Cryopreservation of NK cell products for spot immunotherapy

Abstract

Provided herein are methods for inactivating effector cells (e.g., NK cells, including cells as spot type cells for adoptive cell therapy). The inactivated cells can be cryopreserved after inactivation. The inactivated cells may be expanded and / or activated prior to inactivation, and may or may not include a transgene, which may optionally encode a chimeric antigen receptor and / or a T cell receptor. In certain embodiments, disclosed are methods for inactivating NK cells comprising treating with an inactivating agent, which is a kinase inhibitor, such as an mTOR inhibitor, and / or a tyrosine kinase inhibitor, such as rapamycin and / or dasatinib. Also provided herein are inactivated and cryopreserved NK cells, and methods of making and / or using the same for treating a subject in need thereof (e.g., treating a subject having cancer).

Description

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to U.S. Provisional Patent Application Serial No. 63 / 364,516, filed on May 11, 2022, which is incorporated herein by reference in its entirety.

[0003] Sequence Listing

[0004] This application contains a sequence listing that has been submitted in ST26 format and is hereby incorporated by reference in its entirety. The ST26 copy was created on May 3, 2023, named MDAC_P1326_Sequence_Listing.xml, and is 6,349 bytes in size. background 1. Technical Field

[0005] The present disclosure generally relates to at least the fields of cell biology, molecular biology, biochemistry, immunology, and medicine.

[0006] 2. Description of related technologies

[0007] The cultivation and storage of cells such as mammalian cells for in vitro research or ex vivo culture and / or storage so as to be applied to humans or animals later are important tools for studying and treating human diseases. Cell culture and storage are widely used in the production of various bioactive products, such as viral vaccines, monoclonal antibodies, polypeptide growth factors, hormones, enzymes and tumor-specific antigens. However, many culture media or methods for cultivating and / or storing cells comprise compositions that may have a negative impact on the maintenance of cell growth and / or cultivated cells, and / or are not enough to protect cells from the impact of storage consequences (e.g., cryopreservation).

[0008] In addition, there are currently several cell banks that store cells such as human placental or umbilical cord stem cells for future medical use. There are also cell banks that store cells cultured in, for example, bioreactors for scientific purposes and medical treatments. What all cell banks have in common is that the cells are usually cryopreserved by liquid nitrogen. Cryopreservation of cells using current methods may have adverse effects on cell function and / or viability.

[0009] Currently, FDA-approved CAR T cells are autologous and manufactured for each patient in a highly personalized manner, and while this approach has proven to be effective, it is a time-consuming and expensive endeavor. The development of readily available off-the-shelf allogeneic products provides the opportunity to generate cell banks in advance that can be used as needed. Off-the-shelf effector cell products (e.g., NK cells, CAR-NK cells, etc.) must meet two conditions: (i) donor cells must be able to be infused without regard to HLA matching, and (ii) donor cells must remain functional after cryopreservation. The inventors have previously demonstrated that CAR19 / IL-15 cord blood (CB)-derived NK cells that are HLA-mismatched with the recipient can be safely infused into subjects (see, e.g., Liu E, Marin D, Banerjee P et al., Use of CAR-Transduced Natural Killer Cells in CD19-Positive Lymphoid Tumors. N Engl J Med. 2020; 382(6):545-553, which is incorporated herein for the purposes described herein), which addresses the first requirement for an off-the-shelf product. However, in contrast to T cells (the cytotoxicity of T cells is not significantly affected by freeze-thaw cycles), the expansion, survival, homing to the disease site and / or the ability of NK cells to kill tumor cells in vivo are severely affected by cryopreservation (see, e.g., Mark C, Czerwinski T, Roessner S et al., Cryopreservation impairs 3-D migration and cytotoxicity of natural killer cells. Nat Commun. 2020; 11(1): 5224; and Miller JS, Rooney CM, Curtsinger J et al., Expansion and homing of adoptively transferred human natural killer cells in immunodeficient mice varies with product preparation and invivo cytokine administration: implications for clinical therapy. Biol Blood Marrow Transplant. 2014; 20(8): 1252-1257; each of which is incorporated herein for the purposes described herein). Due to this limitation, clinical trials testing the safety and efficacy of NK cell therapy usually have to use fresh expanded NK cells.

[0010] The present disclosure fulfills a need in the art for improved methods of storing cells.

[0011] Overview

[0012] The present disclosure relates to cells, inactivation and / or cryopreservation techniques, and methods of using cells and / or compositions produced as described herein. In general, the present disclosure relates to immune cells, such as NK cells, which can be inactivated, cryopreserved, and then thawed using one or more inactivating agents as described herein. Compared with cells cryopreserved without the disclosed method, these cells are stronger in terms of viability and / or cytotoxicity to tumor cells. In a specific embodiment, the cell inactivation method described herein stops the cytolytic activity, cytokine production, and / or proliferation of NK cells, thereby allowing cell viability to be enhanced after cryopreservation, and in a specific embodiment, generates cells to be used in a "spot type". After cell inactivation and cryopreservation, the thawed cells can be used immediately, amplified, or further manipulated, such as recombinant techniques, including transfection. In some cases, whether or not the disclosed method is used, the cells are cryopreserved for a second or more times, and before the second or more cryopreservations, the cells may or may not be further manipulated, such as recombinant techniques, including but not limited to transduction, transfection, and / or gene editing.

[0013] In some embodiments, disclosed herein is a method for inactivating natural killer (NK) cells, comprising treating NK cells with an effective amount of one or more inactivating agents under conditions that produce inactivated NK cells. In some embodiments, the inactivating agent is a kinase inhibitor. In some embodiments, the inactivating agent is a mechanistic target of rapamycin (mTOR) inhibitor. In some embodiments, the mTOR inhibitor is rapamycin, everolimus and / or temsirolimus. In some embodiments, the mTOR inhibitor is rapamycin. In some embodiments, the inactivating agent is a tyrosine kinase (TK) inhibitor. In some embodiments, the TK inhibitor is dasatinib, nilotinib, lorlatinib, brigatinib, ceritinib, alectinib, crizotinib, bosutinib, ponatinib, saracatinib, imatinib, zanubrutinib, acalabrutinib, ibrutinib, capmatinib, pesidatinib, dacomitinib, osimertinib, erlotinib, gefitinib, lapatinib, afatinib, pemigatinib, erdafitinib, nintedanib , giltertinib, midostaurin, tucatinib, neratinib, baricitinib, ruxolitinib, fedratinib, tofacitinib, ripretinib, selumetinib, binitinib, cobimetinib, trametinib, upadatinib, afatinib, septanib, cabozantinib, fostamatinib, larotrectinib, entrectinib, axitinib, regorafenib, pazopanib, sorafenib, lenvatinib, vandetanib and / or sunitinib. In some embodiments, the TK inhibitor is a BCR-Abl inhibitor. In some embodiments, the TK inhibitor is dasatinib, nilotinib, bosutinib, ponatinib and / or imatinib. In some embodiments, the TK inhibitor is dasatinib and / or nilotinib. In some embodiments, the TK inhibitor is dasatinib. In some embodiments, the NK cells are not treated with bosutinib. In some embodiments, the NK cells are not treated with nilotinib. In some embodiments, the NK cells are not treated with saracatinib. In some embodiments, the NK cells are not treated with an mTOR inhibitor.

[0014] In some embodiments, the NK cells are treated with an inactivator at any time point during the NK cell culture. In some embodiments, the treatment lasts about 24 to about 96 hours, about 36 to about 84 hours, or about 48 to about 72 hours. In some embodiments, the treatment lasts about 24 hours, about 48 hours, or about 72 hours. In some embodiments, the NK cells are treated with an inactivator at a concentration of about 1 to about 1000 nM. In some embodiments, the NK cells are treated with an inactivator at a concentration of about 5 to about 500 nM. In some embodiments, the NK cells are treated with an inactivator at a concentration of about 20 to about 200 nM. In some embodiments, the NK cells are treated with an inactivator at a concentration of about 30 to about 100 nM. In some embodiments, relative to activated NK cells, inactivated NK cells have increased expression of one or more of C-kit, CCR-5, CD62L and / or CXCR4, and / or decreased expression of one or more of NKG2D, DNAM, OX-40, TRAIL, HLA-DR, CD2, CD25, ICOS and / or CD95.

[0015] In some embodiments, NK cells are derived from human peripheral blood mononuclear cells (PBMC), unstimulated leukocyte separation (leukapheresis) products (PBSC), human embryonic stem cells (hESC), hematopoietic stem cells, induced pluripotent stem cells (iPSC), bone marrow, NK cell lines and / or cord blood. In some embodiments, NK cells are separated from blood. In some embodiments, NK cells are separated from one or more cord blood units. In some embodiments, NK cells are induced NK cells produced by precursor cells. In some embodiments, precursor cells are hESC, hematopoietic stem cells, iPSC and / or induced hematopoietic stem cells.

[0016] In some embodiments, NK cells include transgenics. In some embodiments, transgenics encode chimeric antigen receptors (CAR), T cell receptors (TCR), non-naturally occurring or naturally occurring variants of FcγRIII (CD16), interleukins (e.g., interleukin 15 (IL-15), interleukin 15 receptor (IL-15R) or variants thereof, interleukin 12 (IL-12), interleukin 21 (IL-21), interleukin 18 (IL-18), interleukin-12 receptor (IL-12R) or variants thereof), human leukocyte antigens (e.g., human leukocyte antigen G (HLA-G), human leukocyte antigen E (HLA-E)), leukocyte surface antigen differentiation cluster CD47 (CD47), or any combination of two or more thereof. In some embodiments, NK cells include transgenic CARs. In some embodiments, NK cells include more than one transgenic CAR.

[0017] In some embodiments, NK cells include mutations in endogenous genes. In some embodiments, endogenous genes are immunomodulatory genes. In some embodiments, endogenous genes are NKG2A, SIGLEC-7, LAG3, TIM3, CISH, FOXO1, TGFBR2, TIGIT, CD96, ADORA2, NR3C1, PD1, PDL-1, PDL-2, CD47, SIRPA, SHIP1, ADAM17, RPS6, 4EBP1, CD25, CD40, IL21R, ICAM1, CD95, CD80, CD86, IL10R, TDAG8, CD5, CD7, SLAMF7, CD38, LAG3, TCR, β2-microglobulin, HLA, CD73, GCR, CREM, ICER, CREB1 and / or CD39.

[0018] In some embodiments, NK cells are activated and / or expanded prior to inactivation. In some embodiments, NK cells are activated and / or expanded by culturing with a cell culture solution comprising universal antigen presenting cells (uAPC), IL-2, IL-12, IL-15 and / or IL-18.

[0019] In some embodiments, the inactivated NK cells are frozen and cryopreserved for any period of time. In some embodiments, the inactivating agent is contained in a cryopreservation medium. In some embodiments, the inactivating agent is washed away from the inactivated NK cells before cryopreservation.

[0020] In some embodiments, the present invention also provides NK cells produced by any one or any combination of the methods described herein. In some embodiments, the present invention provides inactivated NK cells of cryopreservation produced by any one or more of the methods described herein. In some embodiments, the inactivated NK cells of cryopreservation are thawed to produce thawed inactivated NK cells. In some embodiments, the inactivated NK cells of thaw are washed to remove inactivating agents. In some embodiments, the inactivated NK cells of thaw are reactivated in the absence of inactivating agents, thereby producing reactivated NK cells. In some embodiments, the reactivated NK cells have an increased survival rate relative to the thawed cryopreserved NK cells of non-inactivated. In some embodiments, the reactivated NK cells include transgenes, and the transgene expression level is not significantly reduced relative to the thawed cryopreserved NK cells of non-inactivated. In some embodiments, the transgene expression level is increased relative to the thawed cryopreserved NK cells of non-inactivated. In some embodiments, relative to the thawed cryopreserved NK cells of non-inactivated, the reactivated NK cells have an increased tumor cell killing rate after cryopreservation.

[0021] In some embodiments, the present invention also provides a method for treating a subject in need thereof, comprising administering to the subject a therapeutically effective amount of the reactivated NK cells described herein. In some embodiments, the subject has cancer. In some embodiments, the cancer is hematological. In some embodiments, the cancer comprises a solid tumor. In some embodiments, the cancer is of hematopoietic origin. In some embodiments, the reactivated NK cells are allogeneic or autologous relative to the subject. In some embodiments, the reactivated NK cells are allogeneic relative to the subject. In some embodiments, the probability of survival of the subject is improved compared to a subject not treated with an effective dose of the reactivated NK cells.

