Pleurotus eryngii strain Ple0400 and application thereof

Abstract

The invention discloses a pleurotus eryngii strain Ple0400 and application of the pleurotus eryngii strain Ple0400. According to the invention, according to genomic sequencing data, Pl.e0400 is selected and bred for bag type cultivation. The method comprises the following steps of: selfing and breeding by taking 'Dai-Induced No.1' as a parent; the method comprises the following steps: comparing whole genome sequencing data of Pl.e0400 and a parent 'Daiseng No.1' pairwise by adopting a Kmer subtraction assembly technology to obtain a specific difference fragment sequence (SV), obtaining a difference fragment (SV), randomly selecting four SV sequences to design eight pairs of specific primers, amplifying the Pl.e0400 and the parent 'Daiseng No.1', sharing Chr1A, Chr2A, Chr4A and Chr5A as Daiseng No.1 and Pl.e0400, and sharing Chr1, Chr2, Chr4 and Chr5 as special fragments of Daiseng No.1. The result shows that the DNA fingerprints of Pl.e0400 parent Tiangui No.1 have significant difference, and the Pleurotus eryngii is determined to be different varieties. Pl.e0400'pileus is concave, light gray, short in stipe, creamy white, high in hardness, short in cultivation period, high in yield, resistant to storage and transportation and good in development and application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of Pleurotus eryngii cultivation, and specifically relates to a Pleurotus eryngii strain Ple0400 and an application thereof. Background Art

[0002] Pleurotus eryngii is the trade name of Pleurotus eryngii, also known as dried scallop mushroom, snow mushroom, almond abalone mushroom, grassland boletus, etc. It belongs to the Basidiomycetes, Basidiomycetes, Hymecomycetes, Agaricales, Pleurotus, and Pleurotus in taxonomy. According to research, Pleurotus eryngii is a precious new edible mushroom that combines food, medicine, and diet therapy. It is very nutritious and contains rich vitamins, calcium, copper, zinc, iron and other minerals. Its vegetable protein content is as high as 25%. Pleurotus eryngii is also known as the "king of mushrooms" and "dried scallop mushrooms" because of its thick flesh and crisp taste, especially the firm, dense, fresh and milky white tissue of the stem, which can be eaten in its entirety. It tastes better when cooked with other ingredients such as fish and meat. As an excellent and precious edible fungus, King Oyster Mushroom has excellent health care functions. Regular consumption of King Oyster Mushroom can not only improve the body's own immune function, but also has anti-cancer, blood pressure lowering, blood lipid lowering, and has excellent gastrointestinal digestion and absorption functions, and is deeply loved by the general public.

[0003] King oyster mushrooms are native to southern Europe and were successfully cultivated in 1977. In the 1990s, my country introduced and carried out research on factory-based year-round cultivation technology and breeding of new varieties from Europe. After decades of development, King oyster mushrooms have become one of the most widely cultivated edible fungi in my country. However, the varieties cultivated in my country are mainly introduced from Japan. "Riyin No. 1" is a variety of King oyster mushrooms (Pleurotus eryngii) introduced from Japan by Zhangzhou Agricultural Science Research Institute and bred through systematic selection. It passed the Fujian Province non-major crop variety certification in 2010 and has become the main cultivated variety of King oyster mushrooms in my country. This variety has the characteristics of high yield, firm mushroom body, and good consistency of mushroom production. However, the cap of this variety is concave and dark in color, which may easily lead consumers to mistakenly think that it is a deformed mushroom and not fresh. At the same time, there are two types of cultivation methods in the current factory cultivation of Pleurotus eryngii. One is bottle cultivation (less material loading and shorter cultivation cycle); the other is bag cultivation (more material loading and longer cultivation cycle); therefore, it is necessary to improve it to adapt to the consumer market of Pleurotus eryngii. Summary of the invention

[0004] The purpose of the present invention is to provide a Pleurotus eryngii strain Ple0400 and its application in order to solve the above-mentioned problems.

[0005] The technical solution adopted by the present invention is as follows: a Pleurotus eryngii strain Ple0400, which is classified and named Pleurotus eryngii Pl.e0400, and has been preserved in the China Center for Type Culture Collection on November 7, 2024, with a preservation number of CCTCC M 20242463, and a preservation address of No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0006] In a preferred embodiment, the Pleurotus eryngii strain Ple0400 is bred by self-crossing with Pleurotus eryngii 'Riyin 1' as a parent.

[0007] In a preferred embodiment, an application of Pleurotus eryngii strain Ple0400 is characterized in that: the application includes using the strain Ple0400 to cultivate Pleurotus eryngii.

[0008] 8. The use of a Pleurotus eryngii strain Ple0400 as claimed in claim 7, characterized in that: the breeding of Pleurotus eryngii comprises the following steps:

[0009] (1) Creation of breeding materials: The parent 'Riyin No. 1' was cultivated and produced in Zhangzhou Tianhua Edible Fungi Co., Ltd., and mature fruiting bodies were selected for collecting spores.

