 2, and the sequence of the probe is as shown in SEQ ID NO: 3. According to the invention, 14 batches of macadamia nut honey collected from February 26th, 2020 to March 9th, 2024 are detected, and the result shows that 14 batches of samples all have positive amplification curves, which indicates that the 14 batches of macadamia nut honey have detected macadamia nut components, and the 14 batches of macadamia nut honey can be determined as macadamia nut honey. The primer probe combination has good specificity and sensitivity, and can be widely applied to identification of macadamia nut honey.

Description

Technical Field

[0001] The present invention relates to the technical field of plant-derived component detection, and in particular to a primer-probe combination, a kit and a detection method for identifying macadamia honey. Background Art

[0002] Macadamia ternifolia, an evergreen tree belonging to the genus Macadamia in the family Proteaceae, is known as the "Queen of Dried Fruits". It is native to the coastal subtropical forests of southeastern Queensland and northeastern New South Wales, Australia. The unique nutritional value of macadamia kernels makes it a high-quality edible fruit and has been introduced and cultivated in many regions. At present, the planting area of ​​macadamia in Xishuangbanna has reached 14.67×104km 2 , has become the main nectar plant in Yunnan Province, and macadamia honey has also become an important single-flower honey in Yunnan. Macadamia honey has a delicate texture, light amber color, sweet honey fragrance, rich in nutrients such as protein, amino acids, minerals and vitamins, and has the effects of moisturizing the intestines, aiding digestion, and regulating body metabolism.

[0003] However, the phenomenon of honey adulteration has existed for many years, disrupting the market order of bee products and infringing on the interests of consumers. Therefore, it is extremely important to find a detection technology that can quickly and accurately identify the authenticity of macadamia honey. There are few reports on macadamia honey in domestic and foreign literature, and their reports mainly focus on physical and chemical indicators, volatile component analysis, etc., and the identification technology of macadamia honey is relatively scarce. The TaqMan probe real-time fluorescence PCR rapid identification method is widely used in the food field and the technical conditions are mature. However, there is no primer probe combination for the identification of macadamia honey in the prior art. Summary of the invention

[0004] The object of the present invention is to provide a primer-probe combination, a kit and a detection method for identifying macadamia honey. The present invention designs specific primers and probes based on the species-specific sequence of macadamia nuts, and detects whether honey contains macadamia nuts by real-time fluorescent PCR, thereby distinguishing macadamia honey from honeys of different flower species. The problem that the prior art cannot identify macadamia honey is solved.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides a primer-probe combination for identifying macadamia honey, comprising an upstream primer, a downstream primer and a probe; the sequence of the upstream primer is shown in SEQ ID NO:1, the sequence of the downstream primer is shown in SEQ ID NO:2, and the sequence of the probe is shown in SEQ ID NO:3.

[0007] The present invention also provides application of the primer-probe combination in identifying macadamia honey.

[0008] The present invention also provides the use of the primer-probe combination in preparing a kit for identifying macadamia honey.

[0009] The present invention also provides a kit for identifying macadamia nut honey, comprising the primer-probe combination.

[0010] The present invention also provides a method for identifying macadamia honey, comprising the following steps:

[0011] (1) Extract DNA from macadamia honey samples;

[0012] (2) Using the DNA in the Australian bee nut honey sample as a template, the primer probe combination is used to perform real-time fluorescent PCR. If a positive amplification curve can be amplified, it can be determined to be Australian bee nut honey.

[0013] Preferably, the reaction procedure of the real-time fluorescent PCR is: pre-denaturation at 95°C for 10 min; 95°C for 15 s, 57°C for 1 min, and 45 cycles.

