Molecular marker combination and primer for identifying new cauliflower mosaic virus and application of molecular marker combination and primer

Abstract

The invention discloses a molecular marker combination for identifying a new cauliflower mosaic virus, a primer and application of the molecular marker combination and the primer, and belongs to the technical field of plant virus detection. According to the invention, two types of novel cauliflower mosaic viruses LaCA and LaCB capable of infecting lilies to cause the lilies to be pathogenic are found, and the genomic sequences of the novel cauliflower mosaic viruses LaCA and LaCB are respectively shown as SEQ ID NO.1 and SEQ ID NO.2. The invention designs a molecular marker combination capable of rapidly identifying the two viruses in plants such as lily and the like, and the molecular marker combination comprises molecular markers with sequences as shown in SEQ ID NO.3-8. The two new viruses can be efficiently identified at low cost, technical support is provided for virus prevention and control of plants such as lily, spreading and diffusion of the two viruses are reduced to the maximum extent, and healthy and efficient development of the lily industry is further promoted.

Description

Technical Field

[0001] The invention belongs to the technical field of plant virus detection, and in particular relates to a molecular marker combination for identifying a new cauliflower mosaic virus, a primer and an application thereof. Background Art

[0002] Plant virus diseases have caused significant losses to rice, tobacco, peppers and other crops worldwide. It is considered a cancer of plants and has caused serious global economic losses. According to statistics, the most serious plant viruses in the world include tobacco mosaic virus (TMV), tomato wilt virus (TSWV), tomato yellow leaf curl virus (TYLCV), cucumber mosaic virus (CMV), potato virus Y (PVY), etc. Tomato wilt virus (TSWV) is susceptible to infecting vegetables, ornamental plants and field crops. The virus can infect more than 35 plant families and 174 plant species; after the plant virus infects the plant, it will destroy the leaf tissue structure and replicate on a large scale, so that the division of plant cells is affected by the viral RNA, which in turn affects the normal morphology of mesophyll cells and causes mosaic phenomenon. Over time, the virus deeply invades the plant body, the leaf tissue gradually loses its normal function, and then necrotizes, a large area of ​​brown spots appears, the leaves curl and deform, and the edges bend inward. Once the plant shows the characteristics of tobacco mosaic disease, it is almost ineffective to treat it with drugs. Therefore, the current treatment of plant viruses is mainly prevention.

[0003] Lily is not only a plant for both medicine and food, but also one of the important cut flowers in the world. However, with the increasing area of ​​lily cultivation, high-density planting and long-term asexual reproduction have led to the continuous accumulation of viruses, and the harm of viral diseases to lilies has become increasingly serious, affecting the yield and quality of lilies, causing huge economic losses to the lily planting industry. However, people do not pay enough attention to the harm of lilies by viruses, and there are very few lily varieties that are resistant to viruses. The frequent introduction of lilies and the high frequency of import and export of fresh flowers have accelerated the spread of viruses. There are 14 known lily virus pathogens and 1 mycoplasma. Among them, there are 4 serious viruses, namely Lily symptomless virus (LSV), Cucumber mosaic virus (CMV), Tulip breaking virus (TBV, also known as Lily mottle virus, LMoV) and Lily rosette virus (LRV). Other viruses occur in local areas. Lily viruses often infect in combination. Different viruses show similar symptoms on lilies, and the symptoms of the same virus under different conditions vary greatly. The most effective way to reduce the losses caused by viral diseases in lily planting and control the spread of viruses is to adopt virus-free culture and strengthen quarantine detection. However, it is difficult to establish a reliable and low-cost virus-free tissue culture system with existing technology. Strengthening virus detection has become extremely important at present, and it is also an important technical means to control the spread of lily viruses and reduce losses.

[0004] Among the current plant virus detection technologies, the biological detection method inoculates plant viruses on test plants and identifies the viruses based on the symptoms of the inoculated plants. This method is relatively simple to operate and does not require the use of other instruments, but it has problems such as a long identification cycle and the phenotype is easily disturbed. The electron microscope detection method (EM) can directly observe virus particles and is an intuitive, accurate, rapid and efficient virus detection technology, but it also has problems such as low detection rate. The enzyme-linked immunosorbent assay method can be used for large-scale detection with the advantages of rapid response, specificity, low detection limit and the most attractive cost-effectiveness, but it can only identify specific types of viruses and cannot detect unknown viruses. The molecular biology detection method uses PCR and other technologies to design specific identification primers for virus detection. This method can achieve high-throughput specific detection and is relatively low in cost. It is a better method. Real-time fluorescence quantitative PCR technology is similar to PCR detection technology, and its sensitivity is higher than that of PCR. It can preliminarily analyze the relative content of viruses, but the cost is relatively high. There is also loop-mediated isothermal amplification (LAMP) technology, where target DNA or RNA can be rapidly amplified in a heating block under isothermal conditions using four specific primers, and the loop primers can accelerate the reaction and shorten the amplification time. At the same time, due to the use of SYBR Green I, the virus detection results can be directly observed with the naked eye. The LAMP method has low sensitivity to inhibitors and isothermal characteristics, and can be deployed experimentally on site.