[0022] Embodiments of the present disclosure include methods for maintaining cell population viability exceeding at least 50% after cryopreservation of a cell population, comprising the following steps: before cryopreservation, subjecting the cell population to an effective amount of one or more inactivating agents (e.g., kinase inhibitors) to inactivate the cells, cryopreserving the cells, and thawing the cell population, wherein after thawing, the viability of the cell population exceeds at least 50%. In some cases, after the cell population is cryopreserved, the viability of the cell population after the cells are thawed is at least more than 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99%.

[0023] It is contemplated herein that the method for extending the shelf life of cell mass (e.g., effector cells, such as NK cells) after cell mass cryopreservation is included in the step of accepting an effective amount of an inactivator (e.g., a kinase inhibitor) to the cell mass before cryopreservation. In some embodiments, compared with the shelf life of the cell cryopreserved in the absence of an inactivator (e.g., a kinase inhibitor) before cryopreservation, the shelf life can be extended by about 1-4, 1-2, 1-3, 2-4, 2-3 or 3-4 weeks, 1-12, 2-12, 3-12, 4-12, 5-12, 6-12, 7-12, 8-12, 9-12, 10-12 or 11-12 months, or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 years or longer. The cell may or may not include one or more transgenes, such as but not limited to chimeric antigen receptors (CARs), engineered cytokines and / or T cell receptors (TCRs). In certain embodiments, the cell can be combined in vivo or ex vivo with single, bispecific and / or multispecific antibodies. After the cells are cryopreserved and thawed, an effective amount of cells can be delivered to a subject in need. Relative to the recipient, the cell can be allogeneic or autologous, and the subject may suffer from cancer, autoimmune diseases, graft-versus-host disease, allogeneic transplant rejection and / or inflammatory conditions, including bacterial, viral or fungal infections. In some embodiments, the subject may also have important organ damage that requires regeneration and repair.

[0024] Embodiments of the present disclosure include methods for thawing a cell population that has been cryopreserved using any method disclosed herein, such as exposing the cell population to an effective amount of an inactivating agent (e.g., a kinase inhibitor) to produce an inactivated cell population, cryopreserved cells, and exposing the cryopreserved cell population to a suitable thawing condition before cryopreservation. Thawing conditions may or may not be standard conditions in the art. For example, in a particular embodiment, frozen cells may be thawed quickly (<1 minute), such as in a 37°C water bath, and the thawed cells may then be diluted, including slow dilution, and optionally using a preheated growth medium. In particular cases, thawed cells are seeded at high density to optimize recovery.

[0025] Certain embodiments of the present disclosure relate to methods of delivering cells to a target site or tissue in an individual, comprising the step of injecting or administering an effective amount of cells intravenously, topically, intrathecally, intraperitoneally, subcutaneously, or to the target site or tissue substantially immediately and / or substantially directly after thawing the cells, including wherein the cells are cryopreserved in a cryopreservation medium composition of the present disclosure. In specific embodiments, the target site or tissue is cancerous, such as a solid tumor, although hematological malignancies may also be treated in the methods of the present disclosure.

[0026] Other objects, features and advantages of the present invention will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples, although indicating preferred embodiments of the present invention, are given by way of illustration only, because those skilled in the art will clearly know various changes and modifications within the spirit and scope of the present invention from the detailed description.

[0027] BRIEF DESCRIPTION OF THE DRAWINGS

[0028] The following drawings constitute part of this specification and are used to further illustrate certain aspects of the present disclosure. The subject matter of the present disclosure may be better understood by referring to one or more of these drawings in combination with the detailed description of specific embodiments presented herein.

[0029] Figure 1 It is a schematic diagram describing a strategy for NK cell activation / expansion followed by inactivation by treatment with an inactivating agent (e.g., a kinase inhibitor, e.g., a tyrosine kinase (TK) inhibitor, e.g., dasatinib, nilotinib, imatinib, bosutinib) or an mTOR inhibitor for 24, 48 or 72 hours (hr) in preparation for storage (e.g., cryopreservation). NK cells are isolated and / or derived from a suitable source (e.g., blood, e.g., cord blood), optionally pre-activated with a cytokine cocktail (e.g., IL-12, Il-15 and / or IL-18), optionally expanded and / or activated (e.g., by including universal antigen presenting cells (APCs) and / or IL-2), and once expanded and / or activated, the NK cells are temporarily inactivated (e.g., induced to enter a quiescent state) by treatment with an inactivating agent, after a set period of time, the inactivating agent is removed (e.g., by washing) and the cells can then be stored (e.g., by cryopreservation).

[0030] Figure 2 A-2B shows how the addition of dasatinib prior to cryopreservation shifts the NK cell phenotype to a less active state when analyzed using mass cytometry. Figure 2(A) and (B) are t-distributed random neighbor embedding (t-SNE) plots showing phenotypic differences between activated NK cells treated with dasatinib and activated NK cells not treated with dasatinib. (A) shows the relative expression of activation and cytotoxicity markers such as CD95, NKG2D, DNAM, OX-40, TRAIL, HLA-DR, CD2, CD25, and ICOS, which show increased expression in NK cells not treated with dasatinib compared to NK cells treated with dasatinib. (B) shows the relative expression of activation and cytotoxicity markers such as CCR5, CD62L, CXCR4, and C-kit, which show decreased expression in NK cells not treated with dasatinib compared to NK cells treated with dasatinib.

[0031] Figure 3 A-3B shows how the addition of dasatinib before cryopreservation improves NK cell viability after thawing without negatively affecting CAR expression. (A) Flow cytometry results are shown, depicting how NK cells treated with dasatinib for 24, 48, or 72 hours (h) before cryopreservation show comparable and / or improved viability compared to NK cells not treated with dasatinib before cryopreservation. The Y-axis quantifies Annexin V levels (a marker of apoptosis), while the X-axis quantifies cell death markers. Highlighted and quantified in the lower left quadrant of each graphical display is the percentage of live cells (60.2% without dasatinib, 61.7% with 24h dasatinib, 68.8% with 48h dasatinib, and 70.9% with 72h dasatinib). (B) Flow cytometry results are shown, depicting how NK cells treated with dasatinib for 24 or 48 hours before cryopreservation show comparable and / or improved chimeric antigen receptor (CAR) expression levels compared to NK cells not treated with dasatinib before cryopreservation. The Y-axis quantifies CD56 levels, while the X-axis quantifies CAR levels. The percentage and mean fluorescence intensity (MFI) of CAR-positive cells for each test condition are shown (57% CAR+, MFI 3724 without dasatinib, 64.9% CAR+, MFI 7987 at 24 hours of dasatinib, and 55.4% CAR+, MFI 4620 at 48 hours of dasatinib).

[0032] Figure 4A-4B shows how adding dasatinib for 48 or 72 hours before cryopreservation improves NK cell viability and anti-tumor cytotoxicity after thawing. (A) is a graph showing NK cell death after cryopreservation and subsequent thawing. NK cell death was measured using Cytotox green dye, and the total cumulative intensity of green was used as a surrogate for the change in NK cell death (Y-axis) over time (X-axis). The data show that adding dasatinib to NK cell cultures for 48 or 72 hours before cryopreservation can enhance NK cell viability after thawing. (B) is a graph showing tumor cell death after cryopreservation and subsequent thawing of NK cells co-cultured with tumor cells (e.g., Raji tumor cells) at a 1:1 effector-target ratio. Tumor cell death was measured using Cytotox green dye, and the total cumulative intensity of green was used as a surrogate for the change in tumor cell death (Y-axis) over time (X-axis) after adding NK cells. This suggests that adding dasatinib to NK cell cultures for 48 or 72 hours before cryopreservation can enhance their anti-tumor potential.

[0033] Figure 5 A-5B shows how adding dasatinib for 48 or 72 hours before cryopreservation improves NK cell anti-tumor cytotoxicity after thawing. (A) is a graph showing the death of Karpas cells (e.g., Karpas-299 cell line, a human non-Hodgkin Ki-positive large cell lymphoma cell line) after co-culture with NK cells inactivated before cryopreservation. Karpas cell death was measured using Cytotox green dye, and the total accumulated intensity of green as a function of the object area of ​​the near-infrared camera (NIR) was used as a surrogate indicator of Karpas cell death (Y-axis) over time (X-axis) after adding thawed NK cells at an effector-target ratio (E:T ratio) of 1:1. (B) is a graph showing dead Raji cells (e.g., a human B lymphoblastoid cell line) after co-culture with NK cells inactivated before cryopreservation. Raji cell death was measured using Cytotox green dye, and the total accumulated intensity of green as a function of the near-infrared camera (NIR) object area was used as a surrogate for Raji cell death (Y-axis) over time (X-axis) after the addition of NK cells at an effector-target ratio (E:T ratio) of 1:1. Together, these results suggest that the addition of dasatinib to NK cell cultures prior to cryopreservation enhances their anticancer potential.

[0034] Figure 6 A-6B shows how the addition of dasatinib prior to cryopreservation improves NK cell anti-tumor cytotoxicity in vivo and improves survival in vivo in Raji-NSG (e.g., NOD scidγ genotype) mice. (A) is a graph showing Raji tumor cell infusion and simultaneous administration of approximately 1×10 7Average irradiance (p / s / cm 2 / sr, a surrogate marker of tumor growth) (Y-axis) versus time (days, X-axis). The results showed that NK cells treated with dasatinib for 24 hours, 48 ​​hours, or 72 hours before cryopreservation showed enhanced inhibition of tumor growth compared to mice treated with thawed NK cells that were not treated with dasatinib before cryopreservation or mice with tumors that were not treated with NK cells. (B) is a graph showing that injection of Raji tumor cells and NK cells (approximately 1×10 7 The results show that thawed NK cells treated with dasatinib for 24h, 48h or 72h before cryopreservation showed better tumor growth inhibition effect compared with mice treated with thawed NK cells not treated with dasatinib or mice with tumors not treated with NK cells.

[0035] Figure 7 A-7D shows how the addition of dasatinib prior to cryopreservation improves NK cell antitumor cytotoxicity and NK cell engraftment in vivo. (A) is a schematic diagram outlining the experimental procedures performed (animals were irradiated on day -4; 0.5x10 6 MM1S cells; 5x10 6 Fresh CAR NK cells or 10x10 6 (B) shows bioluminescent imaging of mice engrafted with MM1s cells (CD70+ multiple myeloma cells) transduced with firefly luciferase (FFluc) without any treatment (MM1s only), fresh NK cells on day 15 transduced with a construct comprising CD70 CAR and IL-15, thawed NK cells containing the same constructs treated with dasatinib for 24 hours or 72 hours before cryopreservation and frozen on day 15 or day 18, respectively, or NK cells containing the same constructs cryopreserved and thawed on day 18 without dasatinib treatment before cryopreservation. (C) is a graphical quantification of the mean irradiance of bioluminescence shown in (B). (D) is a graphical quantification of the percentage of NK cell engraftment in vivo on day 10 after NK cells were infused into the mice shown in (B).

[0036] Figure 8A-8B shows that CAR NK cells cultured for 14 days and then treated with dasatinib for 24 or 72 hours before freezing were superior in in vivo tumor control compared to CAR NK cells stored using a standard freezing medium protocol without inactivation. In addition, dasatinib-treated cells showed similar in vivo anti-tumor control compared to fresh CAR NK cells (cultured for 14 days). (A) Bioluminescence imaging (BLI) shows the growth of MM1S (CD70+ multiple myeloma cells transduced with firefly luciferase (FFluc)) tumors over time (days -3, 4, 15, 22, and 29) in mice receiving MM1S cells alone, MM1S cells plus dasatinib, MM1S cells plus fresh (culture day 14) CD70-targeted CAR-NK cells, or MM1S cells plus frozen CAR-NK cells (treated with dasatinib for 24 or 72 hours before cryopreservation or untreated). (B) is a graphical quantification of the mean irradiance of bioluminescence shown in (8A).

