LAMP (loop-mediated isothermal amplification) primer group, kit and method for detecting monkey pox virus based on double visual loop-mediated isothermal amplification method

Abstract

The invention discloses an LAMP (loop-mediated isothermal amplification) primer group, a kit and a method for detecting monkey pox virus based on a double visual loop-mediated isothermal amplification method, and belongs to the technical field of virus detection. The LAMP primer group provided by the invention comprises a primer group for detecting a monkey pox virus J2R gene and a primer group for detecting a monkey pox virus F3L-F4L gene. The LAMP primer group provided by the invention is high in sensitivity and strong in specificity, the F3L-F4L gene and the J2R gene of the monkey pox virus are detected through double targets, the detection accuracy is improved, and the omission ratio is greatly reduced. The neutral red pH indicator dye is added before the reaction, the cover does not need to be opened, aerosol pollution is reduced, the color change before and after the reaction is obvious, the detection result can be rapidly judged, and the operation is simple. By adding the PCR enhancer, the reaction efficiency and sensitivity are remarkably improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of virus detection, and in particular relates to a LAMP primer set, a kit and a method for detecting monkeypox virus based on a double-visualized loop-mediated isothermal amplification method. Background Art

[0002] Since May 7, 2022, monkeypox virus outbreaks have occurred in several European and American countries. Cases of monkeypox have been found in several countries where monkeypox is not prevalent and are considered "atypical". On July 23, the World Health Organization declared the monkeypox outbreak an "international public health emergency". As of October 19, 2022, a total of 75,141 cases of infection have been reported worldwide, and monkeypox cases have been found in more than 100 countries. The monkeypox virus continues to spread in many countries, so it is very necessary to expand the detection system for the monkeypox virus.

[0003] At present, fluorescent quantitative PCR is the main detection method for monkeypox virus at home and abroad, and other methods are less studied. In addition, the existing devices for monitoring monkeypox virus are not easy to carry and cannot be used for rapid detection in airports, train stations, and seaports. Therefore, it is urgent to establish a rapid, sensitive, and accurate dual-visualization loop-mediated isothermal amplification detection method to provide emergency technical reserves for responding to the monkeypox epidemic. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a LAMP primer set, a kit and a method for detecting monkeypox virus based on a dual visualized loop-mediated isothermal amplification method. The LAMP primer set has high sensitivity and strong specificity. The method is simple and fast to operate, which can not only improve the detection accuracy, but also greatly reduce the missed detection rate.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] On the one hand, the present invention provides a LAMP primer set for detecting monkeypox virus based on a dual-visualized loop-mediated isothermal amplification method, wherein the LAMP primer set includes a primer set for detecting the J2R gene of the monkeypox virus and a primer set for detecting the F3L-F4L gene of the monkeypox virus;

[0007] The primer set for detecting the monkeypox virus J2R gene includes an F3 primer, a B3 primer, a FIP primer, a BIP primer, a LoopF ​​primer and a LoopB primer;

[0008] The nucleotide sequence of the F3 primer is shown in SEQ ID NO.1, the nucleotide sequence of the B3 primer is shown in SEQ ID NO.2, the nucleotide sequence of the FIP primer is shown in SEQ ID NO.3, the nucleotide sequence of the BIP primer is shown in SEQ ID NO.4, the nucleotide sequence of the LoopF ​​primer is shown in SEQ ID NO.5, and the nucleotide sequence of the LoopB primer is shown in SEQ ID NO.6;

[0009] The primer set for detecting the monkeypox virus F3L-F4L gene includes an F3' primer, a B3' primer, a FIP' primer, a BIP' primer, a LoopF' primer and a LoopB' primer;

[0010] The nucleotide sequence of the F3' primer is shown in SEQ ID NO.7, the nucleotide sequence of the B3' primer is shown in SEQ ID NO.8, the nucleotide sequence of the FIP' primer is shown in SEQ ID NO.9, the nucleotide sequence of the BIP' primer is shown in SEQ ID NO.10, the nucleotide sequence of the LoopF' primer is shown in SEQ ID NO.11, and the nucleotide sequence of the LoopB' primer is shown in SEQ ID NO.12.