[0014] Preferably, the specific steps of extracting DNA from a honey sample are as follows: take 18-22 mL of honey sample, add sterile water to 40-50 mL, centrifuge and discard the supernatant, mix the precipitate with 580-620 μL of CTAB extract solution was mixed; steel beads and glass beads, 8-12 μL of mercaptoethanol, and 18-22 μL of snail enzyme were added, and the mixture was oscillated and crushed, and then incubated at 63-67°C for 55-65 min; 780-820 μL of chloroform was added, and the mixture was centrifuged after mixing, and the supernatant was taken, and 1.5-2.5 times the volume of CTAB precipitation solution was added, and the mixture was oscillated and mixed, and the mixture was allowed to stand at room temperature for 1 h, and the supernatant was discarded after centrifugation, and 380-420 μL of sodium chloride aqueous solution was added to dissolve the precipitate, and then 380-420 μL of chloroform was added to oscillate and mix, and the supernatant was taken after centrifugation, and 0.7-0.9 volumes of isopropanol were added, and the mixture was allowed to stand at 3-5°C for 35-45 min, and the supernatant was discarded after centrifugation, and the precipitate was washed 2-3 times with 68-72% ethanol, and the supernatant was discarded, and the precipitate was dried at room temperature, and the obtained precipitate was the extracted DNA.

[0015] Preferably, the diameter of the steel bead is 5 mm, and the amount added is 1 bead; the diameter of the glass bead is 0.5 mm, and the amount added is 0.8-1.2 mL.

[0016] By adopting the above technical scheme, the present invention has the following beneficial effects: the primer-probe combination of the present invention comprises an upstream primer, a downstream primer and a probe; the sequence of the upstream primer is shown in SEQ ID NO:1, the sequence of the downstream primer is shown in SEQ ID NO:2, and the sequence of the probe is shown in SEQ ID NO:3. The present invention detects 14 batches of macadamia honey collected at different times and places, and the results show that positive amplification curves appear in all 14 batches of samples, and macadamia components are detected in all 14 batches of macadamia honey, which can be determined to be macadamia honey. The primer-probe combination of the present invention has good specificity and sensitivity, and can be widely used in the identification of macadamia honey. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 This is a real-time fluorescence PCR test result of 14 kinds of macadamia honey [logarithmic (log) amplification curve] 。

[0018] Figure 2 This is a diagram of the specificity experiment of the real-time fluorescence PCR detection method for macadamia nuts and multifloral honey.

[0019] Figure 3 This is a diagram of the specificity experiment of the real-time fluorescence PCR detection method for macadamia nut and litchi honey.

[0020] Figure 4 This is a diagram showing the specificity of the real-time fluorescence PCR detection method for macadamia nuts and vitex honey.

[0021] Figure 5 This is a specific experimental diagram of the real-time fluorescence PCR detection method for macadamia nuts and sweet potato honey.

[0022] Figure 6 This is a diagram of the specificity experiment of the real-time fluorescence PCR detection method for macadamia nuts and acacia honey.

[0023] Figure 7 This is a diagram of the specificity experiment of the real-time fluorescence PCR detection method for macadamia nuts and lime honey.

[0024] Figure 8 This is a diagram of the specificity experiment of the real-time fluorescence PCR detection method for macadamia nuts and rapeseed honey.

[0025] Fig. 9 This is a specific experimental diagram of the real-time fluorescence PCR detection method for macadamia nut and jujube flower honey.

[0026] Fig.10 This is a sensitivity experiment diagram of the real-time fluorescence PCR detection method for macadamia nut ingredients (1 is the DNA of macadamia nut; 2-5 are the DNA of macadamia nut samples diluted 10, 100, 1000, and 10000 times with ultrapure water, respectively).