[0037] Fig. 9 A-9E shows that CARNK cells cultured for 13 days and then treated with dasatinib for 24 hours before freezing (MDACC) outperformed CAR NK cells stored using a standard freezing medium (CS10) protocol without inactivation. In addition, dasatinib-treated cells showed similar in vivo anti-tumor control as fresh CAR NK cells. (A) is a diagram illustrating the experimental procedure (animals were irradiated on day -4 and injected with 0.5x10 6 MM1S cells were injected at day 0 with 5x10 6 Fresh CAR NK cells or 10x10 6 (B) Bioluminescence imaging (BLI) shows the growth of MM1S (CD70+ multiple myeloma cells transduced with firefly luciferase (FFluc)) tumors over time (days -3, 4, 15, 22, and 29) in mice receiving MM1S cells alone, MM1S cells plus dasatinib, MM1S cells plus fresh (culture day 13) CD70-targeted CAR-NK cells, or MM1S cells plus frozen CAR-NK cells (treated with dasatinib for 24 hours before cryopreservation or not treated before cryopreservation). (C) is a graphical quantification of the mean irradiance of bioluminescence shown in (9B). (D) is a graphical quantification of the absolute counts of in vivo NK cell engraftment in the blood of mice 10 or 20 days after receiving the CAR-NK cells shown in (9B). (E) shows the survival curves of the four groups of mice shown in (9B), and (F) shows the associated statistical analysis.

[0038] Fig.10A-10D demonstrates that CAR NK cells cultured for 13 days and treated with dasatinib for 24 hours before freezing exhibited comparable in vivo anti-tumor control and engraftment compared to freshly prepared day 13 CAR NK cells. In addition, the data indicate that the activity of CAR NK cells was not affected when injected with freezing medium. (A) is a diagram illustrating the experimental procedure (animals were irradiated on day -4 and injected with 0.5x10 6 MM1S cells were injected at day 0 with 5x10 6 Fresh CAR NK cells or 10x10 6 (B) Bioluminescence imaging (BLI) shows the growth of MM1S (CD70+ multiple myeloma cells transduced with firefly luciferase (FFluc)) tumors over time (days -3, 7, 14, 21, 28, and 35) in mice that received MM1S cells alone, MM1S cells plus fresh (culture day 13) CD70-targeted CAR-NK cells, or MM1S cells plus frozen CAR-NK cells. Frozen CAR NK cells were suspended in saline or freezing medium in preparation for injection, and all CAR NK cells contained the same construct. (C) is a graphical quantification of the average irradiance of bioluminescence shown in (10B). (D) is a graphical quantification of the percentage of in vivo NK cell engraftment in the blood of mice 10 days after receiving the CAR-NK cells shown in (10B).

[0039] Fig.11 A-11C is a FACS graph showing that CAR NK cells cryopreserved after 13 days of culture and 24 hours of treatment with dasatinib before freezing exhibited in vivo engraftment levels comparable to freshly prepared (culture day 13) CAR NK cells at day 10 after infusion. In addition, the data show that the engraftment of CAR NK cells was not affected when freezing medium was injected compared to saline. (A) The quality of the antibodies and the gating strategy were evaluated using negative and positive controls for CD138 (a tumor marker) and hCD45 (a natural killer cell marker). (B) The percentage of CD56 / CD16+ and CD27+ (CAR marker) cells of fresh CD70-targeted CAR-NK cells (upper right) previously gated as CD138- and hCD45+ (left; example figure) and frozen CAR-NK cells injected with saline (middle right) or freezing medium (lower right) are shown. (C) shows the percentage of hCD45+ / CD138- (CAR NK cells) engraftment from 3 different tumor-bearing mice injected with fresh (culture day 13) CD70-targeted CAR-NK cells or frozen CAR-NK cells treated with dasatinib before cryopreservation. Frozen CAR-NK cells were thawed and resuspended in saline or freezing medium.

[0040] Fig.12 A-12F depicts the validation of antitumor cytotoxicity of frozen TROP2-targeted CAR NK cells that were cultured for 13 days and treated with dasatinib for 24 hours before freezing. In an in vivo mouse model of ovarian cancer (SKOV3 cells), CAR NK cells treated with dasatinib before cryopreservation exhibited comparable antitumor cytotoxicity relative to fresh NK cells (culture day 13). (A) is a diagram of the experimental procedures performed. Animals were injected with 0.5x10 6 SKOV3 cells; BLI was initiated on day -2, animals were irradiated on day -1, and injected with 10x10 6 Fresh CAR NK cells or 10x10 6 frozen CAR NK cells; and imaged weekly throughout life. (B) Bioluminescence imaging (BLI) shows the growth of SKOV3 (TROP2+ ovarian cancer cells, transduced with firefly luciferase (FFluc)) tumors over time (days -2, 5, 12, 19, 26, 33, 40, 47, 54, 61, and 68) in mice that were untreated, treated with NT NK cells, treated with fresh TROP2-targeted CAR NK cells, or treated with frozen / thawed TROP2-targeted CAR-NK cells treated with dasatinib before cryopreservation (CAR NK cells contain the same construct). (C) is a graphical quantification of the mean irradiance of bioluminescence shown in (12B). (D) is a graphical quantification of the percentage of in vivo NK cell engraftment in the blood of mice 10 or 20 days after receiving the NK cells shown in (12B). (E) shows the survival curves of the four groups of mice in (12B), and (F) shows the relevant statistical analysis.

[0041] Fig.13 A-13B shows how CAR NK cells treated with dasatinib before freezing exhibit in vivo anti-tumor cytotoxicity comparable to fresh NK cells in a mouse model of pancreatic ductal adenocarcinoma (PATC148). (A) shows bioluminescent imaging of mice implanted with untreated PATC148 cells transduced with firefly luciferase (FFluc) (PATC148 alone), fresh NK cells transduced with a construct containing a TROP2-targeted CAR (iC9 / TROP2CAR / IL15), or frozen CAR NK cells containing the same construct treated with dasatinib before freezing over time (days 3, 6, 13, 20, 27, 34, and 41). (B) is a graphical quantification of the average irradiance of bioluminescence shown in (13A).

[0042] Fig.14 A-14C shows that the addition of dasatinib to NK cells prior to freezing enhances their anti-tumor cytotoxicity after thawing in an in vitro glioblastoma tumor sphere assay. (A) Representative images of GSC272 spheres (a glioblastoma multiforme (GBM) tumor cell cancer stem cell line transduced with mCherry) cultured alone (right column, top 2 graphs), co-cultured with NK cells that were not treated with dasatinib prior to freezing (1st column), or co-cultured with NK cells that were treated with dasatinib prior to freezing (2nd column) (E:T ratios of 1:1, 2:1, 3:1, or 5:1) are shown. Dasatinib alone was also added to some wells containing tumor cells as a control (right column, bottom 2 graphs). (B) Quantification of total cumulative red intensity over time is depicted, showing that total cumulative red intensity (as a measure of tumor growth) is significantly reduced when spheres are co-cultured with NK cells that were inactivated with dasatinib prior to freezing. (C) Quantification of total cumulative red intensity over time is depicted, showing that total cumulative red intensity (as a measure of tumor growth) decreased significantly when GSC20 spheroids (a cancer stem cell line of GBM tumor cells transduced with mCherry) were cultured alone, co-cultured with NK cells that were not treated with dasatinib before freezing, or co-cultured with NK cells that were treated with dasatinib before freezing. Together, these results suggest that NK cells inactivated with dasatinib before freezing have enhanced cytotoxicity against glioblastoma tumor cells compared to NK cells that were not inactivated before freezing.

[0043] Fig.15A-15E shows the effect of treatment with various receptor tyrosine kinase inhibitors (dasatinib, D; bosutinib, B; nilotinib, N; and saracatinib, S, respectively) before cryopreservation on post-thaw NK cell viability and phenotype. (A) Depicts the recovery (survival) of NK cells after freeze / thaw, where cells were treated with various tyrosine kinase inhibitors (dasatinib, bosutinib, nilotinib, or saracatinib; final concentration of 1 micromolar) before cryopreservation. The Annexin V assay indicates the percentage of live anti-CD70 CAR NK cells (iCas9 / CD27CAR / IL-15) (Annexin V negative and live-dead negative) after thawing to assess the recovery of NK cells treated with various kinase inhibitors before freezing. (B) t-SNE analysis of thawed iC9 / CD27CAR / IL-15-NK cells (CAR) pretreated with tyrosine kinase inhibitors (dasatinib (D), bosutinib (B), nilotinib (N), or saracatinib (S)) prior to cryopreservation is shown; controls include untreated and cryopreserved CAR NK cells. Thawed cells were assessed by CyTOF and merged to create a single t-SNE CUDA plot (12,000 cells from 2 pooled donors per condition). FlowSOM analysis was then performed for each condition, and the different FlowSOM metaclusters were overlaid on the t-SNE CUDA plot. Each colored region corresponds to a metacluster (1-10). (C) A stacked bar graph containing the relative percentage frequency of the different FlowSOM metaclusters for each CAR NK cell condition is depicted. (D) An outline plot showing the t-SNE CUDA cluster organization (as shown in 15B) for the various CAR NK cell conditions tested is depicted. (E) Depicted are representative heat maps showing the expression levels of phenotypic and functional markers of thawed CAR-NK cells. The Z score of the expression level of each marker is represented by a color scale, where bright red corresponds to the highest expression and dark blue corresponds to the lowest expression.

[0044] Fig.16A-16C depicts how the addition of various tyrosine kinase inhibitors prior to freezing enhances the anti-tumor cytotoxicity of CAR-NK cells against solid cancers after thawing, as determined by xCELLigence impedance assay. Ovarian cancer cell line (SKOV3) (A) and renal cell carcinoma cell line (UMRC3) (B) were grown overnight in a 96-well RTCA E-Plate. The next day, frozen iC9 / CD27CAR / IL-15-NK cells that were not pretreated or pretreated with tyrosine kinase inhibitors (dasatinib, bosutinib, nilotinib, or saracatinib) were thawed and added at a 2:1 effector to target (E:T) ratio. Cancer cell growth was measured continuously over time by the xCELLigence device (X-axis) and expressed as Normalized Cell Index (Y-axis). As shown in (C), frozen / thawed iC9 / CD27CAR / IL-15-NK cells pretreated with tyrosine kinase inhibitors dasatinib, nilotinib, or saracatinib showed enhanced cytotoxicity against SKOV3 cells and / or UMRC3 cells compared with frozen / thawed iC9 / CD27CAR / IL-15-NK cells without any pretreatment.

[0045] Fig.17 A-17C depicts how the addition of various tyrosine kinase inhibitors prior to freezing enhances the anti-tumor cytotoxicity of TCR-NK cells against solid cancers after thawing, as determined by xCELLigence impedance assays. Melanoma cell lines (A375) (A) and osteosarcoma cell lines (Saos-2) (B) were grown overnight in 96-well RTCA E-Plates. The next day, frozen NYESO-targeted TCR-NK cells (either untreated or pretreated with tyrosine kinase inhibitors (dasatinib, bosutinib, nilotinib, or saracatinib) prior to cryopreservation) were thawed and added at a 2:1 effector to target (E:T) ratio. Cancer cell growth was continuously measured over time (X-axis) by the xCELLigence device and expressed as the Normalized Cell Index (Y-axis). As shown in (C), frozen / thawed NYESO-TCR-NK cells pretreated with the tyrosine kinase inhibitors dasatinib, nilotinib, bosutinib, or saracatinib showed increased cytotoxicity against A375 cells and / or Saos-2 cells compared with frozen / thawed NYESO-TCR-NK cells without any pretreatment.

[0046] Fig.18A-18B depicts how the addition of dasatinib prior to cryopreservation enhances the anti-tumor cytotoxicity of NYESO-targeted TCR-NK cells against multiple myeloma cells after thawing, as shown by a chromium release assay. (A) Multiple myeloma cells (U266) were labeled with chromium-51 and co-cultured with frozen and thawed NYESO-TCR-NK cells that were either untreated or treated with various tyrosine kinase inhibitors (dasatinib, bosutinib, nilotinib, or saracatinib) prior to cryopreservation at various E:T ratios (2:1, 1:1, 0.5:1, or 0.25:1). Four hours later, chromium release was measured, which corresponds to cancer cell death. (B) Frozen NYESO-TCR-NK cells pretreated with dasatinib showed increased cytotoxicity against U266 cells compared to frozen NYESO-TCR-NK cells without any pretreatment.