[0010] (2) Multi-spore self-pollination: Scrape the spore print of "Riyin No. 1" into sterile water to prepare a spore suspension, mix thoroughly, take 100 microliters of the spore suspension of "Riyin No. 1" to 90 mm PDA plate culture medium, repeat 10 times, spread evenly with a coating rod, and place in a 25°C incubator to culture in the dark. When the hyphae germinated from the spores in the plate form small colonies, use an inoculation needle to pick and transplant them to the test tube slant culture medium. A total of 500 colonies were picked and cultured in a 25°C constant temperature incubator. When the hyphae cover the test tube slant, take the hyphae at the front end base to observe the lock-like union. The lock-like union is a hybrid. After microscopic examination, the number of hybrids containing lock-like unions was 282. According to the growth rate and growth potential of the hyphae, 37 hybrids with abnormal growth were eliminated, and the remaining 245 were retained for subsequent screening.

[0011] (3) Screening of hybrids: 245 hybrid strains with normal growth obtained from hybridization were screened for mushroom production in Zhangzhou Tianhua Edible Fungi Co., Ltd. The mushroom production management was carried out according to the company's mushroom bag cultivation method. One hybrid strain (Pl.e0400) with better yield and quality traits than the control variety 'Riyin No. 1' was selected for re-screening.

[0012] (4) The hybrid strain Pl.e0400 was cultivated and managed in the bag cultivation mode in the re-screening experiment, and the fruiting characteristics were better. The average single-bottle yield was greater than 550 grams, the cap was light in color, the stem was short and dense and strong, and it was resistant to storage.

[0013] In a preferred embodiment, in step 1, the mother culture medium in the cultivation process is PDA medium, and the formula is: 200g potato, 20g glucose, 20g agar, and 1000mL water.

[0014] In a preferred embodiment, in the step 1, the formula of the culture medium used for the cultivation process is: 42.28% sawdust, 42.28% corn cobs, 6.67% wheat bran, 3.7% corn flour, 3.7% soybean meal, 0.93% lime, 0.44% calcium bicarbonate, 67% ± 2% moisture content, and each bag weighs 1500g (465g dry material).

[0015] In a preferred embodiment, the Pleurotus eryngii strain Pl.e0400 is bred by self-pollination and hybridization with Pleurotus eryngii 'Riyin No. 1' as the parent. 'Riyin No. 1' has the characteristics of high yield, firm mushroom body, and good consistency of mushroom production. It is a variety widely used in factory cultivation of Pleurotus eryngii in my country. However, this variety has a darker cap color, and some consumers mistakenly believe that it is not fresh. According to cultivation tests, 'Pl.e0400' shows high and stable yield, with a concave and light gray cap, and a short, off-white, hard stipe. Its productivity is significantly better than that of 'Riyin No. 1', which improves the problem of the darker cap color of 'Riyin No. 1'. ( Figure 1 ).

[0016] In a preferred embodiment, the mycelium growth temperature range of the Pleurotus eryngii strain Pl.e0400 is 10°C to 30°C, and during the period from 10°C to 30°C, the mycelium growth rate of Pl.e0400 is faster than that of 'Riyin No. 1', and the mycelium growth rate of Pl.e0400 is fastest at 25°C. The mycelium activity of Pl.e0400 is higher than that of 'Riyin No. 1'. After the pilot cultivation variety comparison test, the fruiting body of 'Pl.e0400' is straight, the cap is concave and light gray, the stipe is short, off-white, and hard, the cultivation cycle is short, the yield is high, and it is resistant to storage and transportation. The average yield of 4 batches of 'Pl.e0400' is 622.9 grams / bag, which is 16.84% higher than the control variety 'Riyin No. 1', and the increase in yield has reached a very significant level.

[0017] In a preferred embodiment, the Pleurotus eryngii strain of the present invention uses Kmer subtractive assembly technology to compare the whole genome sequencing data of 'Pl.e0400' and the parent 'Riyin No. 1' in pairs according to the genome sequencing data to obtain specific differential fragment sequences (SVs), and 8 pairs of specific primers are designed by randomly selecting 4 SV sequences to amplify the Pleurotus eryngii bases 'Pl.e0400' and the parent 'Riyin No. 1'. The PCR amplification results of each specific fragment are as follows: Figure 3As shown: Chr1A, Chr2A, Chr4A and Chr5A are common to Riyin No. 1 and Pl.e0400, and Chr1, Chr2, Chr4 and Chr5 are unique to Riyin No. 1. From the results, it can be concluded that the DNA fingerprints of Pleurotus eryngii 'Pl.e0400' and its parent 'Riyin No. 1' are significantly different, and they are determined to be different varieties.