[0011] Optionally, the molar ratio of the F3 primer, the B3 primer, the FIP primer, the BIP primer, the LoopF ​​primer and the LoopB primer is: 0.2:0.2:1.2:1.2:0.8:0.8;

[0013] The molar ratio of the F3' primer, the B3' primer, the FIP' primer, the BIP' primer, the LoopF' primer and the LoopB' primer is:

[0014] 0.2:0.2:1.2:1.2:0.8:0.8.

[0015] In a second aspect, the present invention provides use of the above-mentioned LAMP primer set in preparing a kit for detecting monkeypox virus.

[0016] In a third aspect, the present invention provides a kit for detecting monkeypox virus based on a dual-visualized loop-mediated isothermal amplification method, wherein the kit comprises the above-mentioned LAMP primer set.

[0017] Optionally, the kit further comprises Bst2.0 DNA polymerase, LAMP reaction solution, positive control and negative control.

[0018] Optionally, the kit further comprises a reaction buffer, a neutral red staining solution and a PCR enhancer.

[0019] Optionally, the reaction buffer contains components with the following concentrations: 8 mM MgSO4, 10 mM (NH4)2SO4, 50 mM KCl, 0.1% Tween-20, 0.7 M betaine, and the pH is adjusted to 8.8@25°C.

[0020] Optionally, the molar concentration of the neutral red staining solution is 62.5-250 μmol / L.

[0021] Optionally, the PCR enhancer includes guanidine hydrochloride and bovine serum albumin.

[0022] In the present invention, the LAMP primer set can be used for dual-target detection of the F3L-F4L gene and the J2R gene of the monkeypox virus, which not only improves the detection accuracy but also greatly reduces the missed detection rate.

[0023] In the present invention, neutral red dye solution is added as a pH indicator before the reaction, and there is no need to open the cover, thereby reducing aerosol pollution. The color change before and after the reaction is obvious, the test result can be quickly determined, and the operation is simple.

[0024] In the present invention, the addition of a PCR enhancer can significantly improve the efficiency and sensitivity of the LAMP reaction, thereby improving the detection effect of the kit.

[0025] In a fourth aspect, the present invention provides a method for detecting monkeypox virus based on a dual-visualization loop-mediated isothermal amplification method, wherein the method comprises using the above-mentioned kit to perform a dual-visualization loop-mediated isothermal amplification reaction on the genomic DNA of the sample to be tested.

[0026] Optionally, the temperature of the dual visualization loop-mediated isothermal amplification reaction is 64-65° C., and the time of the dual visualization loop-mediated isothermal amplification reaction is 55-60 min.

[0027] Optionally, after the dual visualization loop-mediated isothermal amplification reaction is completed, a step of enzyme inactivation at 85° C. for 10 min is also included.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] 1) The LAMP primer set provided by the present invention has high sensitivity and strong specificity.

[0030] 2) The kit for detecting monkeypox virus based on the dual visualization loop-mediated isothermal amplification method provided by the present invention can dual-target detect the F3L-F4L gene and J2R gene of the monkeypox virus, which not only improves the detection accuracy, but also greatly reduces the missed detection rate.

[0031] 3) The present invention adds an appropriate amount of neutral red pH indicator dye before the reaction, and there is no need to open the cover, which reduces aerosol pollution. The color changes before and after the reaction are obvious, the test results can be quickly determined, and the operation is simple.

[0032] 4) The present invention improves the reaction efficiency and detection sensitivity by adding PCR enhancers (guanidine hydrochloride, bovine serum albumin), uses a simple method to achieve the standards of complex technologies, and realizes accurate and high-throughput diagnosis. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 This is a result diagram of the sensitivity of the single gene visualized LAMP in detecting the J2R gene of monkeypox virus of the present invention;

[0034] Figure 2 This is a result diagram of the sensitivity of the single gene visualized LAMP in detecting the F3L-F4L gene of monkeypox virus of the present invention;

[0035] Figure 3 The effect of adding bovine serum albumin (BSA) on LAMP in the present invention;

[0036] Figure 4 This is the effect of adding guanidine hydrochloride on LAMP in the present invention. DETAILED DESCRIPTION

[0037] The present application is further described below in conjunction with specific embodiments. The following are only a few embodiments of the present application, and are not intended to limit the present application in any form. Although the present application discloses the following preferred embodiments, they are not intended to limit the present application. Any technician familiar with the profession, without departing from the scope of the technical solution of the present application, using the above disclosed technical content to make some changes or modifications are equivalent to equivalent implementation cases and are within the scope of the technical solution.