[0027] Fig.11 This is a diagram showing the identification effect experiment of commercially available macadamia honey. DETAILED DESCRIPTION

[0028] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0029] Example 1

[0030] 1. Design of specific primers for real-time fluorescence PCR detection method

[0031] Download the macadamia MADS-box gene sequence (SEQ ID NO: 4) from GenBank and design specific primers and probes for fluorescent PCR to identify macadamia components. The MADS-box gene sequence, primers and probes are as follows:

[0032] Macadamia integrifolia MADS-box protein(MADS-box)mRNA,complete cds:

[0033] ATGGGAAGAGGTCCGGTTCAGCTGAGGCGGATCGATAACAAGATCAATCGTCAAGTGACGTTCTCGAAACGAAGGGCGGGATTACTGAAAAAAGCTCACGAGATCTCAGTTCTCTGCGATGCCGAAGTCGCCTTAATCGTC TTCAACGCCAAAGGCAAGCTCTTCGAGTACTCCACCGATTCCTGCATGGATAGGATCCTTGAAAGATACGAGCAGTATTCTTATGCCGAGCGACAGCTTGTGCAATCTGATCACGAATCACAGCCTTTGAGGTCATTAGAATACACTAAATTAAAGTCCAAGGTTGATATTCTACAGAAAAACCAAAGGCACTACATGGGGCAAGATCTTGAGTCCTTGAGTATCAAAGAACTCCAAAATTTAGAGCAACAGCTTGATACTGCTCTTAAGCATATACGAACAAGAAAGTATCAGCTTATGTATGATTCCATATCCGAACTACAGAAAAAGGAGAAAGCGTTGCAGGAGCAAAATAACCAGCTCATGAAGAAGGAGTTCCTCTTCCTCTTCCATGTTGCCCAACAGGGGCATTTGGTGCCGCAGAGTGAGGGCCAGAACTCACCTCCCTTCATGCTTTCACAGCCACTTTCTTCCCTCAACGTACCTGGAAGTTACCAGGAGAGAGGCACAGGATGTGGGGAGGAAGGAGGTAGAAGGCAAGCCCGGACTAATAATCCCATCCCAACTTGGATGCTGTCACGGGAATGA(SEQ ID NO:4).

[0034] The upstream primer sequence is: 5'-AAGGGCGGGATTACTGAAA-3' (SEQ ID NO:1);

[0035] The downstream primer sequence is: 5'-GCAGGAATCGGTGGAGTA-3' (SEQ ID NO:2);

[0036] The probe sequence is: 5'(FAM)-ATCTCAGTTCTCTGCGATGCCGAAGTC-3'(TAMRA) (SEQ ID NO:3).

[0037] 2. DNA Extraction

[0038] (1) DNA extraction from macadamia tissue

[0039] Weigh an appropriate amount of macadamia leaves, chop them into pieces, put them into a mortar, add liquid nitrogen and grind them into powder, transfer them into a 2 mL centrifuge tube, and use a commercial kit (centrifuge column type) to complete the subsequent DNA extraction. The extracted DNA was measured by UV spectrophotometer, and its OD 260 / OD 280 The value is 2.03 and the concentration is 62.7ng / μL.

[0040] (2) Extraction of plant-derived DNA from honey

[0041] Take 20 mL of honey sample, add sterile water to 45 mL, mix well, centrifuge at 6000 rpm for 10 min, discard the supernatant, and repeat the above operation once.

[0042] Transfer the precipitate to a 2mL centrifuge tube, add 600μL of CTAB extract, 1 steel bead with a diameter of 5mm, small glass beads with a diameter of 0.5mm (about 1mL), 10μL of mercaptoethanol, and 20μL of snail enzyme, put it in an oscillator, oscillate for 20min, and then place it on a constant temperature mixer at 65℃ and 650rpm for 1h. Add 800μL of chloroform, shake it thoroughly to mix, and centrifuge it at 12000rpm for 10min.

[0043] Transfer the supernatant to a new 1.5mL centrifuge tube, add 2 times the volume of CTAB precipitation solution, shake and mix, and let stand at room temperature for 1h. Then centrifuge at 12000rpm for 10min, discard the supernatant, add 400μL sodium chloride aqueous solution to dissolve the precipitate, and then add 400μL chloroform to shake and mix. Centrifuge at 12000rpm for 10min, transfer the supernatant to a new 1.5mL centrifuge tube, add 0.8 volume of isopropanol, and let stand at 4℃ for more than 40min. Centrifuge at 12000rpm for 10min, discard the supernatant, wash the precipitate twice with 70% ethanol, discard the supernatant, dry at room temperature, and add 50μL water to dissolve.