[0047] Detailed Description

[0048] A limitation of using certain cryopreserved cells for clinical treatment is that they are few in number and have poor survival rate after thawing. In some embodiments, the present disclosure solves these two limitations by using a strategy that complies with GMP to activate and / or amplify cells in vitro and then temporarily inactivate the cells before cryopreservation, wherein this inactivation before cryopreservation is carried out by treating with at least one inactivating agent, and results in effector cells that can be stored in sufficiently high quantities. After thawing, cells have improved survival rate, improved transgenic expression rate and / or improved cytotoxicity relative to non-inactivated cryopreserved and subsequently thawed counterparts. In specific embodiments, any method disclosed herein shows that this strategy can also be applied to cells that have not been previously amplified and / or activated.

[0049] Thus, certain embodiments of the present disclosure provide methods and compositions for preserving (e.g., for storage) clinical-grade cells, including cells for immunotherapy, including effector cells. Cultivating and shaping clinically relevant quantities of cells for infusion into patients while meeting time constraints is an extremely challenging endeavor even in the best of circumstances. The disclosed methods and compositions detail a process for preserving cells that is useful for improving cell viability, cytotoxicity, and / or transgene expression levels relative to a control that does not contain cells prepared using the methods described herein.

[0050] In certain embodiments, a method for inactivating any type of mammalian cell is further provided herein. In some embodiments, mammalian cells can be of any kind, including any type of immune cells, including NK cells, T cells, B cells, NKT cells, macrophages and monocytes, γδT cells, regulatory T cells, stem cells, induced pluripotent stem cells (iPSC) or any cells derived from iPSC, MSC, hematopoietic stem cells, differentiation or stereotyped cells from any organ, any fibroblasts. In certain embodiments, a method for inactivating immune cells (such as effector cells) is provided herein. In any case, mammalian cells can be used for adoptive cell therapy. In some embodiments, cells are NK cells. In some embodiments, cells are not T cells. In some embodiments, cells are NK cells comprising one or more transgenics. In some embodiments, transgenics are chimeric antigen receptors (CAR), engineered cytokines and / or cytokine signaling pathway members and / or T cell receptors (TCR). In some embodiments, NK cells can be artificially modified in one or more ways, such as but not limited to the introduction of one or more engineered antigen receptors, including chimeric antigen receptors or T cell receptors, or CD16, CD32 and / or CD64 receptors. In some embodiments, NK cells can express heterologous cytokines, such as IL-2, IL-4, IL-7, IL-12, IL-15, IL-18, IL-21 and / or IL-23. In some embodiments, NK cells can express suicide genes. In specific embodiments, NK cells comprise chimeric antigen receptors targeting tumor antigens and cytokines (eg, IL-15), optionally comprising suicide genes. In some embodiments, NK cells are gene edited using any method. In some embodiments, NK cells are combined with monospecific, bispecific and / or multispecific antibodies in vitro or in vivo. In some embodiments, NK cells are activated and / or amplified or used directly in vitro without prior activation / amplification.

[0051] In a specific embodiment, after the cells are inactivated, the cells can be placed in a suitable cryopreservation medium (e.g., a freezing medium). In some embodiments, the freezing medium can include a cryoprotectant such as, but not limited to, dimethyl sulfoxide (DMSO), glycerol, hydroxyethyl starch, or a combination thereof, serum from a human, bovine, or other animal source, or a serum substitute such as, but not limited to, platelet lysate, one or more cytokines or growth factors, including, but not limited to, IL-1, IL-2, IL-3, IL-4, IL-6, IL-7, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-21, IL-22, interferon, tumor necrosis factor, stem cell factor, FLT3-ligand, APRIL, or a combination thereof. Serum can be used as a source of growth factors, adhesion factors, hormones, lipids, and / or minerals, and / or in some cases for regulating cell membrane permeability, and as a carrier for lipids, enzymes, micronutrients, and trace elements to enter cells. In some embodiments, the freezing medium allows for an increased success rate of freezing of individual doses of cells while increasing the viability and functionality of the cells. In some embodiments, the cells can be thawed and injected into the patient as needed. Therefore, the inactivated and frozen cells provided herein are a "ready-to-use" cell therapy that can be thawed and injected into the patient without delaying production.

[0052] The methods and compositions described herein provide adoptive cell therapy approaches and cells that can be stored as cell banks for any purpose, including immunotherapy, without the need to recruit donors for cell collection, although this approach can also be used for cryopreservation of autologous patient-directed products.

[0053] I. Definitions

[0054] It is contemplated that any embodiment discussed in this specification can be implemented with respect to any method or composition of the invention, and vice versa. In addition, the compositions of the invention can be used to implement the methods of the invention.

[0055] Following long-standing patent law convention, "a" and "an" mean "one or more" when used with the terms in this specification, including the claims. Some embodiments of the present disclosure may consist of or consist essentially of one or more elements, method steps, and / or methods of the present disclosure. It is contemplated that any method or composition described herein may be implemented with respect to any other method or composition described herein, and that different embodiments may be combined.

[0056] In this application, the term "about" is used to indicate that a value includes the inherent error variation for the device, the method being employed to determine the value, or the variation that exists between study subjects.

[0057] As used herein, the terms "or" and "and / or" are used to describe multiple components that are in combination or mutually exclusive. For example, "x, y, and / or z" can refer to "x" alone, "y" alone, "z" alone, "x, y, and z", "(x and y) or z", "x or (y and z)", or "x or y or z". It is specifically contemplated that x, y, or z can be explicitly excluded from an embodiment.

[0058] Throughout this specification, unless the context requires otherwise, the words "comprises," "comprising," and "containing" should be understood to imply the inclusion of the stated steps or elements or groups of steps or elements, but not the exclusion of any other steps or elements or groups of steps or elements. "Consisting of" means including and limited to whatever follows the phrase "consisting of." Thus, the phrase "consisting of" means that the listed elements are required or mandatory, and no other elements may be present. "Consisting essentially of" means including any elements listed after the phrase, and is limited to other elements that do not interfere with or contribute to the activity or effect of the listed elements as specified in the present disclosure. Thus, the phrase "consisting essentially of" means that the listed elements are required or mandatory, but other elements are not optional and may be present or absent, depending on whether they affect the activity or effect of the listed elements.

[0059] As used herein, "substantially free" with respect to a specified component is used herein to mean that the specified component was not intentionally formulated into the composition and / or the specified component is present only as a contaminant or trace amount. Thus, the total amount of the specified component resulting from any unintentional contamination of the composition is much less than 0.05%, preferably less than 0.01%. Most preferred are compositions in which no specified component can be detected using standard analytical methods.

[0060] References throughout the specification to "one embodiment," "an embodiment," "a particular / specific embodiment," "a related embodiment," "certain embodiments," "additional embodiments," or "further embodiments," or combinations thereof, mean that a particular feature, structure, or characteristic described in connection with that embodiment is included in at least one embodiment of the present invention. Thus, various appearances of the above phrases throughout the specification are not necessarily all referring to the same embodiment. Furthermore, the particular features, structures, or characteristics may be combined in any suitable manner in one or more embodiments.

[0061] The term "inactivation" or "inactivated" as used herein refers to a process in which a cell is induced to enter a state of lower activity by exposure to one or more agents or refers to a cell induced to enter a state of lower activity by exposure to one or more agents. Inactivated cells may also be considered as cells in a "quiescent" or "resting" state. In general, as described herein, inactivation is a temporary process that can be relieved after removing one or more agents that induce the inactivated state. In general, the level of cytolytic activity, cytokine production, NK cell proliferation and / or one or more cytotoxic markers (such as, but not limited to, CD95, NKG2D, DNAM, OX-40, TRAIL, HLA-DR, CD2, CD25, ICOS, CCR5, CD62L, CXCR4 and / or C-kit) of inactivated cells is reduced or altered relative to non-inactivated cells.

[0062] As used herein, the term "engineered" refers to artificially produced entities, including cells, nucleic acids, polypeptides, vectors, etc. In at least some cases, the engineered entity is synthetic and contains elements that are not naturally present or configured in the manner used in the present disclosure. In specific embodiments, the vector is engineered by recombinant nucleic acid technology and the cell is engineered by transfection or transduction of the engineered vector.

[0063] "Immune disease," "immune-related disease," or "immune-mediated disease" refers to a disease in which the immune response plays a key role in the development or progression of the disease. Immune-mediated diseases include autoimmune diseases, allogeneic transplant rejection, graft-versus-host disease, and inflammatory and allergic diseases.

[0064] An "immune response" is a response of an immune system cell (e.g., a B cell, a T cell, or an innate immune cell) to a stimulus. In one embodiment, the response is a specific response to a particular antigen (an "antigen-specific response").

[0065] "Autoimmune disease" refers to a disease in which the immune system produces an immune response (e.g., a B cell or T cell response) to an antigen that is part of the normal host (i.e., a self-antigen), resulting in tissue damage. The self-antigen can come from a host cell, or it can come from a commensal organism, such as a microorganism that normally colonizes the mucosal surface (called a commensal organism).

[0066] As used herein, the terms "loaded," "loaded with," or "loaded" refer to adoptive cell therapy cells having one or more antibodies on the cell surface that bind to the cells.

[0067] As used herein, the terms "preloaded," "preloaded with," or "pre-charged" mean that adoptive cell therapy cells already have one or more antibodies bound to the cells on their surface prior to use of the cells for any reason.

[0068] The phrase "pharmaceutically or pharmacologically acceptable" refers to molecular entities and compositions that do not produce adverse, allergic or other undesirable reactions when administered to animals (e.g., humans) under appropriate circumstances. The preparation of pharmaceutical compositions comprising antibodies or additional active ingredients will be understood by those skilled in the art in light of this disclosure. In addition, for animal (e.g., human) administration, it should be understood that the formulation should meet the sterility, pyrogenicity, general safety and purity standards required by the U.S. FDA Office of Biological Standards.

[0069] As used herein, "pharmaceutically acceptable carriers" include any and all aqueous solvents known to those skilled in the art (e.g., water, alcohol / aqueous solutions, saline solutions, parenteral vehicles such as sodium chloride, Ringer's dextrose, etc.), non-aqueous solvents (e.g., propylene glycol, polyethylene glycol, vegetable oils, and injectable organic esters such as ethyl oleate), dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial or antifungal agents, antioxidants, chelating agents, and inert gases), isotonic agents, absorption delaying agents, salts, drugs, drug stabilizers, gels, binders, excipients, disintegrants, lubricants, sweeteners, flavoring agents, dyes, fluids, and nutritional supplements, such and similar materials and combinations thereof. The pH and exact concentration of the various ingredients in the pharmaceutical composition are adjusted according to well-known parameters.

[0070] The term "preactivated" or "preactivated" as used herein refers to NK cells exposed to IL-12, IL-15 or IL-2 and / or IL-18, resulting in increased signaling pathways associated with NK cell effector functions, such as genes involved in IFN-γ response, TNF signaling, IL-2 / STAT5 signaling, IL-6 / JAK / STAT3 signaling, mTOR pathways, and / or enrichment of genes associated with inflammatory immune responses. In certain cases, the expression of TRAIL, NKp44, and / or CD69 is increased.

[0071] As used herein, "prevention" and similar words, such as "prevent", "prevent", etc., refer to methods of preventing, inhibiting, or reducing the likelihood of the occurrence or recurrence of a disease or condition (e.g., cancer). It also refers to delaying the onset or recurrence of a disease or condition, or delaying the onset or recurrence of symptoms of a disease or condition. As used herein, "prevention" and similar words also include reducing the intensity, effects, symptoms, and / or burden of a disease or condition before the onset or recurrence of the disease or condition.

[0072] "Subject" and "patient" and "individual" are interchangeable and may refer to humans or non-humans, such as primates, mammals, and vertebrates. In a specific embodiment, the subject is a human. The subject may be any biological or animal subject as the object of the method or material, including mammals, such as humans, experimental animals (such as primates, rats, mice, rabbits), livestock (such as cattle, sheep, goats, pigs, turkeys and chickens), domestic pets (such as dogs, cats and rodents), horses and transgenic non-human animals. The subject may be a patient, such as suffering from or suspected of having a disease (which may be referred to as a medical condition), such as one or more infectious diseases, one or more hereditary diseases, one or more cancers, or any combination thereof. "Subject" or "individual" used herein may be placed in a medical institution, or may not be placed in a medical institution, and may be treated as an outpatient of a medical institution. An individual may receive one or more medical compositions via the Internet. An individual may include humans or non-human animals of any age, and therefore includes adults and adolescents (such as children) and infants, as well as individuals in the womb. Subjects may or may not require medical treatment; individuals may participate in experiments voluntarily or involuntarily, whether in clinical trials or in support of basic scientific research.