[0038] Unless otherwise specified, the raw materials in the examples of the present application were purchased from commercial sources and used directly without any special treatment.

[0039] Unless otherwise specified, the analysis methods in the examples all adopt conventional settings and conventional analysis methods of instruments or equipment.

[0040] Example 1

[0041] 1. LAMP primer design:

[0042] (1) According to literature reports, the specific J2R gene (GenBank, ON568298.1 194,505-195,554) and F3L-F4L gene (GenBank, NC_003310.148048-50476) of monkeypox virus were selected as target genes for amplification, and the accuracy of the gene sequences was determined;

[0043] (2) Based on the sequence determined in step (1), a set of specific primers was designed for the specific conserved regions of the J2R gene and the F3L-F4L gene using the LAMP primer explorer online website (http: / / primer explorer.jp / lampv5e / index.html). These primers targeted 6 to 8 different regional positions, respectively. Each set of primers included a pair of F3 / B3 outer primers, a pair of FIP / BIP inner primers, and a pair of Loop F / Loop B ring primers.

[0044] The nucleotide sequences of the LAMP primer set of the monkeypox virus J2R gene used in the present invention are as follows:

[0045] F3 is shown in SEQ ID NO.1: ACGGAGTATCCGGATACACG

[0046] B3 is shown in SEQ ID NO.2: GATTCGCTGAGACCGGTAGT

[0047] FIP is shown in SEQ ID NO.3:

[0048] TATCTGTGGAAGAGACGGTGTGAG-TACCGGAGACGTCATCTGT TC

[0049] BIP is shown in SEQ ID NO.4:

[0050] TGCGAACCCGTAACCAGCAATAC-GAGTACACGATGTGTCGTTG AC

[0051] LoopF ​​is shown in SEQ ID NO.5: AATATGTTCCGGGACCACACGG

[0052] LoopB is shown in SEQ ID NO.6: CGATGTGGAAATTAACCTGTATCCA

[0053] The nucleotide sequences of the LAMP primer set of the monkeypox virus F3L-F4L gene used in the present invention are as follows:

[0054] F3' is shown in SEQ ID NO.7: ATCCTCTGGTGGTTCGTCG

[0055] B3' is shown in SEQ ID NO.8: CGAACCTCCATTAGTTAGACACG

[0056] FIP' is shown in SEQ ID NO.9:

[0057] AATCCATCTCCTCCAGAATCTCCAG-GAATGTAGCTCTGATTAAC CCGTC

[0058] BIP' is shown in SEQ ID NO.10:

[0059] CCTTGTTTTCATGTATCGATTGCGT-AAACAACACTTTAAGCCTCC CA

[0060] LoopF' is shown in SEQ ID NO.11: ACCAGCATCACCTATAGAT

[0061] LoopB' is shown in SEQ ID NO.12: AACATTAAGATTGCGAAATGCTCT.

[0062] 2. Construction and optimization of real-time LAMP system:

[0063] The primer concentration ratio, dNTPs concentration, Mg 2+ The concentration and reaction temperature were optimized by single factor variation, and other conditions remained unchanged. The real-time LAMP reaction was performed according to the reaction system and reaction conditions before optimization, and the appropriate reaction conditions were determined by the Ct value and the fluorescence value of the amplified product.

[0064] The reference reaction conditions were set as follows: 65°C for 10 s; 65°C for 30 s, and fluorescence collection at 65°C for 30 s, for a total of 60 cycles; after the reaction, a melting curve analysis was performed on the amplified product, and the melting curve program was set as follows: heating from 75°C to 95°C at a rate of 0.1°C / 5 s, collecting a fluorescence signal once every 0.1°C increase in temperature to generate a melting curve.

[0065] The final dual real-time LAMP reaction system (25 μL) was determined as shown in Table 1.

[0066] Table 1 Dual real-time LAMP reaction system

[0067]

[0068] The dual LAMP reaction had the same reaction volume (25 μL) as the single reaction. The concentration of the dual LAMP primer set was half of that of the single reaction, while the concentrations of other components remained unchanged.