[0005] Lilies reproduce through underground bulbs, and virus transmission and viral diseases are serious. Injured underground scales are easily infected with other new viruses while reproducing. Timely detection, discovery and identification of viruses are extremely important for the prevention and control of lily viral diseases. Summary of the invention

[0006] The present invention utilizes high-throughput sequencing and analysis technology to isolate two new cauliflower mosaic viruses from Lilium lily suspected of being infected with the virus. After the two new viruses infect lilies, the lily leaves can turn yellow, obvious yellow stripes appear, the plant grows weakly, and the underground corms in the mature stage partially rot. According to the nucleic acid sequences of the two new cauliflower mosaic viruses, the present invention designs molecular markers that can quickly identify the two viruses in plants such as lilies. Based on this, the object of the present invention is to provide a molecular marker combination, primers and applications thereof for identifying new cauliflower mosaic viruses. The present invention can identify the two new viruses at low cost and efficiently, provide technical support for virus prevention and control of plants such as lilies, minimize the spread and diffusion of the two types of viruses, and help further promote the healthy and efficient development of the lily industry.

[0007] In order to achieve the above object, the present invention adopts the following technical solutions:

[0008] The two new cauliflower mosaic viruses discovered in the present invention are Lancifolium Caulimovirus A (LaCA) and Lancifolium Caulimovirus B (LaCB).

[0009] The genome size of LaCA virus is 7542 bp, and the sequence is shown in SEQ ID NO.1. Its genome map is shown in Figure 1 As shown in Figure 1, the virus has 4 open reading frames (ORFs), of which ORF1 encodes viral movement protein, ORF2 encodes viral capsid protein, ORF3 encodes viral reverse transcriptase, viral replication and mature polyprotein, etc., and ORF4 encodes proteins of unknown function. LaCA has 7 types of mutations. Taking LaCA as a reference, the sequence similarity of the remaining 6 mutant viruses (LacA2-7) with LaCA ranges from 99.59% to 99.73%. The specific sequence differences between them and LaCA are shown in Table 1. After LaCA virus infects lily, obvious yellow stripes appear on the leaves of lily, the plant grows weakly, and the underground corms in the mature stage partially rot. At the same time, the diameter and weight of the underground corms are significantly reduced compared with the control.

[0010] Table 1 Statistics of differences in LaCA virus nucleic acid sequences

[0011]

[0012] The genome size of LaCB virus is 7582 bp, and the sequence is shown in SEQ ID NO.2. Its genome map is shown in Figure 2 As shown in Figure 2, the virus has three ORFs, of which ORF1 encodes the virus movement protein; ORF2 encodes the virus capsid protein; the virus reverse transcriptase protein, virus replication and mature polyprotein, etc.; ORF3 encodes the membrane protein domain, and its specific function is still unknown. LaCB has 6 types of mutations. Taking LaCB as a reference, the sequence similarity of the other 5 mutant viruses (LacB2-6) with LaCB ranges from 98.51% to 98.91%. The specific sequence differences between them and LaCB are shown in Table 2-4. After the LaCB virus infects lily, the lily leaves turn yellow and obvious yellow stripes appear, the plant grows weakly, and the underground corms in the mature stage partially rot. At the same time, the diameter and weight of the underground corms are significantly reduced compared with the control.