[0018] In summary, due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0019] In the present invention, the Pleurotus eryngii strain 'Pl.e0400' is selected for bag cultivation. It is selected by self-pollination with 'Riyin No. 1' as the parent; it has been deposited in the China Center for Type Culture Collection on November 7, 2024, with a deposit number of CCTCC M20242463, and a deposit address of No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The cap of 'Pl.e0400' is concave and light gray, the stem is short, off-white, and hard, the cultivation cycle is short, the yield is high, and it is resistant to storage and transportation, and has a good development and application prospect. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 The fruiting bodies of Pleurotus eryngii strain 'Pl.e0400' and its parent 'Riyin No. 1', of which the left picture shows strain 'Pl.e0400' and the right picture shows the fruiting body of its parent 'Riyin No. 1';

[0021] Figure 2 The whole fruiting of Pleurotus eryngii strain 'Pl.e0400';

[0022] Figure 3 The PCR electrophoresis diagrams of specific fragments of Pleurotus eryngii strain 'Pl.e0400' and its parent 'Riyin No. 1', where 1 is Riyin No. 1 and 2 is strain Pl.e0400. DETAILED DESCRIPTION

[0023] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0024] Reference Figure 1-3 , a Pleurotus eryngii strain Ple0400 and its application, the strain is classified and named Pleurotus eryngii Pl.e0400, which was deposited in the China Center for Type Culture Collection on November 7, 2024, with the deposit number CCTCC M 20242463, and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0025] The tested Pleurotus eryngii strain 'Riyin No. 1' is the main cultivated variety of Pleurotus eryngii at present and is preserved in the Fungus Research Center of Fujian Agriculture and Forestry University.

[0026] In the following examples, the mother culture medium is PDA medium, and the formula is: 200 g potato, 20 g glucose, 20 g agar, and 1000 mL water.

[0027] In the following embodiments, the culture medium formula used for the substitute planting is: 42.28% sawdust, 42.28% corn cobs, 6.67% wheat bran, 3.7% corn flour, 3.7% soybean meal, 0.93% lime, 0.44% calcium bicarbonate, 67% ± 2% moisture content, and each bag weighs 1500g (465g dry material).

[0028] According to the genome sequencing data of the Pleurotus eryngii strain of the present invention, the whole genome sequencing data of 'Pl.e0400' and the parent 'Riyin No. 1' are compared with each other by using Kmer subtractive assembly technology to obtain specific differential fragment sequences (SVs), and 8 pairs of specific primers are designed by randomly selecting 4 SV sequences to amplify the Pleurotus eryngii base 'Pl.e0400' and the parent 'Riyin No. 1'. The PCR amplification results of each specific fragment are as follows: Figure 3 As shown: Chr1A, Chr2A, Chr4A and Chr5A are common to Riyin No. 1 and Pl.e0400, and Chr1, Chr2, Chr4 and Chr5 are unique to Riyin No. 1. From the results, it can be concluded that the DNA fingerprints of Pleurotus eryngii 'Pl.e0400' and its parent 'Riyin No. 1' are significantly different, and they are determined to be different varieties.

[0029] Example 1: Breeding of Pleurotus eryngii 'Pl.e0400'

[0030] The breeding of Pleurotus eryngii 'Pl.e0400' includes the following steps:

[0031] (1) Creation of breeding materials: The parent 'Riyin No. 1' was cultivated and produced in Zhangzhou Tianhua Edible Fungi Co., Ltd., and mature fruiting bodies were selected for collecting spores.

[0032] (2) Multi-spore self-pollination: Scrape the spore print of "Riyin No. 1" into sterile water to prepare a spore suspension, mix thoroughly, take 100 microliters of the spore suspension of "Riyin No. 1" to 90 mm PDA plate culture medium, repeat 10 times, spread evenly with a coating rod, and place in a 25°C incubator to culture in the dark. When the hyphae germinated from the spores in the plate form small colonies, use an inoculation needle to pick and transplant them to the test tube slant culture medium. A total of 500 colonies were picked and cultured in a 25°C constant temperature incubator. When the hyphae cover the test tube slant, take the hyphae at the front end base to observe the lock-like union. The lock-like union is a hybrid. After microscopic examination, the number of hybrids containing lock-like unions was 282. According to the growth rate and growth potential of the hyphae, 37 hybrids with abnormal growth were eliminated, and the remaining 245 were retained for subsequent screening.

[0033] (3) Screening of hybrids: 245 hybrid strains with normal growth obtained from hybridization were screened for mushroom production in Zhangzhou Tianhua Edible Fungi Co., Ltd. The mushroom production management was carried out according to the company's mushroom bag cultivation method. One hybrid strain (Pl.e0400) with better yield and quality traits than the control variety 'Riyin No. 1' was selected for re-screening.

[0034] (4) The hybrid strain Pl.e0400 was cultivated and managed in the bag cultivation mode in the re-screening experiment, and the fruiting characteristics were better. The average single-bottle yield was greater than 550 grams, the cap was light in color, the stem was short and dense and strong, and it was resistant to storage.

[0035] The Pleurotus eryngii strain 'Pl.e0400' was classified and named Pleurotus eryngii Pl.e0400, which was deposited in the China Center for Type Culture Collection on November 7, 2024, with the deposit number CCTCC M20242463, and the deposit address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

[0036] Example 2: Effects of different temperatures on mycelial growth of Pleurotus eryngii 'Pl.e0400'

[0037] The hybrid strains of Pleurotus eryngii Pl.e0400 and 'Riyin No. 1' were inoculated on PDA medium and cultured at constant temperatures of 5℃, 10℃, 15℃, 20℃, 25℃, 30℃ and 35℃. As can be seen from Table 1, the mycelium growth temperature range of Pl.e0400 is between 10℃ and 30℃, and the mycelium growth rate of Pl.e0400 is faster than that of 'Riyin No. 1'. The mycelium growth rate of Pl.e0400 is the fastest at 25℃. Pl.e0400 and 'Riyin No. 1' are both weak in high and low temperature resistance, and their mycelium did not grow at 5℃ and 35℃.

