Microbial amplicon second-generation library building method and device

Abstract

The invention provides a second-generation library building method and device for microbial amplicons. The method comprises the following steps: carrying out PCR (Polymerase Chain Reaction) amplification on a sample DNA (Deoxyribonucleic Acid), a negative sample and a positive sample by utilizing a specific primer for identifying microorganisms to respectively obtain a first amplification product, a second amplification product and a third amplification product; performing library construction by utilizing the first amplification product, the second amplification product and the third amplification product to respectively obtain a first library, a second library and a third library; and sequencing the first library, the second library and the third library, and judging the construction quality of the first library by using the sequencing data of the second library and the third library to obtain the qualified microbial amplicon library. The negative sample and the positive sample are introduced in the construction process of the microbial amplicon library, whether the library construction quality of the to-be-detected sample is qualified or not is judged according to the sequencing results of the negative sample and the positive sample, and the accuracy of the sequencing data of the to-be-detected sample can be simply and conveniently obtained.

Description

Technical Field

[0001] The present invention relates to the technical field of library construction, and in particular to a method and device for second-generation microbial amplicon library construction. Background Art

[0002] There are two different technical solutions for the amplification and library construction and sequencing process of microbial amplicons. The first is to design universal degenerate base primers (with 6-8 base Barcord markers on the primers) for the conserved regions of ribosomal subunits of microorganisms (bacteria and fungi) (mainly 16S, 5S, 23S for bacteria; mainly 18S, 28S, 5S, 5.8S for fungi), amplify the target region (bacteria 16SV34, V4, V45, V57, 16S full length; fungi ITS1, ITS2, etc.), then repair the ends of the amplified products, add adapters (with 8-12 base index sequences) for library construction, and then sequence the library; the other technical route is to design a full-length amplification sequence (including index and Barcord sequences) for the above target region, and after the target fragment is amplified, use universal primers for secondary amplification.

[0003] However, the two current technical routes do not include the accuracy monitoring of the amplified target fragments, and there is no basis for monitoring the final data output of a series of processes such as amplification, library construction, and sequencing. Therefore, it is impossible to determine whether the quality of the constructed library meets the actual needs of theoretical research and analysis, and it is impossible to rule out whether the amplified products contain air pollution introduced during the experiment, human pollution, or contamination caused by bacteria and fungi in the reagents and consumables themselves, which may affect the quality of the library. Therefore, it is very important to introduce a standard process for monitoring the library construction products during the second-generation library construction and sequencing of microbial amplicons to further ensure that the second-generation library construction of microbial amplicons has a high quality. Summary of the invention

[0004] The main purpose of the present invention is to provide a method and device for building a second-generation library of microbial amplicons to solve the problem of lack of quality control in the process of building a second-generation library of microbial amplicons in the prior art.

[0005] To achieve the above-mentioned object, according to a first aspect of the present invention, a method for constructing a second-generation microbial amplicon library is provided, comprising: performing PCR amplification on sample DNA, negative samples and positive samples using primers for specific microbial identification to obtain a first amplification product, a second amplification product and a third amplification product, respectively; constructing a library using the first amplification product, the second amplification product and the third amplification product to obtain a first library, a second library and a third library, respectively; sequencing the first library, the second library and the third library, and judging the construction quality of the first library using the sequencing data of the second library and the third library to obtain a microbial amplicon library of qualified quality; wherein the negative sample is a Tris-HCl buffer; and the positive sample comprises one or more of Listeria monocytogenes, Pseudomonas aeruginosa, Bacillus subtilis, Saccharomyces cerevisiae, Escherichia coli, Salmonella enterica, Lactobacillusfermentum, Enterococcus faecalis, Cryptococcus neoformans or Staphylococcusaureus.

[0006] Further, judging the construction quality of the first library using the sequencing data of the second library and the third library includes: calculating the positive ratio using the following formula I; Among them, ASV is an amplicon sequence variant. When the raw reads of the third library are ≥50,000 and the positive ratio is ≥95%, and the raw reads of the second library are ≤1000, the construction quality of the first library is qualified.