[0013] Table 2 Statistics of differences in LaCB virus nucleic acid sequences

[0014]

[0015]

[0016] Table 3 Statistics of differences in LaCB virus nucleic acid sequences

[0017]

[0018]

[0019]

[0020] Table 4 Statistics of differences in LaCB virus nucleic acid sequences

[0021]

[0022] A molecular marker combination for simultaneously identifying LaCA and LaCB, comprising: LaCA-SP2 with a nucleotide sequence as shown in SEQ ID NO.3, LaCB-SP2 with a nucleotide sequence as shown in SEQ ID NO.4, LaCA-SP4 with a nucleotide sequence as shown in SEQ ID NO.5, and LaCB-SP4 with a nucleotide sequence as shown in SEQ ID NO.6. When using LaC-SP-F2 and LaC-SP-R2 primers for amplification, for LaCA virus, the nucleotide sequence amplified is LaCA-SP2 with a nucleotide sequence as shown in SEQ ID NO.3, and for LaCB virus, the nucleotide sequence amplified is LaCB-SP2 with a nucleotide sequence as shown in SEQ ID NO.4; when using LaC-SP-F4 and LaC-SP-R4 primers for amplification, for LaCA virus, the nucleotide sequence amplified is LaCA-SP4 with a nucleotide sequence as shown in SEQ ID NO.5, and for LaCB virus, the nucleotide sequence amplified is LaCB-SP4 with a nucleotide sequence as shown in SEQ ID NO.6.

[0023] A primer for amplifying the above-mentioned molecular marker combination for simultaneously identifying LaCA and LaCB includes the following sequences: LaC-SP-F2, LaC-SP-R2, LaC-SP-F4, LaC-SP-R4:

[0024] LaC-SP-F2: ACGATGTCCTACTCTAACTC,

[0025] LaC-SP-R2:GCATAGTGGCCTAATTTACCAC;

[0026] LaC-SP-F4: CTAGCAAAATGATAAAGAAAATATAGAAG,

[0027] LaC-SP-R4: CTCTGAGGGAGGTTTAAGTG.

[0028] A kit for simultaneously identifying LaCA and LaCB (including the above-mentioned variant viruses of LaCA and LaCB), comprising: LaC-SP-F2, LaC-SP-R2, LaC-SP-F4, LaC-SP-R4.

[0029] A method for simultaneously identifying LaCA and LaCB (including the above-mentioned variant viruses of LaCA and LaCB), comprising the following steps: extracting DNA of a sample to be tested, using LaC-SP-F2 / R2 and LaC-SP-F4 / R4 for PCR amplification, and detecting the amplified product by agarose gel electrophoresis. For the same sample to be tested, the ability to amplify bands of 519bp or 513bp and 269bp in sequence indicates that the sample contains LaCA or LaCB type viruses. Agarose gel electrophoresis cannot determine the specific size of the bands and cannot distinguish the difference between the 519bp and 513bp bands. Therefore, the identification method determines that as long as a band of about 519bp or 269bp can be amplified, the virus LaCA or LaCB (including the above-mentioned variant viruses of LaCA and LaCB) is contained.

[0030] A molecular marker combination for identifying LaCA (including the above-mentioned variant virus of LaCA), comprising: LaCA-SP with a nucleotide sequence as shown in SEQ ID NO.7, LaCA-SP2 with a nucleotide sequence as shown in SEQ ID NO.3, and LaCA-SP4 with a nucleotide sequence as shown in SEQ ID NO.5. The primers for amplifying the molecular marker LaCA-SP are:

[0031] LaCA-SP-F: TGGAGCATCCCTTTCTTTAG,

[0032] LaCA-SP-R:GAGGCGGAAGCTATCAAAC.

[0033] A kit for identifying LaCA (including the above-mentioned variant virus of LaCA), comprising primers LaC-SP-F2 / R2, LaC-SP-F4 / R4 and LaCA-SP-F / R.

[0034] A method for identifying LaCA (including the above-mentioned variant virus of LaCA), comprising the following steps: extracting DNA of a sample to be tested, performing PCR amplification on the sample using LaC-SP-F2 / R2, LaC-SP-F4 / R4, and LaCA-SP-F / R, and performing agarose gel electrophoresis detection on the amplified product, and bands of 519 bp, 269 bp, and 342 bp can be amplified in turn, indicating that the sample contains LaCA type virus.

[0035] A molecular marker combination for identifying LaCB (including the above-mentioned variant virus of LaCB), comprising: LaCB-SP with a nucleotide sequence as shown in SEQ ID NO.8, LaCB-SP2 with a nucleotide sequence as shown in SEQ ID NO.4, and LaCB-SP4 with a nucleotide sequence as shown in SEQ ID NO.6. The primers for amplifying the molecular marker LaCB-SP are:

[0036] LaCB-SP-F:AGGCAGCATCAAGCCATAATG,

[0037] LaCB-SP-R:CTCCATGAGTCATTGAGTTTGG.