[0073] "Treating" a disease or condition or treatment of a disease or condition refers to carrying out a regimen that may include administering one or more drugs or cell therapy products to a patient in an effort to alleviate the signs or symptoms of the disease. Desired effects of treatment include reducing the rate of disease progression, improving or alleviating the disease state, and alleviating or improving prognosis. Alleviation may occur before the onset of signs or symptoms of the disease or condition, or after the onset of the disease or condition. Thus, "treating" or "medical treatment" may include "prevention" of a disease or adverse condition. Furthermore, "treating" or "medical treatment" does not require complete relief of signs or symptoms, does not require a cure, and specifically includes regimens that have only a marginal effect on the patient.

[0074] As used in this application, the terms "therapeutic benefit" or "therapeutically effective" refer to anything that promotes or enhances the subject's health status in terms of treating the condition. This includes, but is not limited to, reducing the frequency or severity of signs or symptoms of the disease. For example, the treatment of cancer may involve, for example, completely eradicating a tumor, reducing the size of a tumor, reducing the aggressiveness of a tumor, reducing the rate of cancer growth, or preventing metastasis. The treatment of cancer may also refer to prolonging the survival of a cancer patient.

[0075] The term "antigen presenting cell (APC)" refers to a class of cells that can present one or more antigens in the form of peptide-MHC complexes that can be recognized by specific effector cells of the immune system, thereby inducing an effective cellular immune response to the presented antigens. The term "APC" encompasses intact whole cells, such as macrophages, B cells, endothelial cells, activated T cells, dendritic cells, cell lines (e.g., K562), or natural or synthetic molecules that can present antigens, such as purified MHC class I molecules complexed with β2-microglobulin.

[0076] II. Inactivation and cryopreservation of cells

[0077] Any type of cell can be inactivated and then cryopreserved as described herein. In certain embodiments, the cell can be a mammalian cell, and in certain cases, they are mammalian cells for research and / or treatment. In certain cases, the cell can be an immune cell, including immune cells for adoptive cell therapy. Such cells may be or may not be NK cells, T cells, NKT cells, B cells, macrophages or monocytes, stem cells, induced pluripotent stem cells (iPSC) or any cells derived from iPSC, MSC, hematopoietic stem cells, differentiation or stereotyped cells from any organ, any fibroblasts, etc. In certain embodiments, the cell is an NK cell. The cell can be obtained from an individual, cryopreserved using the medium covered herein, then thawed and used for the individual and / or another one or more other individuals. The cell can be obtained from an individual, operated to include one or more features, inactivated and cryopreserved as described herein, and used for the individual and / or another one or more other individuals.

[0078] One or more specific inactivators and one or more specific cryopreservation media described in the art can be used to inactivate and cryopreserve a first plurality of cells from a group of cells, and optionally, one or more different inactivators and different cryopreservation media can be used to inactivate and cryopreserve a second plurality of cells from the same group of cells. Depending on the application of the cells, the number and / or viability of the cells, etc., this approach may or may not be adopted. Exemplary cryopreservation medium solutions are described in the international publication WO2021041399 "Cell Cryopreservation Medium", which is incorporated herein by reference for purposes described herein.

[0079] In a specific embodiment, after collecting (e.g., separating) cells from one or more individuals or from one or more sources (e.g., a blood bank of cryopreservation), cells are substantially immediately inactivated and cryopreserved as described herein. In some embodiments, cells inactivated and cryopreserved as described herein are inactivated and cryopreserved after cultivation and / or amplification. In some embodiments, before inactivation and cryopreservation, cells are pre-activated and / or activated as described herein. After amplification and / or activation, cells (e.g., immune cells) can be operated immediately for subsequent purposes (e.g., infusion), or cells can be inactivated and stored (e.g., by cryopreservation). In some aspects, within about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or more days after cell collection (e.g., cell separation), cells can be used as a large number of colonies in vitro breeding for several days, weeks or months.

[0080] In certain embodiments, it may be necessary to perform a complete medium exchange on the cells prior to inactivation and / or cryopreservation. In some embodiments, it may be necessary to perform a complete medium exchange on the cells prior to inactivation and / or cryopreservation based on the viable cell concentration. In some embodiments, if the viable cell concentration is at least about 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 or 1×10 8 cells / mL, a complete medium change may be required prior to inactivation and / or cryopreservation. In some embodiments, if the viable cell concentration is at least about 1×10 6 cells / mL, it may be necessary to perform a complete medium exchange on the cells prior to inactivation and / or cryopreservation. In some embodiments, the cell culture medium can be replaced with warm complete culture medium. In some embodiments, the warm complete culture medium includes any one, any combination, or all of RPMI, Clicks, and human AB serum. In some embodiments, the warm complete culture medium can be heated to 37°C for at least about 5 minutes, 10 minutes, 15 minutes, 20 minutes, or 25 minutes prior to replacing the culture medium. In some embodiments, the warm complete culture medium can be heated to 37°C for at least about 15 minutes prior to replacing the culture medium.

[0081] In certain embodiments, a complete medium exchange may not be required for the cells prior to inactivation and / or cryopreservation. In some embodiments, if the viable cell concentration is equal to or less than about 1×10 4 , 1×10 5 , 1×10 6 , 1×10 7 or 1×10 8cells / mL, a complete medium change may not be required for the cells prior to inactivation and / or cryopreservation. In some embodiments, if the viable cell concentration is equal to or less than about 1×10 6 / mL, a complete media change may not be necessary for cells prior to inactivation and / or cryopreservation.

[0082] In certain embodiments, the cell for inactivation and / or cryopreservation is a NK cell. In certain embodiments, the NK cell surface antigen can be CD16, CS1, CD56, NKG2D, NKG2C or any c-type lectin, costimulatory molecules such as DNAM, 2B4, CD2, NCR or KIR. In some embodiments, the source of NK cells is cord blood (CB). In some embodiments, the source of cord blood is the cord blood from 1 donor or is collected by 2 or more separate cord blood units. CB can be collected by 3, 4, 5, 6, 7 or 8 separate cord blood units. In some embodiments, NK cells (can be CD56+) can be from cord blood mononuclear cells, cord blood, bone marrow or peripheral blood hematopoietic stem cells, iPSC, peripheral blood or NK cell lines. In some embodiments, the source of NK cells can be a fresh source or a cryopreservation bank. In some cases, when NK cells are derived from cryopreservation, NK cells are cryopreserved in a culture medium comprising at least one cryoprotectant, at least one serum or a non-serum substitute for serum.

[0083] In certain embodiments, the inactivating agent may have a pharmacological effect on the activity of the cells, see, e.g., Mestermann K, Giavridis T, Weber J et al., The tyrosine kinase inhibitor Dasatinib acts as a pharmacologic on / off switch for CAR T cells. Sci Transl Med. 2019; 11(499); and / or Weber EW, Lynn RC, Sotillo E, Lattin J, Xu P, Mackall CL. Pharmacologic control of CAR-T cell function using Dasatinib. Blood Adv. 2019; 3(5): 711-717; each of which is incorporated herein by reference for the purposes described herein.

[0084] In certain embodiments, the inactivating agent is washed from the cells one or more times prior to cryopreservation.

[0085] A.NK cells

[0086] In some embodiments, the cell is an immune cell. In certain embodiments, the cell is a NK cell. In certain embodiments, the cell is a non-transduced NK cell (for example, NK cells transduced without any construct). In certain embodiments, the cell is a transduced NK cell (for example, NK cells transduced with a construct encoding a functional molecule (for example, CAR, TCR, cytokine, etc.). NK cells are becoming an exciting source of cell immunotherapy for patients with malignant hematological diseases and solid tumors; however, most studies using non-fresh adoptive transfer NK cells are limited by insufficient persistence of injected cells, poor in vivo amplification, and disappointing anti-tumor activity. Therefore, the obstacle that needs to be overcome in the field of NK immunotherapy is that a biologically driven method is required to increase the availability of NK cells while maintaining and / or improving anti-tumor function, such as by operating the cells before being administered as a therapy. Therefore, in certain embodiments, the present disclosure provides a method for amplifying and / or activating, inactivating, and optionally storing NK cells with any kind of enhanced efficacy compared to NK cells that have not been so operated. Some embodiments of the present disclosure relate to the separation, activation, amplification, inactivation, freezing, thawing, and use of NK cells, including for cancer immunotherapy.

[0087] In certain embodiments, the disclosure includes NK cells loaded (optional), preactivated (optional) and amplified (optional), which are then inactivated and stored (optional) as described herein. In some embodiments, such cells exhibit enhanced anti-tumor function for cancer. In some embodiments, such cells exhibit enhanced antibody-dependent cellular toxicity (ADCC). In some embodiments, such cells exhibit enhanced transgenic expression. In some embodiments, such cells exhibit enhanced survival rate. In some embodiments, such cells may have reduced expression of one or more genes.

[0088] In certain embodiments, the NK cells described herein may be derived from any suitable source, such as umbilical cord blood (CB), including human CB. In certain cases, NK cells are not derived from umbilical cord tissue (insulating material around umbilical cord blood vessels (i.e., umbilical cord glue)). In alternative embodiments, NK cells are derived from human peripheral blood mononuclear cells (PBMC), unstimulated leukocyte separation products (PBSC), human embryonic stem cells (hESC), induced pluripotent stem cells (iPSC) and / or bone marrow, or umbilical cord blood, bone marrow or peripheral blood hematopoietic stem cells, or are derived from the patient's NK cell line, such as NK-92, by methods well known in the art. In a specific embodiment, NK cells are separated from the collected CB. CB can be collected from 2, 3, 4, 5, 6, 7, 8, 9, 10 or more units. NK cells can be autologous or allogeneic relative to the recipient individual. The separated NK cells may be haplotype matched with the subject receiving cell therapy, or may not match. NK cells may be detected by specific surface markers (e.g., CD16 and / or CD56 in humans), or may not be detected by specific surface markers. In some cases, NK cells are depleted due to the presence of one or more surface markers, such as CD3+, CD14+ and / or CD19+ cells. In a specific embodiment, NK cells are CD3-CD56+.

[0089] In some aspects, NK cells are isolated by previously described methods for in vitro expansion of NK cells (Spanholtz et al., 2011; Shah et al., 2013). In this method, CB mononuclear cells are isolated by ficoll density gradient centrifugation. Cell cultures can be depleted of any cells expressing CD3 and can be characterized to determine the percentage of CD56+ / CD3- cells or NK cells. In other methods, umbilical cord CB is used to derive NK cells by isolating CD34+ cells.

[0090] B. Activator

[0091] In some embodiments, the cells are expanded and / or activated prior to inactivation. The expansion and / or activation of the cells can be performed by any suitable method known in the art.

[0092] In certain embodiments, NK cells are expanded in a certain manner and are optionally pre-activated in a certain manner. For example, in addition to optionally exposing NK cells to one or more cytokines as a pre-activation step, NK cells can also be expanded in the presence of specific antigen presenting cells under certain culture conditions. In some embodiments, after cell separation, cells are pre-activated using a cytokine mixture. In some embodiments, the cytokine mixture includes one or more or any combination of IL-2, IL-12, IL-15 and / or IL-18.

[0093] In some embodiments, NK cells are preactivated before optional amplification and / or additional activation and inactivation and / or storage. The preactivation step may or may not occur before any amplification step. In a specific embodiment, NK cells are preactivated with one or more cytokines, and in a specific embodiment, NK cells are preactivated with one or more (including two, three or more) of IL-12, IL-15, IL-2 and IL-18. In the case of using less than all three IL-12, IL-15 and IL-18, it may be IL-12 and IL-15, but IL-18 is not used; or IL-12 and IL-18, but IL-15 is not used; or IL-15 and IL-18, but IL-12 is not used. IL-2 may or may not replace IL-15.