[0038] Table 1 Mycelium growth rate test results (unit: cm / day)

[0039]

[0040] Example 3: Batch planting of Pleurotus eryngii strain 'Pl.e0400'

[0041] The main cultivar of Pleurotus eryngii, 'Riyin No. 1', was used as a control. The cultivars of 'Pl.e0400' and 'Riyin No. 1' were activated and liquid cultivars were prepared. Then, the production was carried out in bags. The planting site was Zhangzhou Tianhua Edible Fungi Co., Ltd. The mushroom production management was carried out in accordance with the company's production method of Pleurotus eryngii. Four batches were planted continuously, of which 6,000 bags were planted for each variety in the first three batches, and 5,000 bags were planted for each variety in the fourth batch. It took 62 days from inoculation to harvest. The yield, cap diameter, cap thickness, stipe diameter, and stipe length were measured at the time of harvest for each batch. The measurement data of the four batches of 'Pl.e0400' and the control variety 'Riyin No. 1' were summarized and analyzed for significant differences. The results are listed in Table 2.

[0042] Table 2 Results of multiple batches of cultivation experiments

[0043]

[0044]

[0045] Note: 1. '**' means P < 0.01, the difference is extremely significant; 2. '-' means no difference.

[0046] After 4 batches of cultivation trials, the total average yield of 'Pl.e0400' was 622.9 grams per bag, the average cap diameter was 60.18 mm, the thickness was 26.79 mm, the average stem diameter was 51.82 mm, and the length was 12.5 cm. The total average yield of the control variety 'Riyin No. 1' was 533.1 grams per bag, the average cap diameter was 61.91 mm, the thickness was 30.73 mm, the average stem diameter was 54.56 mm, and the length was 14.4 cm. The total average yield of 'Pl.e0400' was 16.84% higher than that of the control variety 'Riyin No. 1' (the difference reached an extremely significant level), and the total average stem length was 13.19% shorter than that of the control variety 'Riyin No. 1' (the difference reached an extremely significant level).

[0047] Example 4: DNA fingerprints of Pleurotus eryngii 'Pl.e0400' and its parent 'Riyin No. 1'

[0048] The DNA samples were sent to Beijing Novogene Bioinformatics Technology Co., Ltd. for whole genome sequencing. After the sequencing data were obtained, the Kmer subtractive assembly technology was used to compare the whole genome sequencing data of 'Pl.e0400' and the parent 'Riyin No. 1' to obtain specific differential fragment sequences (SVs). Four SV sequences were randomly selected to design 8 pairs of specific primers for amplification of Pleurotus eryngii 'Pl.e0400' and the parent 'Riyin No. 1'.

[0049] The PCR amplification results of each specific fragment are shown in Figure 3 As shown: Chr1A, Chr2A, Chr4A and Chr5A are common to Riyin No. 1 and Pl.e0400, and Chr1, Chr2, Chr4 and Chr5 are unique to Riyin No. 1. From the results, it can be concluded that the DNA fingerprints of Pleurotus eryngii 'Pl.e0400' and its parent 'Riyin No. 1' are significantly different, and they are definitely different varieties. The primer sequence of SV is shown in Table 3 below:

[0050] Table 3 SV primer sequences

[0051]

[0052] The DNA sequences of each specific fragment are:

[0053] Chr1A (956 bp)