[0038] A kit for identifying LaCB (including the above-mentioned variant virus of LaCB), comprising primers LaC-SP-F2 / R2, LaC-SP-F4 / R4 and LaCB-SP-F / R.

[0039] A method for identifying LaCB (including the above-mentioned variant virus of LaCB), comprising the following steps: extracting DNA of a sample to be tested, performing PCR amplification on the sample using LaC-SP-F2 / R2, LaC-SP-F4 / R4 and LaCB-SP-F / R, and performing agarose gel electrophoresis detection on the amplified product, and bands of 513 bp, 269 bp and 203 bp can be amplified in turn, indicating that the sample contains LaCB type virus.

[0040] Application of the above molecular markers or primers in identifying LaCA and / or LaCB (including the above mutant viruses of LaCA and LaCB).

[0041] Compared with the prior art, the present invention has the following advantages and beneficial effects: the present invention first discovered two new lily cauliflower mosaic viruses, and first disclosed the sequences of the two viruses and the identification molecular markers and amplification primers of the two types of viruses. Through high-throughput sequencing and Sanger sequencing, the existence of the two cauliflower mosaic viruses and their nucleic acid sequences were confirmed, and the variant subspecies of LaCA and LaCB were determined by splicing and comparing a large number of sequencing results. For these virus sequences, molecular markers and amplification primers (LaC-SP-F2 / R2, LaC-SP-F4 / R4) that can simultaneously identify LaCA and LaCB and molecular markers and amplification primers (LaCA-SP-F / R, LaCB-SP-F / R) that can identify LaCA and LaCB separately were designed. The sequences amplified by the molecular marker amplification primers were not matched to similar sequences in the NCBI database, indicating that the amplification results were unique. In addition, the products amplified by the molecular marker amplification primers had clear agarose gel electrophoresis bands, which can be used for the rapid identification of such viruses. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 This is the viral map of LaCA.

[0043] Figure 2 This is the viral map of LaCB.

[0044] Figure 3 The agarose gel electrophoresis results of the products obtained by PCR amplification of the extracted lily DNA using the molecular marker amplification primers designed by the present invention. M: Marker DL2000; 1: LaC-SP-F2 / R2 amplification product, 2: unsusceptible lily control; 3: LaC-SP-F4 / R4 amplification product, 4: unsusceptible lily control; 5: LaCA-SP-F / R amplification product, 6: unsusceptible lily control; 7: LaCB-SP-F / R amplification product, 8: unsusceptible lily control; 9: LaC-SP-F2 / R2 amplification product, 10: LaC-SP-F4 / R4 amplification product; 11: LaC-SP-F2 / R2 amplification product, 12: LaC-SP-F4 / R4 amplification product, 13: LaCA-SP-F / R amplification product; 14: LaC-SP-F2 / R2 amplification product, 15: LaC-SP-F4 / R4 amplification product, 16: LaCB-SP-F / R amplification product; Among them, lanes 9 and 10 are marker combination one, lanes 11-13 are marker combination two, and lanes 14-16 are marker combination three.

[0045] Figure 4The present invention discloses the field phenotype of susceptible lilies and the result of PCR amplification using the molecular marker amplification primers designed by the present invention. A: Field status and disease phenotype of susceptible lilies; B: Field status and disease phenotype of susceptible lilies (Shuanghe-01); C: Diagram of underground bulbs of control (Shuanghe-04) and susceptible lilies (Shuanghe-03, Shuanghe-02, Shuanghe-01); D: Susceptibility identification of materials in Shuanghe area using four molecular marker amplification primers (M: DL2000, 1, 5, 9, 13 are LaC-SP-F2 / R2 amplification products, 2, 6, 10, 14 are LaC-SP-F4 / R4 amplification products, 3, 7, 11, 15 are LaCA-SP-F / R amplification products, 4, 8, 12, 16 are LaCB-SP-F / R amplification products); E: Statistical analysis of underground bulb phenotypes of control (Shuanghe-04) and susceptible lilies (Shuanghe-03, Shuanghe-02, Shuanghe-01). DETAILED DESCRIPTION