[0007] Furthermore, PCR amplification was performed using Phusion high-fidelity DNA polymerase.

[0008] Furthermore, primers for specifically identifying microorganisms are shown in SEQ ID NOs: 1-14.

[0009] In order to achieve the above-mentioned object, according to a second aspect of the present invention, a device for building a second-generation microbial amplicon library is provided, comprising: a PCR amplification module, configured to perform PCR amplification on sample DNA, negative samples and positive samples using primers for specific microbial identification, to obtain a first amplification product, a second amplification product and a third amplification product respectively; a library construction module, configured to perform library construction using the first amplification product, the second amplification product and the third amplification product, to obtain a first library, a second library and a third library respectively; a sequencing and quality assessment module, configured to sequence the first library, the second library and the third library, and to judge the construction quality of the first library using the sequencing data of the second library and the third library, so as to obtain a microbial amplicon library of qualified quality; wherein the negative sample is a Tris-HCl buffer; the positive samples include Listeria monocytogenes, Pseudomonas aeruginosa, Bacillus subtilis, Saccharomyces cerevisiae, Escherichia coli, Salmonella enterica, Lactobacillus fermentum, Enterococcus faecalis, Cryptococcus neoformans or Staphylococcus aureus.

[0010] Further, the sequencing and quality assessment module includes: a calculation unit, configured to calculate the positive ratio using the following formula I; Wherein, ASV is an amplicon sequence variant; and the judgment unit is that when the raw reads of the third library are ≥50,000 and the positive ratio is ≥95%, and the raw reads of the second library are ≤1000, the construction quality of the first library is qualified.

[0011] Furthermore, PCR amplification was performed using Phusion high-fidelity DNA polymerase.

[0012] Furthermore, primers for specific identification of microorganisms are shown in SEQ ID NOs: 1-14.

[0013] In order to achieve the above object, according to a third aspect of the present invention, a computer-readable storage medium is provided, the storage medium including a stored program, wherein when the program is executed, the device where the storage medium is located is controlled to execute the above method.

[0014] In order to achieve the above objective, according to a fourth aspect of the present invention, a processor is provided, the processor being used to run a program, wherein the program runs the above method.

[0015] By applying the technical solution of the present invention, negative samples and positive samples are introduced into the process of constructing a microbial amplicon library, and the sequencing results of the negative samples and the positive samples are used to judge whether the construction quality of the library of the sample to be tested is qualified, so that the accuracy of the sequencing data of the sample to be tested can be obtained relatively simply, and the influence of contamination on the sequencing data in the links such as reagents and consumables used in the experiment, human operation, and cross-contamination between samples is eliminated, thereby providing a guarantee for the accuracy of further biological and / or clinical research and analysis using the library sequencing data of the sample to be tested. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] The drawings constituting a part of the present application are used to provide a further understanding of the present invention. The exemplary embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention. In the drawings:

[0017] Figure 1 A statistical graph showing the positive ratios of all samples in Example 1 is shown;

[0018] Figure 2 The figure shows the statistical graph of the raw read number of negative samples of all samples in Example 1. DETAILED DESCRIPTION

[0019] It should be noted that, in the absence of conflict, the embodiments and features in the embodiments of the present application can be combined with each other. The present invention will be described in detail below with reference to the accompanying drawings and in combination with the embodiments.

[0020] As mentioned in the background technology, when the second-generation microbial amplicon library is constructed in the prior art, since it is a commercial application scenario, no control monitoring is set to monitor the possible contamination caused during the library construction process, such as the possible introduction of air bacteria and fungi contamination during PCR amplification, contamination during human operation, the risk of contamination of reagents and consumables themselves during the amplification library construction process, and whether there is cross-contamination between samples. Therefore, it is impossible to clearly determine whether the results of sequencing the constructed library of the sample to be tested can be analyzed and studied to produce sufficiently objective and accurate results. This application intends to provide a method for constructing a microbial amplicon library that can judge the library quality of the sample to be tested.