[0054] CGGAAAAGAGGCGAATGAACGCGTCCGCGCGCTCCAGCAGGATGTGAACTACTGCGTTTCATTTGC

[0055] GAGGGCAACAGCCCGATACAGTCCACTCATTCGGCCCTTCAGGATACATAAATGCGTTGACGTCGTTG

[0056] AATTATTGCCAAGGTCGTCGTCCAACGGGTCTCAGTCTGAATCGCATTTTGACATGTCCTGAGACCTA

[0057] GGTTCTGAGTGCACACTGCCATCGTGATCGTCCATAGCTACAAAAATAGTGGCAGAATCGACATCCAT

[0058] GCCGTATGTGACATAGAGCGCGAAGCGGTAGGGAAAATACTAGCTGTTGGAGGCGACGCGCAGAGAA

[0059] GTGACCCCCCCCCGTTCTCTACGATTGGGTATTGTGTTGAAGGAGGTGGTTAACGTGTTGAGACGGAG

[0060] TAGTTGTAGGTCTATGCACTTGTAGTTGGTCTCTTCGAAGTCGGTGAAGAAGACGGCCCCGACACGA

[0061] AGGGCAGTATCGGCGGACGAAGGAGGCAGCGTGTACTAGGTTGTAAATGTAGTAGCGCATACATTGCC

[0062] CTTCACGGACGGTAGGAACGGTCGGCATCCATCGGTGGTCGTCGCGATAGAGAGGCGAGAAGGTGA

[0063] GTTACGATTGCAGGCTTGGGGAAGAACAGTGAGGTCAGTGCCCATGCACATGAGGTACAGATGAGAA

[0064] GAGGGACGAGATACAATACGAACTCACTGTATCCATATCCTCGTAACCAAAAGGCAAGCCGGTAGTCC

[0065] TCCATGGACGTCCTCGCGCCTCCATGATCATGAACCAGAACGACGAATGCCAGTATCATGCTTCATAAT

[0066] CGATGGGCGCGACGTTTGCTATGTTCGCAATTGATAGGAATGAGATTTTGGGTGCGGGGGAAGTAGTA

[0067] CTCAGGAAGGCGTATGACAGGGATCAAGATGGTACGGAGGGTGGAGTAACACGCTCGCTTGTGTTCT

[0068] CCTCGGTGTT

[0069] Chr1(650bp)

[0070] ATACCAGAATGAGTCCCGCAACTGCAGAGCCAGGTTCGCCATTCCCTGGTCACCCTTCCATTTCCATT

[0071] CATCATCATTGTCATTGTTGTCACTTCCAGACAGGTCAGCATCACCAGTTGGTATTGGGCCATCATCCA

[0072] TGCAATCCTCATAGGCAGCAGTGGTGAGATAACGTCGGTAGGCAACAGCAGCCAAGTCTTCAAGAAA

[0073] TGAGAACTCCTTGCTCACAAGGGAGCCAACAGCAGAGAATGCATGGTTGAGGTAGTCAAGCAGCTTC

[0074] TTCGTGGATTTGCTCTGTGAGGCTGGCGGTGAACCAGATGCTGGGGGCAAACTAGGTGCTGATGCATC

[0075] AGTGGGAGTAGGTGAAGTAAATTGGTCATTGGCGATGGGTGGTTCACCAGATGCTAAGGGCGAAGCA

[0076] TATGCCAAAGTGTCGGCGGTGGCAGACGAGGATTGAGAGGACTCCTCCAGCAATGTCCTGCAGGCTA

[0077] TTGAGTATCAATGACTATATAAGCATAATTACATACCGGAGAACGCCAAGGCATGATATCTCAAAAGTC

[0078] TCGGTAACGGCGTGGTGATGAGGATAGAAGTCACATTTTGTTGGGTTCAGCTTGGTATGTCCTAAGGT

[0079] ATCACAGTCATGGTGTAGCCCAAATAGTCGCTTGCCGGTA

[0080] Chr2A(977 bp)

[0081] TCCCCTAAATCCCCTGTCTACTCCTGGGACCCCTAATCAATATCCTTACATCCCAACCACTCAACAAGT

[0082] TTACAAGCCATGTTGAAATGCAGTTGTGAAGTTAGTAGAAATGTCATGGAACTTCAAAGAATGTTACA

[0083] GAACCTTTTAGCACTTTGCAACTACTGAACAAAATGCCATCTAAGCCTGTCCTCAGGAAGACCAAAAT

[0084] AAATTAGATGACATCAGATGACATCATTGTGGAGTATTGTGGAGCATTATAAAGCTCCACATGCAAAGG

[0085] ATTAACTGCTTTACTAAGCCATTGGCAGAATCATTATCAATCATTGGCTTGGCATACTTGAAGCATGTTT

[0086] CATATAGTGTTTCAGCTCCACTTTCAGCCCCTTGATGTCAATTTCATACATCTGATTCAGTTGAAGACAC

[0087] TTTTACTTAGTAGATCTCCATTCTAGAACTCAGTTCCACTTGACCTCACCCATCCCTTCTGTAGTACCAC

[0088] TTCTTAGTAAGCAGTATAGTACTATTAAGTTACATAGATAAAGAATATACTTGATTCATTGATAATTAAGT

[0089] ACTTTGAAATTGTGAGAAGCCCTTGCTGAATAAAAGATTATAGGTGTCTAGTGTACACTTATCTTGTTA

[0090] CTCAAAGTTATAAGCTCCCATCTATCTTAGGTACAGAGTATACCATTACTGGCTAGGCATTAGACTGTAG

[0091] ATACAATTCTATAGGTGTCTAGTAATATATTAGAGGTGATATTGCACTATAGCTTAAGTGTGCGTCTGGTA

[0092] TCATTTATATCTAAAAAGGAAGTGATCTAGCATCTGACTAAAGCTTCTGACCAGTAGTGTTACAGAGTA

[0093] GTCATTATATTTTGGAGTTAGTCAGGAGTATATTCATCCAGGAATATTCCCATGATTAGTATTTGTTTTATA

[0094] TTCAATCAGTTACGACTTATCAAGTTCCTATTGTGCTATTCATTTATTGAGTAGTTTGGTATTGCCTGCTG

[0095] Chr2(977 bp)