[0046] The present invention collects suspected virus-infected tissues such as leaves and buds of Lilium lily from Enshi, Ezhou, Jiangxia and other places in Hubei. All the collected tissues are mixed and ground, and DNA of the mixed sample is extracted. Two new cauliflower mosaic viruses are preliminarily identified through high-throughput sequencing, lily genome removal, splicing and assembly annotation of the remaining sequences, etc. Primers are designed according to the assembled viral reference sequence, the target segment is amplified and Sanger sequencing is performed, and the sequences are further spliced ​​and assembled after being obtained, and finally two new lily cauliflower mosaic virus nucleic acid sequences are obtained, which are named LancifoliumCaulimovirus A (LaCA) and LancifoliumCaulimovirus A (LaCB) respectively. Through sequence analysis in the mixed sample, LaCA has 7 kinds of minor sequence variations, and LaCA has 6 kinds of minor sequence variations. Through sequence comparison analysis of LaCA and LaCB, the present invention designs molecular markers and corresponding amplification primers (LaC-SP-F2 / R2, LaC-SP-F4 / R4) that can simultaneously identify LaCA and LaCB, as well as molecular markers and corresponding amplification primers (LaCA-SP-F / R, LaCB-SP-F / R) that can identify LaCA and LaCB separately. These molecular markers can be used for rapid and high-throughput identification of these two types of new viruses, providing technical support for the subsequent breeding and detoxification of lily bulbs and the prevention and control of lily viruses.

[0047] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. The methods used in the following examples, unless otherwise specified, are conventional methods in the art; the reagents or materials used, unless otherwise specified, are from commercial sources.

[0048] Example 1: Extraction of viral nucleic acid, detection, library construction and sequencing of DNA

[0049] (1) The sample of Lilium lily was ground with liquid nitrogen, and 100 mg of the powdered sample was taken for DNA extraction using the CTAB method.

[0050] (2) DNA sample quality detection: NanoDrop spectrophotometer was used to detect sample purity, Qubit4.0 was used to detect DNA sample concentration, and agarose electrophoresis was used to detect whether the DNA sample was degraded and had impurities (gel concentration 1%, voltage 120 V, time 45 min).

[0051] (2) Preparation of DNA small fragment library After the sample is qualified, 0.5 μg gDNA template is taken from each sample and the library is prepared according to the method and process of VAHTS Universal DNA Library Prep Kit for Illumina V3. According to the instructions of VAHTS Universal DNA Library Prep Kit for Illumina V3, the DNA samples that have passed the test are fragmented using Bioruptor Pico, and the fragmented DNA is screened using magnetic beads; then the end repair and linker addition are performed, and the magnetic beads are used for purification, the target fragments are enriched by PCR, and the product quality control is performed. After the quality control is qualified, the subsequent library construction is carried out.

[0052] (3) The database construction process is as follows

[0053] 1) DNB preparation After the double-stranded PCR library is purified, it is melted and then circularized to form single-stranded circular DNA (Singlestranded Circular DNA). Then, DNA nanoballs (DNBs) are formed using rolling circle amplification (RCA) technology, and then the DNBs are loaded into the chip and fixed using a fully automatic sample loading system.

[0054] 2) Sequencing: Sequencing was performed on the DNB SEQ-T7 platform using relevant sequencing reagents, and the double-end sequencing program was run to obtain 150 bp double-end sequencing reads.

[0055] Example 2: Assembly and annotation of viral genomic DNA

[0056] (1) Sequencing data quality control

[0057] After the samples are sequenced on the machine, image files are obtained, which are converted by the software provided by the sequencing platform to generate fastq raw data (RawData), i.e., offline data. Fastp (v0.21.0) is used to further filter the sequencing data. The data filtering criteria mainly include: 1) removing sequences with adapters at the 3' end; 2) removing reads with an average quality score lower than Q20; 3) removing reads containing N.

[0058] (2) Species annotation based on reads

[0059] Kraken2 was used to remove the lily genome sequence from the quality-controlled data and perform species annotation.

[0060] (3) Genome assembly

[0061] Spade was used to assemble, correct and optimize the quality-controlled data (excluding the lily genome) to obtain the final genome.

[0062] (4) Virus Annotation and Evaluation

[0063] Use tRNAscan-SE to predict eukaryotic tRNAs for the assembled genome; use barrnap to predict rRNAs for bacteria and archaea for the assembled genome; use infernal to compare and annotate the assembled genome with Rfam data; use python scripts to integrate the prediction and annotation results of the three software to obtain the ncRNA annotation results of the gene. According to the ncRNA annotation results, sequences that may come from bacteria, archaea and eukaryotes in the genome are removed, and possible viral sequences are retained. Use cd-hit to cluster possible viral sequences and obtain non-redundant sequences. VirSorter2, DeepVirFinder, VIBRANT, VirFinder and VirBot software are used to predict viral sequences for non-redundant sequences.