[0094] In some embodiments, the pre-activation cytokine is IL-12, IL-15 and IL-18. The pre-activation step can use one or more additional cytokines. Pre-activation can last for a shorter time, such as 5-72 hours, such as 10-50 hours, particularly 10-20 hours, such as 12, 13, 14, 15, 16, 17, 18, 19 or 20 hours, and in some cases particularly about 16 hours. In some embodiments, the pre-activation culture can include IL-18 and / or IL-15 at a concentration of 10-100 ng / mL, such as 40-60 ng / mL, particularly 45, 46, 47, 48, 49, 50, 51, 52, 53, 54 or 55 ng / mL, particularly about 50 ng / mL. In some cases, the pre-activation culture includes IL-12 at a concentration of 0.1-150 ng / mL, including a concentration of 1-20 ng / mL, such as a concentration of 10 ng / mL. In alternative embodiments, NK cells can be stimulated with IL-2 or other cytokines that bind to the common γ chain (e.g., IL-7, IL-21, etc.), which can be in addition to IL-12, IL-15, and IL-18, or can be a replacement for one or more of them. In this case, the pre-activated culture can contain IL-12 at a concentration of 0.1-150 ng / mL, such as 0.5-50 ng / mL, particularly 1-20 ng / mL, such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 ng / mL, particularly about 10 ng / mL.

[0095] In a specific embodiment, after optional pre-activation, NK cells are expanded to increase their number before inactivation and / or storage. The expanded cells may or may not be derived from pre-activated NK cells, so that the pre-activation step can occur before the expansion step. The NK cell expansion step can be any suitable length that allows the NK cell population to expand, but in certain cases, the expansion step utilizes specific one or more reagents (e.g., in culture) to enhance its expansion. In some cases, NK cells may not be expanded. Before or during expansion, IL-2 or IL-15 or IL-18 or any cytokine combination can be added to the expansion culture. In some embodiments, NK cells can be expanded in vitro in culture bottles. In some embodiments, NK cells can be expanded in vitro in several different bioreactor configurations with a continuous perfusion culture medium / additive.

[0096] In some embodiments, NK cells (whether preactivated or not) may be washed (e.g., with PBS or Plasma Lyte or human serum albumin or culture medium or a combination thereof) before and / or after expansion, for example 2, 3, 4 or 5 times, particularly 3 times. In a specific embodiment, NK cells are expanded in the presence of feeder cells and / or artificial antigen presenting cells (APCs) (e.g., universal artificial antigen presenting cells (uAPCs) and / or artificial antigen presenting cells (aAPCs)). aAPCs may be engineered to express CD137 ligands and / or membrane-bound cytokines. The membrane-bound cytokine may be membrane-bound IL-21 (mIL-21) or membrane-bound IL-15 (mIL-15). In a specific embodiment, aAPCs are engineered to express CD137 ligands and mIL-21. aAPCs may be derived from cancer cells, such as leukemia cells. aAPCs may not express endogenous HLA class I, II or CD1d molecules. They may express ICAM-1 (CD54) and LFA-3 (CD58) or CD48. Specifically, aAPCs may be K562 cells, for example K562 cells engineered to express CD137 ligand and mIL-21. Engineering may be performed by any method known in the art, such as retroviral transduction, although any viral or non-viral vector may be used. aAPCs may or may not be irradiated.

[0097] In some embodiments, antigen presenting cells can be macrophages, B lymphocytes and / or dendritic cells, which are distinguished by the expression of their specific MHC molecules. APCs internalize antigens and re-express a portion of the antigen and MHC molecules on their external cell membrane. MHC is a large genetic complex with multiple loci. The MHC loci encode two major categories of MHC membrane molecules, called class I and class II MHC. T helper lymphocytes generally recognize antigens associated with MHC class II molecules, and T cytotoxic lymphocytes recognize antigens associated with MHC class I molecules. MHC is called the HLA complex in humans and the H-2 complex in mice.

[0098] In some cases, aAPCs are suitable for preparing therapeutic compositions and cell therapy products of the embodiments. For general guidance on preparing and using antigen presentation systems, see, for example, U.S. Patent Nos. 6,225,042, 6,355,479, 6,362,001, and 6,790,662; U.S. Patent Application Publication Nos. 2009 / 0017000 and 2009 / 0004142; and International Publication No. WO2007 / 103009.

[0099] In some embodiments, the APC system (e.g., uAPC and / or aAPC) may include at least one exogenous auxiliary molecule. Any suitable number and combination of auxiliary molecules may be used. Auxiliary molecules may be selected from auxiliary molecules such as costimulatory molecules and adhesion molecules. Exemplary costimulatory molecules include CD86, CD64 (FcγRI), 41BB ligands and IL-21. Adhesion molecules may include carbohydrate-binding glycoproteins (e.g., selectins), transmembrane-bound glycoproteins (e.g., integrins), calcium-dependent proteins (e.g., cadherins) and single-pass transmembrane immunoglobulin (Ig) superfamily proteins (e.g., intercellular adhesion molecules (ICAM)), which promote, for example, intercellular or cell-matrix contact. Exemplary adhesion molecules include LFA-3 and ICAM, such as ICAM-1. For selecting, cloning, preparing and expressing exemplary auxiliary molecules (including costimulatory molecules and adhesion molecules), techniques, methods and reagents are exemplified in, for example, U.S. Patent Nos. 6,225,042, 6,355,479 and 6,362,001.

[0100] In some embodiments, the expansion can last for a specific time, for example, about 2-30 days, such as 3-20 days, especially 12-16 days, such as 12, 13, 14, 15, 16, 17, 18 or 19 days, especially about 14 days. In some embodiments, the optional pre-activated NK cells and APCs can be present in a ratio of about 3: 1-1: 3, such as 2: 1, 1: 1, 1: 2, especially about 1: 2. In some embodiments, the expansion culture may also include one or more cytokines to promote expansion, such as IL-2. The concentration of IL-2 may be about 10-500U / mL, such as 100-300U / mL, especially about 200U / mL. IL-2 can be supplemented in the expansion culture, including at a certain frequency, such as once every 2-3 days. In some embodiments, APCs may be added to the culture at least a second time, such as when expanding for about 7 days. Any cytokine used in the pre-activation and / or expansion step may be a recombinant human cytokine.

[0101] In some embodiments, after expansion, the NK cells can be immediately inactivated, for example by treatment with one or more inactivating agents described herein. After inactivation, the NK cells can be stored, for example by cryopreservation. In some aspects, within about 1, 2, 3, 4 or 5 days after cell isolation, the cells can be propagated in vitro as a large population for days, weeks or months.

[0102] In certain embodiments, activated and / or amplified NK cells can secrete type I cytokines, such as interferon-γ, tumor necrosis factor-α, and granulocyte-macrophage colony stimulating factor (GM-CSF) (which activates innate and adaptive immune cells) and other cytokines and chemokines. In some embodiments, the measurement of these cytokines can be used to determine the activation state of NK cells. In addition, other methods known in the art for determining NK cell activation can be used to characterize the NK cells of the present disclosure. In some embodiments, the measurement of such markers can be used to determine the efficacy of one or more inactivating agents and / or the state of the NK cell activation phenotype.

[0103] In some embodiments, with respect to the specific pre-activation and expansion aspects of the present disclosure, in specific embodiments, NK cells are pre-activated with IL-12, IL-15, and IL-18, and then expanded with APC. In some embodiments, APC is aAPC, such as K562 cells expressing mIL-21 and CD137 ligands, providing efficient cell products. In some embodiments, NK cells for treating various diseases (e.g., immunotherapy of cancer patients) are provided herein, which are suitable for long-term storage (e.g., by cryopreservation). In an exemplary method, isolated NK cells can be briefly (e.g., about 16 hours) pre-activated using a cytokine combination (e.g., interleukin-12 (IL-12), IL-15 and / or IL-18) and then expanded using APCs, and / or exogenous IL-2, IL-2 or IL-15 or IL-18 or any cytokine combination can be added to the expansion culture at least a second time, and after an appropriate expansion period, the NK cells are inactivated by treatment with an inactivating agent for an appropriate period of time. After inactivation, the NK cells can be stored, for example, by cryopreservation. After cryopreservation, the NK cells can be thawed and then used in any suitable downstream process, such as but not limited to immunotherapy and / or other operations (e.g., transformation, transduction, loading, etc.).

[0104] C. Loading of NK cells

[0105] In some embodiments, the cells are optionally loaded with an agent, such as an antibody.

[0106] In certain embodiments, NK cells can be loaded in any particular manner, including in culture, loading immediately before infusion and / or adding in vivo, for example, to produce a complex of NK cells and antibodies. Conditions are suitable enough to allow an effective amount of antibodies to bind to the surface of NK cells. In the case of using a monospecific antibody, the Fc region of the monospecific antibody binds to NK cells, and the antigen binding domain of the monospecific antibody can freely bind to its target antigen. In the case of using a multispecific antibody, one or more antigen binding domains of the antibody can be bound to the surface of the NK cell, for example, through an antigen on the NK cell surface, and another antigen binding domain can freely bind to its target antigen. In the alternative case of using a multispecific antibody, one or more antigen binding domains of the antibody can bind to a target antigen on a target cell, and one or more alternative antigen binding domains of the antibody can bind to one or more alternative target antigens on the target cell.

[0107] In some embodiments, the culture conditions for NK cell loading may or may not be a specific type with one or more specific parameters. In a specific embodiment, the loading of NK cells occurs in the culture of a specific temperature (e.g., 37 ° C), although the temperature is 36 ° C or 38 ° C, or lower or higher in an alternative embodiment. In some embodiments, the duration of the loading step can be any suitable amount of time, for example, in the range of 1 minute to 24 hours or longer. For example, the range can be 1 minute to 24 hours, 1 minute to 18 hours, 1 minute to 12 hours, 1 minute to 6 hours, 1 minute to 1 hour, 30 minutes to 24 hours, 30 minutes to 18 hours, 30 minutes to 12 hours, 30 minutes to 6 hours, 30 minutes to 1 hour, 1-24 hours, 1-18 hours, 1-12 hours, 1-6 hours, 6-24 hours, 6-18 hours, 6-12 hours, 12-24 hours, 12-18 hours or 18-24 hours. In some embodiments, the duration of the loading step can be greater than or equal to about 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46 or 48 hours, or any range derivable therein. In specific embodiments, the cell culture medium is a basal medium or a complex medium. In some cases, the culture includes one or more reagents used during the pre-activation and / or expansion steps, while in other cases the culture does not contain these reagents. In specific embodiments, the culture includes one or more cytokines, for example, including one or more of IL-12, IL-15, IL-2 and IL-18. In some embodiments, the culture includes any type of APC.

[0108] In some embodiments, an effective amount of an antibody is contacted with an effective amount of NK cells of the present disclosure, thereby producing a "chimeric antigen receptor-like" complex. In some embodiments, the antigen binding domain of the antibody binds to the NK cell, for example, through an antigen as a cell surface protein. In some embodiments, multiple antibodies can be contacted with multiple NK cells, so that there are multiple cell / antibody complexes. In some embodiments, the antibody can be of any type, including monospecific, bispecific or multispecific, and in certain cases, the antibody is engaged with the NK cell and the target antigen through the antigen binding domain of the antibody (for example, the conjugate in the art is a fusion protein composed of a single-chain variable fragment (scFv) of two different antibodies). In some embodiments in which the antibody is monospecific, the antigen binding domain of the antibody binds to the target antigen (for example, a cancer antigen), and another part of the antibody, such as the Fc region of the antibody, binds to the NK cell. In some embodiments in which the antibody is multispecific, one or more antigen binding domains of the antibody bind to NK cells (for example, through NK cell surface antigens), and one or more antigen binding domains of the antibody bind to one or more target antigens. In some embodiments, multispecific antibodies can be bispecific, trispecific or tetraspecific. In some embodiments, where the antibody is trispecific or tetraspecific, additional antigen binding domains may bind other cells, such as stem cells.

[0109] In some embodiments, the antibody can bind to any NK cell surface antigen (which may or may not be a receptor) on NK cells, such as CD16 (including CD16a or CD16b), CD56, C-type lectins (e.g., NKG2D, NKG2C), co-stimulatory molecules (e.g., CS1, DNAM, 2B4, CD2, NCR, or KIR), and redirect NK cells to the target, thereby increasing the response and specificity against different tumors.

[0110] In some embodiments, the antibody can bind to any suitable antigen (e.g., an antigen described herein, such as an antigen described as a target of a CAR and / or TCR). In certain embodiments, the antibody targets EGFR. In certain embodiments, the antibody is bispecific and targets EGFR and c-MET.