[0021] In a first typical embodiment of the present application, a method for constructing a second-generation microbial amplicon library is provided, the method comprising: performing PCR amplification on sample DNA, negative samples and positive samples using primers that specifically identify microorganisms to obtain a first amplification product, a second amplification product and a third amplification product, respectively; using the first amplification product, the second amplification product and the third amplification product to construct a library to obtain a first library, a second library and a third library, respectively; sequencing the first library, the second library and the third library, and using the sequencing data of the second library and the third library to judge the construction quality of the first library, so as to obtain a microbial amplicon library of qualified quality; wherein the negative sample is a Tris-HCl buffer; and the positive sample comprises one or more of Listeria monocytogenes, Pseudomonas aeruginosa, Bacillus subtilis, Saccharomyces cerevisiae, Escherichia coli, Salmonella enterica, Lactobacillusfermentum, Enterococcus faecalis, Cryptococcus neoformans or Staphylococcusaureus.

[0022] In the process of constructing the library of the sample to be tested, negative samples and positive samples are introduced, and the library construction operation is carried out simultaneously with the sample to be tested. The sequencing data of the negative and positive samples are used to monitor whether the quality of the library of the sample to be tested is qualified. The quality of the library of the sample to be tested can be effectively evaluated to ensure the reliability of the sequencing data, and further ensure the accuracy of subsequent data analysis using the sequencing data, such as microbial ecology research, disease diagnosis, food hygiene testing, etc.

[0023] ASV (Amplicon Sequence Variant) data are reads produced after sequencing, and are reads that can be clustered together after the sequencing data is analyzed by QiIME2 software. In a preferred embodiment, the construction quality of the first library is determined using the sequencing data of the second library and the third library, including: calculating the positive ratio using the following formula I;

[0024]

[0025] Wherein, ASV is the amplicon sequence variant. When the raw reads of the third library are ≥50,000 and the positive ratio is ≥95%, and the raw reads of the second library are ≤1000, the construction quality of the first library is qualified. The ASV theoretical value and the ASV actual value are used to evaluate the library quality of the positive sample. When the positive ratio is ≥95% and the raw reads obtained are sufficient (≥50,000), it means that the library construction process does not cause operational contamination that can affect the quality of the library. Wherein, raw read(s) is the original sequencing data.

[0026] In most cases, negative samples are regarded as background values. Only when the background noise is extremely small can the sequencing results reflect the true species composition of the sample. In order to further determine whether the quality of the construction of the library of the sample to be tested is qualified, in a preferred embodiment, the judgment of the quality of the library construction using the sequencing data of the second library and the third library also includes: when the raw reads of the second library are ≤1000, the quality of the library construction is qualified. In negative samples, if the output ratio of raw reads is low, it indicates that the contamination of the library construction process is controllable.

[0027] To further improve the quality of library construction, in a preferred embodiment, Phusion high-fidelity DNA polymerase is used for PCR amplification. Preferably, the primers for specific identification of microorganisms are shown in SEQ ID NOs: 1-14. Among them, the primers for specific identification of microorganisms include primers for identifying bacterial 16SV34, V4, V45, V57, 16S full length, fungal ITS1, ITS2 and other regions.

[0028] In a preferred embodiment, the F primer for identifying bacteria 16SV34 is CCTAYGGGRBGCASCAG (SEQ ID NO: 1), and the R primer is GGACTACNNGGGTATCTAAT (SEQ ID NO: 2); wherein the F primer for identifying bacteria 16SV4 is GTGCCAGCMGCCGCGGTAA (SEQ ID NO: 3), and the R primer is GGACTACHVGGGTWTCTAAT (SEQ ID NO: 4); wherein the F primer for identifying bacteria 16SV45 is GTGCCAGCMGCCGCGGTAA (SEQ ID NO: 3), and the R primer is CCGTCAATTCCTTTGAGTTT (SEQ ID NO: 5); wherein the F primer for identifying bacteria 16SV57 is AACMGGATTAGATACCCKG (SEQ ID NO: 6), and the R primer is ACGTCATCCCCACCTTCC (SEQ ID NO: 7); wherein the F primer for identifying fungus ITS1-1F is ACGTCATCCCCACCTTCC (SEQ ID NO: 8); NO:8), and the R primer is GCTGCGTTCTTCATCGATGC (SEQ ID NO:9); wherein the F primer identifying fungal ITS1-5F is GGAAGTAAAAGTCGTAACAAGG (SEQ ID NO:10), and the R primer is GCTGCGTTCTTCATCGATGC (SEQ ID NO:9); wherein the F primer identifying fungal ITS2 is GCATCGATGAAGAACGCAGC (SEQ ID NO:11), and the R primer is TCCTCCGCTTATTGATATGC (SEQ ID NO:12); wherein the F primer identifying archaea V4 is CAGCCGCCGCGGTAA (SEQID NO:13), and the R primer is GTGCTCCCCCGCCAATTCCT (SEQ ID NO:14).