[0064] (5) Annotation and evaluation of viral sequences

[0065] The predicted viruses were classified using geNomad software, and the predicted viruses were compared with IMG_VR data and NCBI's virus database for verification and species annotation using mmseqs2. The virus sequences were evaluated for integrity using checkV, and the relevant results were integrated using a python script to retain the sequences predicted and annotated as viruses.

[0066] Example 3: Cloning, sequencing and annotation of viral DNA sequences

[0067] Virus segment amplification primers were designed for PCR amplification based on the virus reference sequence provided in Example 2. The primers and sequences used for segment amplification are shown in Table 5.

[0068] Table 5 Summary of primers for viral sequence amplification

[0069]

[0070]

[0071] PCR amplification conditions are as follows:

[0072] The 20μL PCR reaction system is as follows: ddH2O 15.4μL, 10×PCR Buffer 2μL, dNTP (2.5mmol / L) 1.0μL, primer F (20nmol / L) 0.2μL, primer R (20nmol / L) 0.2μL, template DNA (10-20ng / μL) 1μL, rTaq polymerase (1U / μL) 0.2μL.

[0073] The PCR amplification reaction procedure is as follows: 94℃ pre-denaturation for 2min; 94℃ denaturation for 30s, 59℃ (adjusted according to specific primers) annealing for 30s, 72℃ annealing extension for 1min (adjusted time according to fragment length, about 1min amplification of 1kb), 34 cycles; 72℃ extension for 10min, 4℃ storage for later use. Then the above PCR products were Sanger sequenced. For PCR products with double peaks or variations, they were cloned into T vectors to screen positive clones for sequencing. The specific steps were carried out according to the TA cloning instructions (6028Takara). The sequenced fragments were spliced ​​to obtain the full-length sequence of the virus. The sequences of LaCA and LaCB are shown in SEQ ID NO.1 and SEQ ID NO.2. In addition, according to the sequencing results, a small amount of sequence variation was found in both LaCA and LaCB in the lily mixed sample. There are 7 sequence variations in LaCA and 6 sequence variations in LaCB.

[0074] Use ORF Finder ( https: / / www.ncbi.nlm.nih.gov / orffinder / ) to search for open reading frames in the genome sequences of these viruses. Then InterPro( https: / / www.ebi.ac.uk / interpro / search / sequence / ) was used to predict the conservative structure of ORF. The above prediction results were summarized and the viral map diagram of LaCA and LaCB was constructed using SnapGene Viewer software (see Figure 2). Figure 1 and Figure 2 ).

[0075] Example 4: Development of molecular markers for virus identification

[0076] The LaC viroid sequences provided in Example 3 were sequenced using Clustal Omega ( https: / / www.ebi.ac.uk / jdispatcher / msa / clustalo) Sequence comparison of 7 LacA and 6 LacB viruses revealed that the sequence similarities of the 7 LaCAs ranged from 99.59% to 99.73%, and the sequence similarities between LaCBs ranged from 98.51% to 98.91%, indicating that the variation of LaCA and LaCB viruses was very small. The specific sequence differences are shown in Tables 1-4 above. Therefore, they were merged into 2 new viruses, named LaCA and LaCB, respectively. Molecular marker combinations and corresponding amplification primers (LaC-SP-F2 / R2, LaC-SP-F4 / R4) that can simultaneously detect these two types of viruses were designed based on their sequence information. The target band sizes were 519 bp (SEQ ID NO.3) or 513 bp (SEQ ID NO.4), 269 bp (SEQ ID NO.5 or SEQ ID NO.6), respectively. In addition, the amplified target sequence was compared for sequence similarity in the NCBI database (https: / / blast.ncbi.nlm.nih.gov / Blast.), and the results showed that no similar sequences were matched. Therefore, it can be explained that the molecular marker is a specific detection marker for these two types of viruses. On this basis, based on the sequence comparison results of 7 types of LacA, a molecular marker that can simultaneously identify 7 types of LaCA and the corresponding amplification primers LaCA-SP-F / R were designed according to the conserved sequence of LacA. The size of the PCR amplification product is: 342bp (SEQ ID NO.7). In addition, the same method was used to design a molecular marker that can simultaneously identify 6 types of LacB viruses and the corresponding amplification primers LaCB-SP-F / R. The size of the PCR amplification product is: 203bp (SEQ ID NO.8). The above molecular marker amplification primers were used to amplify the extracted Lilium lily DNA respectively, and the amplification method and system were carried out according to the method in Example 4. The amplification results are shown in the figure. Figure 3 As shown, the results show that the molecular marker amplification primers designed above can accurately identify the target virus and can be used for subsequent corresponding virus identification. The sequences of the molecular marker amplification primers are shown in Table 6 below.