[0044] The purity and concentration of the extracted genomic DNA were determined by UV spectrophotometer. 260 / OD 280 The value is between 1.85 and 2.00, and the DNA purity is high and meets the requirements of PCR amplification. The above method is an optimized and improved CTAB method, which is mainly used for the extraction of pollen DNA in honey. It can effectively improve the purity and concentration of the obtained DNA and keep the DNA fragments intact. High-quality DNA templates are the basis of PCR detection, so the above improved DNA extraction method plays an important role in the sensitivity of subsequent PCR detection.

[0045] 3. Fluorescence PCR detection of macadamia nut ingredients

[0046] PCR amplification was performed using the specific primers and probes designed above and the DNA genome extracted above as a template.

[0047] The real-time fluorescence PCR system is a 25 μL system, including 10 μL MasterMix (ThermoFisher Scientific) (containing dNTP, Mg 2+ , Taq enzyme), 1 μL each of the designed upstream primer and downstream primer (final concentration 0.2 μM), 1 μL of probe (final concentration 0.2 μM), 2 μL of extracted honey sample DNA, and 10 μL of pure water;

[0048] The reaction procedure of real-time fluorescence PCR was as follows: pre-denaturation at 95°C for 10 min; 95°C for 15 s, 57°C for 1 min, and 45 cycles;

[0049] The fluorescence quantitative PCR instrument (Thermo Fisher Scientific QuantStudio 7) was used with the software provided to set the reaction parameters. After the reaction, the experimental results were analyzed using the software provided to the instrument.

[0050] Example 2

[0051] Using the primer probe and detection method of Example 1, 14 batches of macadamia honey collected from different locations from February 26, 2020 to March 9, 2024 were tested (see Table 1 for macadamia honey information), with water as the negative control, and the amplification system and amplification procedure of real-time fluorescence PCR were the same as in Example 1. After real-time fluorescence PCR amplification, all 14 batches of samples showed positive amplification curves, with Ct values ​​between 27 and 35, no amplification in the negative control, and a typical positive amplification curve in the positive control (macadamia leaf DNA). The test results are shown in Table 1. Figure 1 The results showed that macadamia ingredients were detected in all 14 batches of macadamia honey, which met the determination criteria of this example and could be determined to be macadamia honey.

[0052] Table 1 Information on collected macadamia honey

[0053]

[0054] Example 3

[0055] 1. Validation of primer and probe specificity

[0056] Using the above-mentioned specific primers and probes, macadamia leaf DNA was used as a positive control, and DNA extracted from 3 kinds of flower honeys, 4 kinds of litchi honeys, 4 kinds of vitex honeys, 5 kinds of acacia honeys, 5 kinds of jujube flower honeys, 5 kinds of rape flower honeys, 5 kinds of linden honeys and 5 kinds of vetch honeys were used as templates to perform real-time fluorescent PCR. The amplification system and amplification procedure of real-time fluorescent PCR were the same as those in Example 1. The specificity of the primers and probes was verified. The test results are as follows: Figures 2 to 9 .Depend on Figures 2 to 9 It can be seen that no positive amplification curve was observed for honeys of 8 categories and 36 different sources (honey information is shown in Table 2), indicating that the primers and probes designed in the present invention have good specificity.

[0057] Table 2 Information of collected honey

[0058]

[0059]

[0060] 2. Sensitivity Verification of Primers and Probes

[0061] The DNA of macadamia nuts was diluted 10-fold with ultrapure water, and a total of 5 dilution gradients were obtained to obtain a DNA stock solution concentration of 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 A total of 5 concentrations of DNA dilution were prepared, and real-time fluorescence PCR detection was performed using the original DNA solution and the DNA dilution as templates. The results are as follows Fig.10 . Fig.10 In the figure, 1 is the original DNA template solution of macadamia nuts; 2 to 5 are the DNA of macadamia nut samples diluted 10 times with ultrapure water. Fig.10 It can be clearly seen that the detection limit can reach 10 -4 DNA concentration of macadamia samples (10 -5 There is no amplification curve), so the minimum detection limit of this primer and probe for macadamia components is 6.27ng / mL.