[0029] In a second typical embodiment of the present application, a device for building a second-generation microbial amplicon library is provided, comprising: a PCR amplification module, configured to perform PCR amplification on sample DNA, negative samples and positive samples using primers that specifically identify microorganisms, to obtain a first amplification product, a second amplification product and a third amplification product, respectively; a library construction module, configured to perform library construction using the first amplification product, the second amplification product and the third amplification product, to obtain a first library, a second library and a third library, respectively; a sequencing and quality assessment module, configured to sequence the first library, the second library and the third library, and to judge the construction quality of the first library using the sequencing data of the second library and the third library, so as to obtain a microbial amplicon library of qualified quality; wherein the negative sample is a Tris-HCl buffer; the positive samples include: Listeria monocytogenes, Pseudomonas aeruginosa, Bacillus subtilis, Saccharomyces cerevisiae, Escherichia coli, Salmonella enterica, Lactobacillus fermentum, Enterococcus faecalis, Cryptococcus neoformans or Staphylococcus aureus

[0030] Negative samples and positive samples are introduced into the PCR amplification module, and PCR amplification and subsequent library construction operations are carried out simultaneously with the samples to be tested. The sequencing data of negative samples and positive samples are used to monitor whether the library quality of the samples to be tested is qualified. The library quality of the samples to be tested can be effectively evaluated to ensure the reliability of the sequencing data, and further ensure the accuracy of subsequent data analysis using the sequencing data, such as microbial ecology research, disease diagnosis, food hygiene testing, etc.

[0031] In a preferred embodiment, the sequencing and quality assessment module includes: a positive sample judgment unit, which is configured to calculate the positive ratio using the following formula I;

[0032]

[0033] ASV is an amplicon sequence variant. When the raw reads of the third library are ≥50,000 and the positive ratio is ≥95%, and the raw reads of the second library are ≤1000, the construction quality of the first library is qualified. The ASV theoretical value and the ASV actual value are used to evaluate the library quality of the positive sample. When the positive ratio is ≥95% and the raw reads obtained are sufficient (≥50,000), it means that the library construction process does not cause operational contamination that can affect the quality of the library.

[0034] In most cases, negative samples are regarded as background values. Only when the background noise is extremely small can the sequencing results reflect the true species composition of the sample. In order to further determine whether the quality of the construction of the library of the sample to be tested is qualified, in a preferred embodiment, the sequencing module also includes: a negative sample judgment unit, which is set to be qualified when the raw reads of the second library are ≤1000.

[0035] To further improve the quality of library construction, in a preferred embodiment, Phusion high-fidelity DNA polymerase is used for PCR amplification. Preferably, the primers for specific identification of microorganisms are shown in SEQ ID NOs: 1-14. Among them, the primers for specific identification of microorganisms include primers for identifying bacterial 16SV34, V4, V45, V57, 16S full length, fungal ITS1, ITS2 and other regions.

[0036] In a third typical embodiment of the present application, a computer-readable storage medium is provided, the storage medium includes a stored program, wherein when the program is executed, the device where the storage medium is located is controlled to execute the above method.

[0037] In a fourth typical implementation of the present application, a processor is provided, and the processor is used to run a program, wherein the program runs the above method.

[0038] The present application is further described in detail below in conjunction with specific embodiments. These embodiments should not be construed as limiting the scope of protection claimed in the present application.