[0077] Table 6 Molecular marker amplification primer sequences

[0078] Primer name Primer sequence (5'-3') LaCB-SP-F AGGCAGCATCAAGCCATAATG LaCB-SP-R CTCCATGAGTCATTGAGTTTGG LaC-SP-F4 CTAGCAAAATGATAAAGAAAATATAGAAG LaC-SP-R4 CTCTGAGGGAGGTTTAAGTG LaC-SP-F2 ACGATGTCCTACTCTAACTC LaC-SP-R2 GCATAGTGGCCTAATTTACCAC LaCA-SP-F TGGAGCATCCCTTTCTTTAG LaCA-SP-R GAGGCGGAAGCTATCAAAC

[0079] Example 5: Identification and phenotypic analysis of virus-infected plants

[0080] Using the molecular marker primers designed above, this example identified lily samples from the Shuanghe area of ​​Enshi. DNA was extracted from each sample leaf, and then the virus infection status of the extracted DNA was identified using an amplification system and method similar to that in Example 3. The identification results are shown in Figure 2. Figure 4 D, based on the above identification results, the phenotypes of these underground lily bulbs were analyzed, and the statistical results are as follows Figure 4 E shows the representative virus-infected leaf phenotypes. Figure 4 As shown in A and B. These results show that after LaCA and LaCB viruses infect lily plants, the leaves turn yellow and obvious yellow stripes appear on the leaves. The underground bulbs become significantly smaller and have scale dieback symptoms (such as Figure 4 C).

[0081] The above embodiments are only used to help illustrate the present invention. The implementation methods of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. An isolated cauliflower mosaic virus LaCA or LaCB, characterized in that: The genome sequence of the virus LaCA is as shown in SEQ ID NO.1, or has a similarity of more than 98% to the sequence shown in SEQ ID NO.1; The genome sequence of the virus LaCB is shown in SEQ ID NO.2, or has a similarity of more than 98% with the sequence shown in SEQ ID NO.

2.

2. A molecular marker combination for simultaneously identifying the viruses LaCA and LaCB described in claim 1, characterized in that: The molecular marker combination comprises: LaCA-SP2 with a nucleotide sequence as shown in SEQ ID NO.3, LaCB-SP2 with a nucleotide sequence as shown in SEQ ID NO.4, LaCA-SP4 with a nucleotide sequence as shown in SEQ ID NO.5, and LaCB-SP4 with a nucleotide sequence as shown in SEQ ID NO.

6.

3. A primer for amplifying the molecular marker combination according to claim 2, characterized in that: Contains: primers for amplifying LaCA-SP2 and LaCB-SP2, primers for amplifying LaCA-SP4 and LaCB-SP4; The primers for amplifying LaCA-SP2 and LaCB-SP2 are LaC-SP-F2 and LaC-SP-R2 of the primer pair shown below: LaC-SP-F2: ACGATGTCCTACTCTAACTC, LaC-SP-R2:GCATAGTGGCCTAATTTACCAC; The primers for amplifying LaCA-SP4 and LaCB-SP4 are the primer pair LaC-SP-F4 and LaC-SP-R4 with the following sequences: LaC-SP-F4: CTAGCAAAATGATAAAGAAAATATAGAAG, LaC-SP-R4: CTCTGAGGGAGGTTTAAGTG.

4. A molecular marker combination for identifying the virus LaCA described in claim 1, characterized in that: The molecular marker combination comprises: LaCA-SP2, LaCA-SP4 as described in claim 2 and LaCA-SP with a nucleotide sequence as shown in SEQ ID NO.

7.

5. A primer for amplifying the molecular marker combination according to claim 4, characterized in that: Contains: primers for amplifying LaCA-SP2, primers for amplifying LaCA-SP4, and primers for amplifying LaCA-SP; The primers for amplifying LaCA-SP2 are the primer pair LaC-SP-F2 and LaC-SP-R2 with the following sequences: LaC-SP-F2: ACGATGTCCTACTCTAACTC, LaC-SP-R2:GCATAGTGGCCTAATTTACCAC; The primers for amplifying LaCA-SP4 are the primer pair LaC-SP-F4 and LaC-SP-R4 with the following sequences: LaC-SP-F4: CTAGCAAAATGATAAAGAAAATATAGAAG, LaC-SP-R4: CTCTGAGGGAGGTTTAAGTG; The primers for amplifying LaCA-SP are the primer pair LaCA-SP-F and LaCA-SP-R with the following sequences: LaCA-SP-F: TGGAGCATCCCTTTCTTTAG, LaCA-SP-R:GAGGCGGAAGCTATCAAAC.