[0111] In some embodiments, the generation of the complex can be carried out by any suitable method, so that the conditions are sufficient to bind the appropriate region of the antibody to the appropriate surface region of the NK cell. In some embodiments, any specific culture medium can be used. In certain cases, Plasma-Lyte A and / or human serum albumin are used, while in other cases they are not used. Once the complex is formed in culture, they may or may not be washed before inactivation or storage.

[0112] D. Inactivation agent

[0113] In some embodiments, the cells are inactivated by treating the cells with an inactivating agent. In some embodiments, the cells are inactivated by treating the cells with an inactivating agent prior to storage (eg, but not limited to, cryopreservation) and under conditions suitable for cell inactivation.

[0114] In some embodiments, the inactivating agent includes one or more kinase inhibitors. In some embodiments, the inactivating agent is a tyrosine kinase (TK) inhibitor. In some embodiments, the cell is a NK cell and is treated with an inactivating agent under certain conditions to produce inactivated NK cells. In some embodiments, NK cells are treated with a TK inhibitor to produce inactivated NK cells. In some embodiments, NK cells are treated with dasatinib to produce inactivated NK cells. In some embodiments, NK cells are treated with dasatinib, nilotinib, imatinib, bosutinib, saracatinib and / or mTOR inhibitors (e.g., rapamycin, etc.) to produce inactivated NK cells. In some embodiments, NK cells are not treated with bosutinib. In some embodiments, NK cells are not treated with nilotinib. In some embodiments, NK cells are not treated with saracatinib. In some embodiments, NK cells are not treated with mTOR inhibitors.

[0115] In some embodiments, the inactivating agent is an agent that can be removed after an appropriate treatment period. In some embodiments, the inactivating effect of the inactivating agent can be reversed by removing the inactivating agent. In some embodiments, after removing the inactivating agent, cells (e.g., NK cells) can be reactivated spontaneously without adding additional activators. In some embodiments, the inactivating agent is removed by washing away the inactivating agent, and those skilled in the art understand the steps required for cell culture, such as cell expansion, cell division, cell washing, etc. In some embodiments, the inactivating agent is removed before storing (e.g., cryopreservation) cells (e.g., NK cells). In some embodiments, the inactivating agent is removed after storing (e.g., cryopreservation) cells (e.g., NK cells).

[0116] In some embodiments, the cells (e.g., NK cells) are treated with an inactivating agent for more than, less than, or exactly about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 hours, or any range derivable therein. In certain embodiments, the NK cells are treated with an inactivating agent for more than, less than, or just about 16 hours. In certain embodiments, the NK cells are treated with an inactivating agent for more than, less than, or just about 24 hours. In certain embodiments, the NK cells are treated with an inactivating agent for more than, less than, or just about 36 hours. In certain embodiments, the NK cells are treated with an inactivating agent for more than, less than, or just about 48 hours. In certain embodiments, the NK cells are treated with an inactivating agent for more than, less than, or just about 60 hours. In certain embodiments, the NK cells are treated with an inactivating agent for more than, less than, or just about 72 hours. In certain embodiments, the NK cells are treated with an inactivating agent for more than, less than, or just about 84 hours. In certain embodiments, the NK cells are treated with an inactivating agent for more than, less than, or just about 96 hours. In certain embodiments, the NK cells are treated with an inactivating agent for about 24 to 96 hours, about 24 to 72 hours, about 24 to 48 hours, about 36 to 84 hours, or about 48 to 72 hours.

[0117] In some embodiments, cells (e.g., NK cells) are cultured for at least about or about 1 day, 2 days, 3 days, 4 days, 5 days, 6 days, 7 days, 8 days, 9 days, 10 days, 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days, 21 days, 22 days, 23 days, 24 days, 25 days, 26 days, 27 days, 28 days, 29 days or 30 days, cells are treated with an inactivating agent. In some embodiments, cells (e.g., NK cells) are cultured for at least about or about 11 days, 12 days, 13 days, 14 days, 15 days or 16 days, cells (e.g., NK cells) are treated with an inactivating agent. In some embodiments, cells (e.g., NK cells) are cultured for about 12 days, cells (e.g., NK cells) are treated with an inactivating agent. In some embodiments, after the cells (e.g., NK cells) are cultured for about 13 days, the cells (e.g., NK cells) are treated with an inactivating agent. In some embodiments, after the cells (e.g., NK cells) are cultured for about 14 days, the cells (e.g., NK cells) are treated with an inactivating agent. In some embodiments, after the cells (e.g., NK cells) are cultured for about 15 days, the cells (e.g., NK cells) are treated with an inactivating agent.

[0118] In certain embodiments, the inactivator is a kinase inhibitor. In some embodiments, the kinase inhibitor is a broad-spectrum kinase inhibitor, which may have an inhibitory effect on more than one tyrosine kinase and / or serine / threonine kinase. In certain embodiments, the inactivator is a mammalian (mechanism) target of rapamycin (mTOR) inhibitor. In certain embodiments, the mTOR inhibitor is rapamycin (also known as sirolimus), everolimus and / or temsirolimus. In certain embodiments, the mTOR inhibitor is rapamycin. In certain embodiments, the inactivator is a kinase inhibitor approved by the U.S. FDA (e.g., see Robert Roskoski "Properties of FDA-approved small molecule proteinkinase inhibitors: A 2021update" Pharmalogical Research, March 2021; It is incorporated herein by reference for purposes described herein). In certain embodiments, the inactivator is dasatinib. In certain embodiments, the inactivator is nilotinib.

[0119] In certain embodiments, the inactivating agent is a tyrosine kinase (TK) inhibitor. In certain embodiments, the TK inhibitor is lorlatinib, brigatinib, ceritinib, alectinib, crizotinib, bosutinib, ponatinib, nilotinib, dasatinib, saracatinib, imatinib, zanubrutinib, acalabrutinib, ibrutinib, capmatinib, pesidatinib, dacomitinib, osimertinib, erlotinib, gefitinib, lapatinib, afatinib, pemigatinib, erdatinib, nintedanib , gilteritinib, midostaurinib, tucatinib, neratinib, baricitinib, ruxolitinib, fedratinib, tofacitinib, ripretinib, selumetinib, binitinib, cobimetinib, trametinib, upadacitinib, afatinib, seratinib, cabozantinib, fostamatinib, larotrectinib, entrectinib, axitinib, regorafenib, pazopanib, sorafenib, lenvatinib, vandetanib, and / or sunitinib. In certain embodiments, the TK inhibitor is not lorlatinib, brigatinib, ceritinib, alectinib, crizotinib, bosutinib, ponatinib, nilotinib, dasatinib, saracatinib, imatinib, zanubrutinib, acalabrutinib, ibrutinib, capmatinib, pesidatinib, dacomitinib, osimertinib, erlotinib, gefitinib, lapatinib, afatinib, pemigatinib, erdafitinib, nimetazidine, or nimetazidine. , gilteritinib, midostaurin, tucatinib, neratinib, baricitinib, ruxolitinib, fedratinib, tofacitinib, ripretinib, selumetinib, binitinib, cobimetinib, trametinib, upadacitinib, afatinib, seratinib, cabozantinib, fostamatinib, larotrectinib, entrectinib, axitinib, regorafenib, pazopanib, sorafenib, lenvatinib, vandetanib, and / or sunitinib.

[0120] In certain embodiments, the TK inhibitor is an anaplastic lymphoma kinase (ALK) inhibitor. In certain embodiments, the ALK inhibitor is lorlatinib, brigatinib, ceritinib, alectinib and / or crizotinib. In certain embodiments, the ALK inhibitor is not lorlatinib, brigatinib, ceritinib, alectinib and / or crizotinib.

[0121] In certain embodiments, the TK inhibitor is a breakpoint cluster tyrosine-protein kinase ABL1 fusion (BCR-Abl) inhibitor. In certain embodiments, the BCR-Abl inhibitor is bosutinib, ponatinib, nilotinib, dasatinib, saracatinib and / or imatinib. In certain embodiments, the TK inhibitor is dasatinib and / or nilotinib. In certain embodiments, the TK inhibitor is dasatinib. In certain embodiments, the BCR-Abl inhibitor is not bosutinib, ponatinib, nilotinib, dasatinib, saracatinib and / or imatinib.

[0122] In certain embodiments, the TK inhibitor is a Bruton's tyrosine kinase (BTK) inhibitor. In certain embodiments, the BTK inhibitor is zanubrutinib, acalabrutinib, and / or ibrutinib. In certain embodiments, the BTK inhibitor is not zanubrutinib, acalabrutinib, and / or ibrutinib.

[0123] In certain embodiments, the TK inhibitor is a c-MET (a member of the MNNG HOS transforming gene family) inhibitor. In some embodiments, the c-MET inhibitor is capmatinib. In some embodiments, the c-MET inhibitor is not capmatinib.

[0124] In certain embodiments, the TK inhibitor is a colony stimulating factor 1 receptor (CSFR1) inhibitor. In some embodiments, the CSFR1 inhibitor is pesidatinib. In some embodiments, the CSFR1 inhibitor is not pesidatinib.

[0125] In certain embodiments, the TK inhibitor is an epidermal growth factor receptor (EGFR) inhibitor. In certain embodiments, the EGFR inhibitor is dacomitinib, osimertinib, erlotinib, gefitinib, lapatinib and / or afatinib. In certain embodiments, the EGFR inhibitor is not dacomitinib, osimertinib, erlotinib, gefitinib, lapatinib and / or afatinib.

[0126] In certain embodiments, the TK inhibitor is a fibroblast growth factor receptor (FGFR) inhibitor. In certain embodiments, the FGFR inhibitor is pemigatinib, erdafitinib and / or nintedanib. In certain embodiments, the FGFR inhibitor is not pemigatinib, erdafitinib and / or nintedanib.

[0127] In certain embodiments, the TK inhibitor is a vascular endothelial growth factor receptor (VEGFR) inhibitor. In certain embodiments, the VEGFR inhibitor is giltertinib, axitinib, regorafenib, pazopanib, sorafenib, lenvatinib, cabozantinib and / or vandetanib. In certain embodiments, the VEGFR inhibitor is not giltertinib, axitinib, regorafenib, pazopanib, sorafenib, lenvatinib, cabozantinib and / or vandetanib.

[0128] In certain embodiments, the TK inhibitor is an fms-like tyrosine kinase 3 (FLT3) inhibitor. In certain embodiments, the FLT3 inhibitor is midostinib. In certain embodiments, the FLT3 inhibitor is not midostinib.

[0129] In certain embodiments, the TK inhibitor is a receptor tyrosine protein kinase erbB-2 (also known as HER2) inhibitor. In some embodiments, the HER2 inhibitor is tucatinib, lapatinib, afatinib and / or neratinib. In some embodiments, the HER2 inhibitor is not tucatinib, lapatinib, afatinib and / or neratinib.

[0130] In certain embodiments, the TK inhibitor is a Janus kinase 1, 2 and / or 3 (JAK) inhibitor. In some embodiments, the JAK inhibitor is baricitinib, ruxolitinib, fedratinib and / or tofacitinib. In some embodiments, the JAK inhibitor is not baricitinib, ruxolitinib, fedratinib and / or tofacitinib.

[0131] In certain embodiments, the TK inhibitor is a platelet-derived growth factor receptor (PDGFR) inhibitor. In certain embodiments, the PDGFR inhibitor is ripretinib, upadacitinib and / or afatinib. In certain embodiments, the PDGFR inhibitor is not ripretinib, upadacitinib and / or afatinib.

[0132] In certain embodiments, the TK inhibitor is a mitogen-activated protein kinase kinase 1 / 2 (MEK1 / 2) inhibitor. In some embodiments, the MEK1 / 2 inhibitor is selumetinib, binitinib, cobimetinib and / or trametinib. In some embodiments, the MEK1 / 2 inhibitor is not selumetinib, binitinib, cobimetinib and / or trametinib.

[0133] In certain embodiments, the TK inhibitor is a proto-oncogene tyrosine protein kinase receptor (RET) inhibitor. In certain embodiments, the RET inhibitor is alectinib, lenvatinib, septanib and / or cabozantinib. In certain embodiments, the RET inhibitor is not alectinib, lenvatinib, septanib and / or cabozantinib.