[0069] The above reaction system also includes a reaction buffer (containing 2.5 μL buffer reagent and 5 μL other reagents), specifically including: buffer reagent (2mM MgSO4, 10mM (NH4)2SO4, 50mM KCl, 0.1% Tween-20), other reagents (6mM MgSO4, 0.7M betaine).

[0070] 1 μL each of monkeypox virus plasmid J2R and F3L-F4L DNA templates, and the blank control was replaced with an equal amount of ddH2O.

[0071] Example 2

[0072] 1. Establishment of visual LAMP system:

[0073] The experiment found that the detection system is very easy to be contaminated, mainly due to the aerosol contamination caused by the terminal product after opening the cover. In order to avoid aerosol contamination caused by the reaction system, 2 μL of 0.5% neutral red solution diluted 10 times was added to the reaction system of Example 1, and the pH indicator was used to directly observe the detection results with the naked eye after the reaction was completed. The color development results were clearly distinguished and the operation was simple.

[0074] In order to optimize the color development system, the concentration of neutral red in the system was set to four gradients of 62.5 μmol / L, 125 μmol / L, 187.5 μmol / L and 250 μmol / L. The reaction was carried out at 65°C in a thermostat for 60 min, and the enzyme was inactivated at 85°C for 10 min. After the reaction, the color development results were visualized using a camera with white paper as the background. The color developer concentration with the most obvious contrast between positive and negative can be screened by naked eye.

[0075] Neutral red changes in the range of 6.4 (red) to 8.0 (yellow). Principle of color change: the system is weakly alkaline before the reaction (the pH of the buffer is adjusted to 8.8). During the LAMP reaction, pyrophosphate and hydrogen ions are released as byproducts, and the pH gradually becomes acidic. Therefore, a positive result is that the reaction solution changes from orange-yellow to purple-red, while a negative result is that the color remains unchanged and is still orange-yellow.

[0076] 2. Sensitivity detection of visual LAMP system:

[0077] The target recombinant plasmid containing monkeypox virus J2R and F3L-F4L was diluted 10 times in a gradient manner, and the copy number of 10 was selected after absolute quantification. 4 ~10 0 The number of copies / μL was used as a template to verify the analytical sensitivity, and negative controls and repeated experiments were set up to verify the analytical sensitivity of single / double visualized LAMP. Figure 1 and Figure 2 shown.

[0078] Through repeated experiments, the lowest detection limit of single-target visualized LAMP was (J2R gene: 10 copies / μL, F3L-F4L gene: 100 copies / μL). The lowest detection limit of dual-target visualized LAMP was (J2R gene: 1 copy / μL, F3L-F4L gene: 10 copies / μL).

[0079] Example 3

[0080] Most colorimetric LAMP tests have lower sensitivity than standard qPCR tests. To address the shortcomings of the prior art, which have long detection times and low sensitivity, the present invention designs experiments to verify the role of PCR enhancers in LAMP and the effects of different concentrations of additives on LAMP:

[0081] A PCR enhancer was added to the reaction system in Example 2 where a neutral red solution had been added, and a concentration gradient of the enhancer was prepared (BSA: 5 μL, concentration 1 mg / mL; guanidine hydrochloride: 0.5 μL, concentration 1 mol / L; concentrations 0 mM, 20 mM, 40 mM, 60 mM, 80 mM). The Ct values ​​of the PCR enhancer without and with the PCR enhancer added were compared, and a visualization experiment was performed using a plasmid template with the minimum detection limit of the copy number without and with the PCR enhancer added. The experimental results are shown in FIG. Figure 3 and Figure 4 shown.

[0082] The results showed that bovine serum albumin (BSA) could enhance the LAMP, and guanidine hydrochloride could improve the amplification efficiency and detection sensitivity of LAMP.

[0083] The above are only a few embodiments of the present application and do not constitute any form of limitation to the present application. Although the present application is disclosed as above with preferred embodiments, it is not intended to limit the present application. Any technician familiar with the profession, without departing from the scope of the technical solution of the present application, using the technical content disclosed above to make slight changes or modifications are equivalent to equivalent implementation cases and fall within the scope of the technical solution.