[0096] GAACAGGTCCAACCATTCCTTCAGGAAAAAGAACATATGCCTTTTACAACCCTAGGGACAATGATACA

[0097] CTACAATGCGAGTATCACATATACTGAAATGTCTCTTCCTAGATTCACGCTGTCCATGGACAGGACATA

[0098] CTTCTCAATAGATGGCCACCCTATCACGTTTGCCAAATTCAAAGAATACACTCTCAACATGGTTATGCT

[0099] TGCAGAAAGTAAACTCTATGCTGTGCTTTGTGGGTGTGGTCTGGACGATATCAATGCAAGTATCAAAG

[0100] CTGCCCTACAACCAGGAGATTCGCAGCACGTTTTCCTCAATAGACTACAGGACAGTGGTGCCGGCTAT

[0101] TCCTTTTTTGGACACCCATAATCCTCTTAGAACTGAATGCAACCGACTTTTGAAGCACTTTCTTCGCCC

[0102] CAGACATGACGAATTCTCTACATCTATACCCAGAGCCACACCTCCTGAGATTTTTAAGCCAGGTATGTA

[0103] TATTATTATTCATAGTACACCTTGGCTGATGAACTCCCAGTGAATTGTCATCTCTGGCTAGACAAGGTC

[0104] AACTCCCTCATCTCTATGTTATATGCTTCGACTATCGTCACCTGGCCTGGTGCCGCTTGAGGCCCAGAA

[0105] CTCGACCACCTCACATATCGCAACGAACATGGCAAATGGCATATCTTCATATTCAACAACATATTGACA

[0106] TTTGTTACTTCTTATATCAAAACCCAACAGATTACCGGCCGTGCTCCTCTAATCCCTTGTGGAGTCAAT

[0107] CCTTGCCTTGCCCATGTGCTCATCATCACCATCAACTTTGTTTATTATGCAGCATCCGCTATAAGCATGC

[0108] AACTCAAATCACACAAACAGGCTGTTGCTTATACCCGTTACATGTTTGTATTTCGAGGCAAGCCGATG

[0109] AACGCAGAGCGCATGACTGTTGTACTGAAAGAGCACTCAAAGAACGTGTTCCATTCCAAGTTTGGCA

[0110] TACACGATTGGAGACA

[0111] Chr4A(965 bp)

[0112] TCGAAAACCTCTTCGTCTGCTGCAAATGCGCTCCCAGGGTGCGCATCAAAGACAGCAAGCCGCTCGC

[0113] TATGTTTGAAGTGTTCACCTGGCGCGAGGCAGTACGTCGTACGTATCCTTTCATGATGCTTTAATTGAA

[0114] CGTTCGGACCTCTAGGTATTGCATTACTACAAGGATTGTATAGCGGATCTTCGTTCTGATATTATAGACC

[0115] CCCAGTTTACGCGCACGTCCCCACTCGACCCGAATCTGCAAGGCGACGACTCGCCTGCTGCCCACAA

[0116] GAACATCTGGTCGTGTCTGCACTGCGCGATCCACCTCCACAGCTGGGTCAACCGGCACGAAGTTATC

[0117] GCGCACGTCAAATCCGCGTCTGTTTCCGTTTCTCGTTTGCACCCTCCGTGACGTCCACTCATGCTTTAT

[0118] CGTGTTGCAGACACCCAATTGCCGACCCAGCGGAGCATGTCGACTTCTTTGCTGATCCGGTTGCGGGG

[0119] GAACGCCCTGCCTCGCAATGGCGGCTCTGCCTCCCCCAGGGCACAGAACCGCCGCCTGCGCTCAGAG

[0120] GTCTCGTCGTAGCGATGAATCAGCCTGTTAAGCCTGCTGCCCTCGCAGACCCCAAACAACAGTTTCGC

[0121] TGCAAACTATGCAGCTCGTCGTCAACTCGTCGATTCATCCTGGGTGGCGTCCAAAGCCACATCCGCGA

[0122] TGTGTAAGACCATTCCTTCCGCGTTGTACAGTACATGCACTCACGGCATCGTTGCCTCGTCTAGTCACA

[0123] AAGTCCCCCGCAGTCCCAGCGCGCTCACGAGCACTTCGAGGAAGCGTAGTATCATTCTGGTTCATCTG

[0124] ACTATATAATGCTTCTACTAATCGTATCTTCTACATGTGCGATATTTCCCCTTGATAGTTAATGGACGTGC

[0125] CGTTTGTTCGCGCTGCTAACTGCCTTTCGTCCTATGATAGCCTCTCAATACCGTTCATGGTATACTGTCC

[0126] GGTCTGT

[0127] Chr4(888 bp)