[0039] The negative sample used in the examples of the present application is Tris-HCl buffer, and the positive sample is the commercial genome Catalog No. D6311 of ZymoBIOMICS. The specific species composition and proportion are shown in Table 1 below. The primers F used are SEQ ID NOs: 1, 3, 6, 8, 10, 11, 13, and the primers R used are SEQ ID NOs: 2, 4, 5, 7, 9, 12, 14.

[0040] Table 1 Species composition ratio of positive samples

[0041]

[0042] Embodiment 1

[0043] 1. DNA extraction

[0044] DNA was extracted from 142 samples from different sources, including soil, ginseng rhizosphere soil, broiler feces, pig feces, human feces, chicken cecal chyme, mouse feces, cat feces, colonic chyme, sediment, dog feces, chicken ileum content, vole feces, wine dregs, sauerkraut fermentation, rat intestinal content, cow dung, plant roots, rhizosphere soil, tobacco roots, ginseng roots, ginseng stems, ginseng leaves, corn stalks, sauce-flavored distiller's grains mixture, alfalfa, dried radish, fermented grains, potato healthy rhizosphere soil, soybean roots, thistle plants and plant tissues. Targeted DNA extraction methods were used for different types of samples to obtain genomic DNA of the samples to be tested.

[0045] 2. PCR amplification

[0046] Phusion high-fidelity DNA polymerase was used to perform PCR amplification on the genomic DNA of the sample to be tested, the negative sample and the positive sample. The specific PCR amplification procedure is shown in Table 2-3 below:

[0047] Table 2:

[0048]

[0049]

[0050] Table 3:

[0051]

[0052] After PCR amplification, the amplified product was transferred to a 1.5 ml centrifuge tube, and 24 μl Beckman Agencourt AMPure XP nucleic acid purification magnetic beads were added for purification and recovery. The recovered amplified product was dissolved in 30 μl Elution buffer for standby use. The amplified product was quantitatively detected using the Thermo Fisher Qubit 3.0 instrument. Equal amounts were mixed according to the concentration of the PCR product, and after sufficient mixing, agarose gel electrophoresis was performed to recover the target bands of the first amplified product, the second amplified product, and the third amplified product.

[0053] 3. Library construction and sequencing

[0054] Amplification product library construction: Novokit (PT004) was used to construct libraries for the first amplification product, the second amplification product, and the third amplification product, including end repair + A, adapter reaction, and PCR amplification reaction, to obtain the first library, the second library, and the third library, respectively. Qubit was used to quantify the first library, the second library, and the third library, respectively. The first library, the second library, and the third library were sequenced on the illumina NovaSeq Xplus platform.

[0055] The sequencing data of the third library was used to count the number of raw reads of the positive samples, and the positive ratio was calculated using the following formula I:

[0056]

[0057] Using the sequencing data of the second library, count the number of raw reads of the negative sample. In most cases, the value of the negative control is regarded as the background value. Only when the background noise is extremely small can the sequencing results reflect the true species composition of the sample.

[0058] When the raw reads of the third library are ≥50,000 and the positive ratio is ≥95%, and the raw reads of the second library are ≤1000, the quality of the library construction is qualified. In the negative control, the raw reads output ratio is low, indicating that the contamination of the current process is controllable and it is a baseline result obtained when no measurable positive results are produced.

[0059] The sequencing data of the positive and negative samples of this application were used to monitor the quality of the library construction process of the 142 samples of this application, such as Figure 1-2 As shown, the sequencing results of a total of 142 positive samples and 142 negative samples are respectively shown, among which the average positive ratio is 99.7% and the median is 99.8%; the average number of raw reads of negative samples is 96 and the median is 1, and the library construction quality of the 142 samples sequenced in this application is qualified, which is the same as the actual library application (the existing judgment standard is that the first library outputs ≥50,000 raw reads).

[0060] type Index Sample quantity average value Median Positive Control Raw reads 142 99.7％ 99.8％ Negative control Proportion of types in standard products 142 96 1

[0061] In summary, using laboratory standard positive and negative samples in the entire process of sample sequencing can monitor whether there is contamination in reagents and consumables used in the experiment, human operations, and other links, and monitor whether there is cross-contamination between samples.