6. A molecular marker combination for identifying the virus LaCB described in claim 1, characterized in that: The molecular marker combination comprises: LaCB-SP2, LaCB-SP4 as described in claim 2 and LaCB-SP with a nucleotide sequence as shown in SEQ ID NO.

8.

7. A primer for amplifying the molecular marker combination according to claim 6, characterized in that: Contains: primers for amplifying LaCB-SP2, primers for amplifying LaCB-SP4, and primers for amplifying LaCB-SP; The primers for amplifying LaCB-SP2 are the primer pair LaC-SP-F2 and LaC-SP-R2 with the following sequences: LaC-SP-F2: ACGATGTCCTACTCTAACTC, LaC-SP-R2:GCATAGTGGCCTAATTTACCAC; The primers for amplifying LaCB-SP4 are the primer pair LaC-SP-F4 and LaC-SP-R4 with the following sequences: LaC-SP-F4: CTAGCAAAATGATAAAGAAAATATAGAAG, LaC-SP-R4: CTCTGAGGGAGGTTTAAGTG; The primers for amplifying LaCB-SP are the primer pair LaCB-SP-F and LaCB-SP-R with the following sequences: LaCB-SP-F:AGGCAGCATCAAGCCATAATG, LaCB-SP-R:CTCCATGAGTCATTGAGTTTGG.

8. Use of the molecular marker combination of claims 2, 4, 6 or at least one of the primers of claims 3, 5, 7 in identifying the virus LaCA and / or LaCB described in claim 1.

9. A kit for identifying the virus LaCA and / or LaCB described in claim 1, characterized in that: Contains at least one of the following primer pairs: LaC-SP-F2: ACGATGTCCTACTCTAACTC, LaC-SP-R2:GCATAGTGGCCTAATTTACCAC; LaC-SP-F4: CTAGCAAAATGATAAAGAAAATATAGAAG, LaC-SP-R4: CTCTGAGGGAGGTTTAAGTG; LaCA-SP-F: TGGAGCATCCCTTTCTTTAG, LaCA-SP-R:GAGGCGGAAGCTATCAAAC; LaCB-SP-F:AGGCAGCATCAAGCCATAATG, LaCB-SP-R:CTCCATGAGTCATTGAGTTTGG.

10. A method for identifying the virus LaCA and / or LaCB described in claim 1, characterized in that: The method for identifying the viruses LaCA and LaCB comprises the following steps: extracting DNA of a sample to be tested, performing PCR amplification using LaC-SP-F2 / R2 and LaC-SP-F4 / R4, and performing agarose gel electrophoresis on the amplified products, and amplifying bands of 519 bp or 513 bp and 269 bp respectively, indicating that the sample to be tested contains LaCA or LaCB virus; The method for identifying the virus LaCA comprises the following steps: extracting DNA of a sample to be tested, performing PCR amplification on the sample using LaC-SP-F2 / R2, LaC-SP-F4 / R4, and LaCA-SP-F / R, and performing agarose gel electrophoresis on the amplified product, and bands of 519 bp, 269 bp, and 342 bp can be amplified in sequence, indicating that the sample to be tested contains the LaCA virus; The method for identifying the virus LaCB comprises the following steps: extracting DNA of a sample to be tested, performing PCR amplification on the sample using LaC-SP-F2 / R2, LaC-SP-F4 / R4 and LaCB-SP-F / R, and performing agarose gel electrophoresis on the amplified product, and bands of 513 bp, 269 bp and 203 bp can be amplified in sequence, indicating that the sample to be tested contains the LaCB virus; The primer sequences are as follows: LaC-SP-F2: ACGATGTCCTACTCTAACTC, LaC-SP-R2:GCATAGTGGCCTAATTTACCAC; LaC-SP-F4: CTAGCAAAATGATAAAGAAAATATAGAAG, LaC-SP-R4: CTCTGAGGGAGGTTTAAGTG; LaCA-SP-F: TGGAGCATCCCTTTCTTTAG, LaCA-SP-R:GAGGCGGAAGCTATCAAAC; LaCB-SP-F:AGGCAGCATCAAGCCATAATG, LaCB-SP-R:CTCCATGAGTCATTGAGTTTGG.

Images