[0128] GCAGCAAACCAACTCATTTTCCTATGGTATTATTGCCATTAATGCGATTGAGCATGCTATCTTTGGCAA

[0129] GCATCTTTGGGAGGCTCAACAAGCCGCTCCTGAGCAAATCAAATGGTTTTGTGAGGATTGTTGAGCGG

[0130] CATGAAACGAGAGCGAAAGAAGTCAGCTCACAAGACTCTGATCTCATGATGGGAAACAATGTACATA

[0131] TGAATCACTGTAACCATATGAACCAAAGCATAATGATTTACACTCAATAGTTTTCCAAGAATGTAAATG

[0132] ATCATGTGTATGACATCATCACTGGAAGTCTCATATCAGCCTCAATTTTTACCAACAAGGACTCAGATT

[0133] CATCTGATGGTAAGTACTTGCCTTCAAGCATCTTGTCTGCTTCGTTCCCAGACATCCAATCAGGCAATG

[0134] AATCGGACCTTGGTTCTGATTCAACTTCGAGGCATGTAGCAAAGATCATAATCACTGAGGATACTTCTG

[0135] TGAGGATACAGGCACCAGTAGGAGTTAGCAAATGTTCAAGGCTGCCATCAAGTGACAAGGGGTCTAG

[0136] TGGCTCATCCGAGTCAACACCCAAGGGAAGGTCTAAATCAATTGTTAAAAGTCAACAAGGCCATTAC

[0137] AAAGGCACGCCTGCAGTAGATGAAGAAAAACTTACAAGATGGAAGAATAAGCTACTTGAGGACAAC

[0138] CCTAAAGTATGCTTCCTACATGACCATCCAAGAAGGGTACAGCATTCAGTGTGCACATCCATTATCACG

[0139] ATGAAGAACATGTACGACACAACCTGATAGAATGAGCATATTACAAAGAGTTGTCCTGGAAAACCCTG

[0140] GACGAAGAAACAGAAGACAGTGAAGGCAGCATTAGAGACACACCCAATCAAGAATTGGTTCCTGCC

[0141] TCAGA

[0142] Chr5A(981 bp)

[0143] CAATGGGTGTAAGGGCTGAAGGATTCGGACAATTGGCCGTGTTCTGGTTGGTGACGATACGCACCAA

[0144] GCGCGGTTTGACAGCTGTCAGACAGCGATCAAAGAGATAAAGTAGGTTCATCATTAGTCGAAACACG

[0145] GCCATGAACTGACTGAGGGGCAACCAGCTCCTGGTGAATGCGAACGAGAGGAGTGCCGAAGACTTC

[0146] GACATCGTGTGAATCTCGTAAAACAAAGTCGTAAAGCAGCTGGGGATGGTTGATGGTCCGCAAGCTA

[0147] CATGGTCATTTATACGGGCCTCGTTTATTGTCGACGACTAGTCGTGCCAGTTCCTTCGCATACTTACCGT

[0148] TTACAGCGCTGTCGTATTAGGCTTGGGCTCTAACCGTTTTTGCTAAATATCAAAGTCAGCTCGTGTAGG

[0149] ACTCCAACCGTGGGAGTAAGTCATCGTTGGAAGTGGCTCACGCCTTCTGTTGCGATCATCCAGTGGCA

[0150] CGTCCGTGAGTTGCTTCTACTCATCGTGTGGGTATGCAACCGACTTGGAAACGTATACAGGAGTTTCC

[0151] CAGAGTCCGACTGCGTTCATATAACAACGGCCGTGCTGAAACCATGCTGTCAGCCTGACTCTCTCATA

[0152] ACTTTGAACTCAGTTACATGCCAGGCGAAGATAGGCTCGTAAACCAGCGCTCTATTCGAGATTATGATA

[0153] AGTTGAGTAGTCTGAGAATAGAATTCACGGAAGCTTCTTGTCGAAATCTCGAGATGTTGAGATTTTGA

[0154] AACATCTTGTAAACATCCACACATCAACAGGAGACACTGGAAGGTCCTACCATCCCCTGGACGAGATA

[0155] TCCACCGCATCTACTTCGCTTCCGCTGTTGGTAGTTTCTCATCCTAGGCCTCATTTCTGTCCTGTCTGAT

[0156] CTGTCCAAGAAGCTCTTGCGTTTCTCTTCTGGTCTTGATGTGCATCTCAACCGTCAATCATAAATGGAA

[0157] AGCGGTGGTGCTCCTTGTTCATCCAGT

[0158] Chr5(897 bp)