[0062] Example 3

[0063] Six different brands of commercially available macadamia honey (information of commercially available honey is shown in Table 3) were selected, and the macadamia components were detected by using the primer probes designed by the present invention and the established DNA extraction method. The six different brands of honey were numbered MH1-MH6, and the reaction procedure and reaction system of real-time fluorescence PCR amplification were the same as those in Example 1.

[0064] Table 3 6 different brands of honey

[0065]

[0066]

[0067] The results of real-time fluorescence PCR amplification are shown in Fig.11 As can be seen from the figure, macadamia ingredients were detected in all six types of macadamia honey on the market, which meets the determination criteria of this embodiment and can be determined to be macadamia honey.

[0068] From the above examples, it can be seen that the present invention provides a primer-probe combination, a kit and a detection method for identifying macadamia honey. The primer-probe combination of the present invention can realize the simple and rapid identification of macadamia honey, and has good specificity and sensitivity, and can be widely used in the identification of macadamia honey.

[0069] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A primer-probe combination for identifying macadamia honey, characterized in that: It comprises an upstream primer, a downstream primer and a probe; the sequence of the upstream primer is shown in SEQ ID NO:1, the sequence of the downstream primer is shown in SEQ ID NO:2, and the sequence of the probe is shown in SEQ ID NO:

3.

2. Use of the primer-probe combination of claim 1 in identifying macadamia honey.

3. Use of the primer-probe combination according to claim 1 in preparing a kit for identifying macadamia honey.

4. A kit for identifying macadamia honey, characterized in that: The invention comprises the primer-probe combination according to claim 1.

5. A method for identifying macadamia honey, characterized in that: The steps include: (1) Extract DNA from macadamia honey samples; (2) Using the DNA in the Australian bee nut honey sample as a template, the primer-probe combination of claim 1 is used to perform real-time fluorescent PCR. If a positive amplification curve can be amplified, it can be determined to be Australian bee nut honey.

6. The method according to claim 5, characterized in that The reaction procedure of the real-time fluorescent PCR is: pre-denaturation at 95°C for 10 min; 95°C for 15 s, 57°C for 1 min, and 45 cycles.

7. The method according to claim 5, characterized in that The steps for extracting DNA from macadamia honey samples are as follows: take 18-22 mL of honey sample and add sterile water to 40-50 mL, centrifuge and discard the supernatant, mix the precipitate with 580-620 μL CTAB extract solution was mixed; steel beads and glass beads, 8-12 μL of mercaptoethanol, and 18-22 μL of snail enzyme were added, and the mixture was oscillated and crushed, and then incubated at 63-67°C for 55-65 min; 780-820 μL of chloroform was added, and the mixture was centrifuged after mixing, and the supernatant was taken, and 1.5-2.5 times the volume of CTAB precipitation solution was added, and the mixture was oscillated and mixed, and the mixture was allowed to stand at room temperature for 1 h, and the supernatant was discarded after centrifugation, and 380-420 μL of sodium chloride aqueous solution was added to dissolve the precipitate, and then 380-420 μL of chloroform was added to oscillate and mix, and the supernatant was taken after centrifugation, and 0.7-0.9 volumes of isopropanol were added, and the mixture was allowed to stand at 3-5°C for 35-45 min, and the supernatant was discarded after centrifugation, and the precipitate was washed 2-3 times with 68-72% ethanol, and the supernatant was discarded, and the precipitate was dried at room temperature, and the obtained precipitate was the extracted DNA.

8. The method according to claim 7, characterized in that The diameter of the steel bead is 5 mm, and the amount added is 1 bead; the diameter of the glass bead is 0.5 mm, and the amount added is 0.8-1.2 mL.

Images