[0062] From the above description, it can be seen that the above embodiments of the present invention achieve the following technical effects: negative samples and positive samples are introduced into the process of constructing the microbial amplicon library, and the operation is carried out according to the whole process. The sequencing results of negative samples and positive samples are used to judge whether the quality of the library construction of the sample to be tested is qualified, thereby measuring the accuracy and reliability of the sequencing data. It is possible to easily judge the accuracy of the sequencing data of the sample to be tested, eliminate the influence of contamination on the sequencing data in the links such as reagents and consumables used in the experiment, manual operation, and cross-contamination between samples, and better conduct subsequent research and analysis on the sequencing data.

[0063] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A method for building a second-generation library of microbial amplicons, characterized in that: include: Using primers that specifically identify microorganisms, PCR amplification is performed on sample DNA, negative samples, and positive samples to obtain a first amplification product, a second amplification product, and a third amplification product, respectively; Using the first amplification product, the second amplification product and the third amplification product to construct libraries, to obtain a first library, a second library and a third library respectively; Sequencing the first library, the second library, and the third library, and using the sequencing data of the second library and the third library to judge the construction quality of the first library, so as to obtain a microbial amplicon library of qualified quality; Wherein, the negative sample is Tris-HCl buffer; The positive samples include one or more of Listeria monocytogenes, Pseudomonas aeruginosa, Bacillus subtilis, Saccharomyces cerevisiae, Escherichia coli, Salmonella enterica, Lactobacillus fermentum, Enterococcus faecalis, Cryptococcus neoformans or Staphylococcus aureus.

2. The method according to claim 1, characterized in that: Using the sequencing data of the second library and the third library to determine the construction quality of the first library includes: The positive ratio was calculated using the following formula I; Wherein, ASV is an amplicon sequence variant, when the raw reads of the third library are ≥50,000 and the positive ratio is ≥95%, and the raw reads of the second library are ≤1000, the construction quality of the first library is qualified.

3. The method according to claim 1, characterized in that The PCR amplification was performed using Phusion high-fidelity DNA polymerase.

4. The method according to claim 1, characterized in that: The primers for specifically identifying microorganisms are shown in SEQ ID NOs: 1-14.

5. A device for building a second-generation library of microbial amplicons, characterized in that: include: A PCR amplification module is configured to perform PCR amplification on the sample DNA, the negative sample and the positive sample using primers that specifically identify microorganisms, to obtain a first amplification product, a second amplification product and a third amplification product, respectively; a library construction module, configured to construct a library using the first amplification product, the second amplification product and the third amplification product to obtain a first library, a second library and a third library respectively; A sequencing and quality assessment module is configured to sequence the first library, the second library, and the third library, and use the sequencing data of the second library and the third library to determine the construction quality of the first library, so as to obtain a microbial amplicon library of qualified quality; Wherein, the negative sample is Tris-HCl buffer; The positive samples include one or more of Listeria monocytogenes, Pseudomonas aeruginosa, Bacillus subtilis, Saccharomyces cerevisiae, Escherichia coli, Salmonella enterica, Lactobacillus fermentum, Enterococcus faecalis, Cryptococcus neoformans or Staphylococcus aureus.

6. The device according to claim 5, characterized in that The sequencing module comprises: The calculation unit is configured to calculate the positive ratio using the following formula I; Wherein, ASV is the amplicon sequence variant; The judgment unit is as follows: when the raw reads of the third library are ≥50,000 and the positive ratio is ≥95%, and the raw reads of the second library are ≤1,000, the construction quality of the first library is qualified.

7. The device according to claim 5, characterized in that The PCR amplification was performed using Phusion high-fidelity DNA polymerase.

8. The device according to claim 5, characterized in that The primers for specifically identifying microorganisms are shown in SEQ ID NOs: 1-14.

9. A computer-readable storage medium, characterized in that: The storage medium includes a stored program, wherein when the program is executed, the device where the storage medium is located is controlled to execute the method according to any one of claims 1 to 4.

10. A processor, characterized in that: The processor is configured to run a program, wherein the program runs the method according to any one of claims 1 to 4.

Images