[0159] CAACCATGCTCACTCCATCAATCTGCAGCAAGCCTGAGAATGCTGTTGATCCAGGTCCATGAAGCTTG

[0160] GCCCACCGCACGACCTCCCAATCTATCTTTGATGCAAATGGTGCCCATGAGTTGTTCATGGCACCAGA

[0161] GATCCTTTCCTTGTACTCAGCATATGACGAAGCTTTCCCTTCAACCAGTACTTCGCCTGACCACCCCCG

[0162] AATGGTTCAATGAACGAAGGTGGATTCTTCAAACGATTGTGGGCTTCCTCATCTTGCTCAGCCAACCA

[0163] CACCATCCCATCCCCTCCCAACTCTGGGTCACCATCGACATCCATGTCCCTTAGCATCTCCAACTGCGT

[0164] ACCGGAAGGCGTGTCCATCTGTGTGTGTAAGTCGTGGCCTATCTCTTCCTCATCTGAATCATTCTCCCT

[0165] TTCCTCATCACCATCCTCCGGAATAGGCGCAGTGAATGGGAAGTCGGCATCATCATAATTATTGCTGAA

[0166] CCAATCATCCTGGAACTGGGTTATTGTTTCACTGTTGTCCAATGACACAGAACGGGTGGAATCACCAG

[0167] TATCAGTGTTGCTGGGAGAGTGTGCTTCTCTTCTTGGTGAGCGCCAAACTCCTTGAATAGGCTGATGT

[0168] TGACATTGAAAAATGTCTCAGTACTGTTGACATTGTAGGTTGTTAGTTTTATCAAGGTGTTGGGTGTAT

[0169] GGGCCACTGGTTTTGAAGGTTTTGAAGCATCCTCCGCACTGGTATGTCATGGGGTTGATGTGCTTGTC

[0170] ATGTGCTCAGAGCTTCGAAGTTGAGTACTAAGAACTAAGCATTGAGCCTTGTTTAACATTTGAACACT

[0171] GACATCACGCACCACTTGTTTACTCATCGAAGCTCCAGCCTAGGATCTGGGCACACTGAATGGTCTTG

[0172] GGCATAGC

[0173] From the above, it can be known that in the present invention, the Pleurotus eryngii strain 'Pl.e0400' is obtained by self-crossing and hybridization with Pleurotus eryngii 'Riyin No. 1' as the parent, and has been deposited in the China Center for Type Culture Collection on November 7, 2024, with a deposit number of CCTCC M 20242463, and a deposit address of No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province. The cap of 'Pl.e0400' is concave and light gray, the stem is short, off-white, and hard, the cultivation cycle is short, the yield is high, and it is resistant to storage and transportation, and has a good development and application prospect.

[0174] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the term "comprise" or any other variant thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, the elements defined by the sentence "comprise a ..." do not exclude the existence of other identical elements in the process, method, article or device including the elements.

[0175] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that the technical solutions described in the aforementioned embodiments may still be modified, or some of the technical features may be replaced by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Pleurotus eryngii strain Ple0400, characterized in that: The strain is classified and named Pleurotus eryngii Pl.e0400, and was deposited in the China Center for Type Culture Collection on November 7, 2024, with the collection number CCTCC M 20242463, and the collection address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province.

2. The Pleurotus eryngii strain Ple0400 according to claim 1, characterized in that: The Pleurotus eryngii strain Ple0400 is bred by self-crossing with Pleurotus eryngii 'Riyin No. 1' as a parent.

3. The protoplasts produced by the Pleurotus eryngii strain Ple0400 as claimed in claim 1.

4. The fruiting body produced by the Pleurotus eryngii strain Ple0400 as claimed in claim 1.

5. Mycelium produced by the Pleurotus eryngii strain Ple0400 as claimed in claim 1.

6. A mushroom log produced from the Pleurotus eryngii strain Ple0400 as claimed in claim 1.

7. The use of a Pleurotus eryngii strain Ple0400 as claimed in claim 1, characterized in that: The application includes cultivating Pleurotus eryngii using the strain Ple0400.

8. The use of Pleurotus eryngii strain Ple0400 as claimed in claim 7, characterized in that: The method of cultivating Pleurotus eryngii comprises the following steps: (1) Creation of breeding materials: The parent 'Riyin No. 1' was cultivated and grown in Edible Fungi Co., Ltd., and mature fruiting bodies were selected for spore collection; (2) Multi-spore self-pollination: Scrape the spore print of 'Riyin No. 1' into sterile water to prepare a spore suspension, mix thoroughly, take 100 μl of the spore suspension of 'Riyin No. 1' to 90 mm PDA plate culture medium, repeat 10 times, spread evenly with a coating rod, and place in a 25°C incubator in the dark for incubation; when the hyphae of spore germination in the plate form small colonies, use an inoculation needle to pick and transplant them to the test tube slant culture medium, pick a total of 500 colonies, and place in a 25°C constant temperature incubator for incubation, wait until the hyphae cover the test tube slant, take the hyphae at the front end base to observe the lock-like union, and the one with the lock-like union is a hybrid; after microscopic examination, the number of hybrids with lock-like unions was 282, and according to the growth rate and growth potential of the hyphae, 37 hybrids with abnormal growth were eliminated, and the remaining 245 were retained for subsequent screening; (3) Hybrid screening: 245 hybrid strains with normal growth obtained from hybridization were screened for fruiting test at Zhangzhou Tianhua Edible Fungi Co., Ltd., and fruiting management was carried out according to the company's mushroom bag cultivation method. A hybrid strain (Pl.e0400) with better yield and quality traits than the control variety 'Riyin No. 1' was selected for re-screening test; (4) The hybrid strain Pl.e0400 was cultivated and managed in the bag cultivation mode in the re-screening experiment, and the mushroom fruiting characteristics were better; the average single-bottle yield was greater than 550 grams, the cap was light in color, the stem was short and the texture was dense and firm, and it was resistant to storage.

9. The use of Pleurotus eryngii strain Ple0400 as claimed in claim 1, characterized in that: In the step 1, the mother culture medium in the cultivation process is PDA medium, and the formula is: 200g potato, 20g glucose, 20g agar, and 1000mL water.

10. The use of Pleurotus eryngii strain Ple0400 as claimed in claim 1, characterized in that: In the step 1, the formula of the culture medium used for the cultivation process is: 42.28% sawdust, 42.28% corn cobs, 6.67% wheat bran, 3.7% corn flour, 3.7% soybean meal, 0.93% lime, 0.44% calcium bicarbonate, 67%±2% water content, and each bag weighs 1500g.

Images