Claims

1. A LAMP primer set for detecting monkeypox virus based on a dual-visualized loop-mediated isothermal amplification method, characterized in that: The LAMP primer set includes a primer set for detecting the J2R gene of the monkeypox virus and a primer set for detecting the F3L-F4L gene of the monkeypox virus; The primer set for detecting the monkeypox virus J2R gene includes an F3 primer, a B3 primer, a FIP primer, a BIP primer, a LoopF ​​primer and a LoopB primer; The nucleotide sequence of the F3 primer is shown in SEQ ID NO.1, the nucleotide sequence of the B3 primer is shown in SEQ ID NO.2, the nucleotide sequence of the FIP primer is shown in SEQ ID NO.3, the nucleotide sequence of the BIP primer is shown in SEQ ID NO.4, the nucleotide sequence of the LoopF ​​primer is shown in SEQ ID NO.5, and the nucleotide sequence of the LoopB primer is shown in SEQ ID NO.6; The primer set for detecting the monkeypox virus F3L-F4L gene includes an F3' primer, a B3' primer, a FIP' primer, a BIP' primer, a LoopF' primer and a LoopB' primer; The nucleotide sequence of the F3' primer is shown in SEQ ID NO.7, the nucleotide sequence of the B3' primer is shown in SEQ ID NO.8, the nucleotide sequence of the FIP' primer is shown in SEQ ID NO.9, the nucleotide sequence of the BIP' primer is shown in SEQ ID NO.10, the nucleotide sequence of the LoopF' primer is shown in SEQ ID NO.11, and the nucleotide sequence of the LoopB' primer is shown in SEQ ID NO.

12.

2. The LAMP primer set for detecting monkeypox virus based on dual visualization loop-mediated isothermal amplification according to claim 1, characterized in that: The molar ratio of the F3 primer, the B3 primer, the FIP primer, the BIP primer, the LoopF ​​primer and the LoopB primer is: 0.2:0.2:1.2:1.2:0.8:0.8； The molar ratio of the F3' primer, the B3' primer, the FIP' primer, the BIP' primer, the LoopF' primer and the LoopB' primer is: 0.2:0.2:1.2:1.2:0.8:0.8。 3. Use of the LAMP primer set according to claim 1 or 2 in preparing a kit for detecting monkeypox virus.

4. A kit for detecting monkeypox virus based on a dual visualization loop-mediated isothermal amplification method, characterized in that: The kit comprises the LAMP primer set according to claim 1 or 2.

5. A kit for detecting monkeypox virus based on dual visualization loop-mediated isothermal amplification according to claim 4, characterized in that: The kit also includes Bst2.0 DNA polymerase, LAMP reaction solution, positive control and negative control.

6. A kit for detecting monkeypox virus based on dual visualization loop-mediated isothermal amplification according to claim 5, characterized in that: The kit also includes a reaction buffer, a neutral red staining solution and a PCR enhancer.

7. A kit for detecting monkeypox virus based on dual visualization loop-mediated isothermal amplification according to claim 6, characterized in that: The reaction buffer contains the following components: 8 mM MgSO4, 10 mM (NH4)2SO4, 50 mM KCl, 0.1% Tween-20, 0.7 M betaine, and the pH is adjusted to 8.8@25°C.

8. A kit for detecting monkeypox virus based on dual visualization loop-mediated isothermal amplification according to claim 6, characterized in that: The molar concentration of the neutral red staining solution is 62.5 to 250 μmol / L; Preferably, the PCR enhancer comprises guanidine hydrochloride and bovine serum albumin.

9. A method for detecting monkeypox virus based on double visualization loop-mediated isothermal amplification, characterized in that: The method comprises using the kit described in any one of claims 4 to 8 to perform a double visualized loop-mediated isothermal amplification reaction on the genomic DNA of the sample to be tested.

10. The method for detecting monkeypox virus based on dual visualization loop-mediated isothermal amplification according to claim 9, characterized in that: The temperature of the dual visualization loop-mediated isothermal amplification reaction is 64-65° C., and the time of the dual visualization loop-mediated isothermal amplification reaction is 55-60 min; Preferably, after the dual visualization loop-mediated isothermal amplification reaction is completed, a step of enzyme inactivation at 85° C. for 10 min is further included.

Images