[0134] In certain embodiments, the TK inhibitor is a tyrosine protein kinase (SYK) inhibitor. In some embodiments, the SYK inhibitor is fostamatinib. In some embodiments, the SYK inhibitor is not fostamatinib.

[0135] In certain embodiments, the TK inhibitor is a Trk system potassium uptake protein A, B, and / or C (TRKA / B / C) inhibitor. In some embodiments, the TRKA / B / C inhibitor is larotrectinib and / or entrectinib. In some embodiments, the TRKA / B / C inhibitor is not larotrectinib and / or entrectinib.

[0136] In certain embodiments, the TK inhibitor is an inhibitor of proto-oncogene tyrosine protein kinase ROS (ROS1). In some embodiments, the ROS1 inhibitor is crizotinib and / or entrectinib. In some embodiments, the ROS1 inhibitor is not crizotinib and / or entrectinib.

[0137] In certain embodiments, the TK inhibitor is a mast cell / stem cell growth factor receptor Kit (KIT) inhibitor. In certain embodiments, the KIT inhibitor is ripretinib and / or imatinib. In certain embodiments, the KIT inhibitor is not ripretinib and / or imatinib.

[0138] In some embodiments, the concentration of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47 , 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 nM or any range derivable therein. In some embodiments, the concentration of about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47 , 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 μM or any range derivable therein. In certain embodiments, the cells are treated with an inactivating agent at a concentration of about 0.1-1, 1-5, 5-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-160, 160-170, 170-180, 180-190, or 190-200 nM.In certain embodiments, the cells are treated with an inactivating agent at a concentration of about 0.1-1, 1-5, 5-10, 10-20, 20-30, 30-40, 40-50, 50-60, 60-70, 70-80, 80-90, 90-100, 100-110, 110-120, 120-130, 130-140, 140-150, 150-160, 160-170, 170-180, 180-190, or 190-200 μM. In certain embodiments, the concentration of about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,050, 1,100, 1,150, 1,200, 1,250, 1,300, 1,350, 1,400, 1,450, 1,500, 1,550, 1,600 9,000, 9,500, or 10,000 nM, or any range derivable therein. In certain embodiments, the concentration of about 50, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, 900, 950, 1,000, 1,050, 1,100, 1,150, 1,200, 1,250, 1,300, 1,350, 1,400, 1,450, 1,500, 1,550, 1,600 , 1,650, 1,700, 1,750, 1,800, 1,850, 1,900, 1,950, 2,000, 2,500, 3,000, 3,500, 4,000, 4,500, 5,000, 5,500, 6,000, 6,500, 7,000, 7,500, 8,000, 8,500, 9,000, 9,500 or 10,000 μM or any range derivable therein.

[0139] In certain embodiments, cells are inactivated by treating cells with an inactivator. In some embodiments, cells are inactivated by treating cells with an inactivator before storage, such as but not limited to cryopreservation, and under conditions suitable for inactivating cells. In some embodiments, the concentration of the inactivator is at least or about 2000, 1000, 500, 200, 100, 50, 40, 30, 25, 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1 mM, or any range that can be derived therefrom. In some embodiments, the concentration of the inactivator is at least or about 11 mM. In some embodiments, the concentration of the inactivator is at least or about 10 mM. In some embodiments, the concentration of the inactivator is at least or about 9 mM. In some embodiments, the inactivator is in a suitable aqueous or non-aqueous solvent. In some embodiments, the inactivating agent is in a suitable non-aqueous solvent. In some embodiments, the inactivating agent is in DMSO. In some embodiments, the inactivating agent and / or any solvent is stored under cold conditions.

[0140] In certain embodiments, based on the total volume of cell culture, cells are treated with an inactivator. In some embodiments, for every 1mL cell culture volume, at least or about 0.001, 0.01, 0.05, 0.1, 0.15, 0.2 or 0.3 μL inactivator is added to the cell culture. In some embodiments, for every 1mL cell culture volume, at least about or about 0.05 μL of concentration is added to the cell culture for at least about or about 10mM of inactivator (in DMSO). In some embodiments, for every 1mL cell culture volume, at least about or about 0.1 μL of concentration is added to the cell culture for at least about or about 10mM of inactivator (in DMSO). In some embodiments, for every 1mL cell culture volume, at least about 0.15 μL or about 0.15 μL of concentration is at least about 10mM or about 10mM of DMSO in inactivator is added to the cell culture. In some embodiments, the cells are treated with an inactivating agent at a final concentration of at least about 0.05 μM, 0.1 μM, 0.5 μM, 1 μM, 5 μM, 10 μM, 50 μM, or 100 μM, or any range derivable therein. In some embodiments, the cells are treated with an inactivating agent at a final concentration of at least about 0.5 μM or about 0.5 μM. In some embodiments, the cells are treated with an inactivating agent at a final concentration of at least about 1 μM or about 1 μM. In some embodiments, the cells are treated with an inactivating agent at a final concentration of at least about 5 μM or about 5 μM.

[0141] In certain embodiments, treatment of cells (e.g., NK cells) with an inactivating agent results in increased expression of one or more of C-kit, CCR-5, CD62L and / or CXCR4, and / or decreased expression of one or more of NKG2D, DNAM, OX-40, TRAIL, HLA-DR, CD2, CD25, ICOS and / or CD95 relative to activated NK cells.

[0142] E. Harvesting cells for cryopreservation

[0143] In some embodiments, following inactivation, the cells are harvested and then placed in a cryopreservation medium for storage (eg, cryopreservation).

[0144] In certain embodiments, washing medium can be used to wash cells after inactivation. In some embodiments, washing medium comprises HSA PlasmaLyte-A buffer at a concentration of about 0.1%, 0.2%, 0.3%, 0.4%, 0.5%, 0.6%, 0.7%, 0.8%, 0.9% or 1.0% HSA (or any range that can be derived therein). HSA PlasmaLyte-A buffer can be prepared by adding HSA at a concentration of about 25% of the desired amount to 1L PlasmaLyte-A. For example, in some embodiments, 0.5% HSA PlasmaLyte-A buffer can be prepared by adding 20mL 25% HSA to 1L Plasma-LyteA.

[0145] In certain embodiments, centrifugation can be used to wash cells through a wash medium under gentle and non-destructive conditions (e.g., low centrifugation speed, no braking or low braking and / or short centrifugation time). In some embodiments, as will be appreciated by those skilled in the art, different combinations of centrifugation parameters can be used to achieve cell washing while reducing potential damage to the cells. In some embodiments, centrifugation and processing of cells can be performed under aseptic conditions using sterile containers and / or equipment.

[0146] In certain embodiments, cells and culture medium can be used for one or more quality control tests. One or more quality control tests can include the following aspects, such as cell count, cell viability, microorganisms (e.g., mycoplasma measured by PCR), viruses (e.g., foreign viruses), cytokines (e.g., IL-15 and IL-15 by Elisa), immunophenotyping, endotoxin, vector copy number, replicating retrovirus (RCR, for example, measured by QPCR) and / or residual beads.

[0147] In certain embodiments, the cells may be washed prior to being placed in a cryopreservation medium. In some embodiments, an exemplary method of washing cells includes: harvesting cells from one or more cell culture flasks and pooling into one or more appropriately labeled sterile centrifuge tubes; gently resuspending the pooled cell suspension; washing the cells, including centrifuging the cells using a gentle and / or non-destructive centrifuge setting, aseptically aspirating the supernatant and discarding it, and gently resuspending the cell pellet using a suitable buffer (e.g., 0.5% HSA PlasmaLyte buffer); collecting a quality control sample; and calculating the total viable cells per milliliter based on the quality control count and the total viable cell recovery after harvest.

[0148] In certain embodiments, the cells may be placed in a cryopreservation medium with or without washing. In some embodiments, the cell pellet may be harvested by centrifugation using a gentle and / or non-destructive centrifuge setting, and the cell pellet may be gently dispersed in a freezing medium and transferred to a refrigerator (e.g., at about 4° C.) for a period of time.

[0149] F. Cryopreservation Medium

[0150] In some embodiments, following inactivation and / or harvesting, the cells are placed in a cryopreservation medium for storage (eg, cryopreservation).

[0151] In certain embodiments, at least one cytokine and / or at least one growth factor can be added to the cryopreservation medium. In some embodiments, cryoprotectant can be dimethyl sulfoxide (DMSO), glycerol, glycerol, hydroxyethyl starch, dextran trehalose or its combination. In some embodiments, non-serum substitutes can include platelet lysate and / or blood product lysate or human or animal serum albumin. In some cases, at least one cytokine (it can be interleukin (IL) -1, IL-2, IL-3, IL-4, IL-6, IL-7, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-21, IL-22, IL-23, interferon, tumor necrosis factor, stem cell factor, FLT3- ligand, APRIL, thrombopoietin, erythropoietin or its combination) is natural protein, recombinant protein, synthetic protein or its mixture.

[0152] In certain embodiments, the cryopreservation medium for cryopreserving the inactivated cells of the present disclosure may include dimethyl sulfoxide (DMSO); serum (including human serum); and one or more cytokines of any type. In certain embodiments, any one or more components of the cryopreservation medium are natural proteins, which may also be referred to as endogenous or recombinant proteins. In certain cases, the endogenous protein is one or more cytokines. The cryopreservation medium may also include one or more FDA-approved agents, and in certain cases, one or more FDA-approved agents may be one or more cytokines.

[0153] In certain embodiments, the cryopreservation medium composition comprises, consists of or is substantially composed of at least one cryoprotectant, at least one serum (or non-serum substitute for serum) and at least one cytokine and / or at least one growth factor. The example of cryoprotectant comprises dimethyl sulfoxide (DMSO), glycerol, glycerol, hydroxyethyl starch or its combination. For composition, non-serum substitute can comprise platelet lysate and / or blood product lysate and / or human serum albumin and / or animal serum albumin. Human serum can be human AB serum. Any cytokine can be natural protein, recombinant protein, synthetic protein or its mixture, including at least one cytokine (as the cytokine of Food and Drug Administration (FDA) approval). In certain cases, composition comprises two or more cytokines. By way of example only, the at least one cytokine is IL-1, IL-2, IL-3, IL-4, IL-6, IL-7, IL-9, IL-10, IL-12, IL-13, IL-15, IL-17, IL-18, IL-21, IL-22, interferon, tumor necrosis factor, stem cell factor, FLT3-ligand, APRIL, or a combination thereof.

[0154] In specific cases, the one or more cytokines include IL-2, IL-15, IL-12, IL-18 and / or IL-21. The cells can be suspended in a GMP cryopreservation medium comprising DMSO (e.g. 1-10%, such as 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10%, especially 5%), 95% human AB serum (e.g. 90-99%, such as 91, 92, 93, 94, 95, 96, 97, 98 or 99%, especially 95%), platelet lysate (e.g. 90-99%, such as 91, 92, 93, 94, 95, 96, 97, 98 or 99%, especially 95%), 97, 98 or 99%, in particular 95%), IL-2 (e.g. 50-500 U / mL, such as 100, 200, 300, 400, 500, 1000 or 5000 U / mL, in particular 400 U / mL), IL-15 (5-500 ng / ml) and / or IL-21 (e.g. 1-500 ng / mL, such as 10, 20, 30, 40, 50, 100 or 500 ng / mL, in particular 20 ng / mL). In certain cases, the cells are frozen in liquid nitrogen using a rate-controlled method.

[0155] In certain embodiments, the cryoprotectant comprises a certain amount of the composition; in certain aspects, the cryoprotectant comprises 4-6% of the composition or 5-10% of the composition; in certain cases, the cryoprotectant comprises 4-10, 4-9, 4-8, 4-7, 4-6, 4-5, 5-10, 5-9, 5-8, 5-7, 5-6, 6-10, 6-9, 6-8, 6-7, 7-10, 7-9, 7-8, 8-10, 8-9 or 9-10% of the composition. The serum may comprise a specific amount of the composition, for example, 5-99, 5-90, 5-85, 5-80, 5-75, 5-70, 5-65, 5-60, 5-55, 5-50, 5-45, 5-40, 5-35, 5-30, 5-25, 5-20, 5-15, 5-10, 10-99, 10-90, 10-85, 10-80, 10-75, 10-70, 10-65, 10-60, 10-55, 10-50, 10-45 , 10-40, 10-35, 10-30, 10-25, 10-20, 10-15, 25-99, 25-90, 25-85, 25-08, 25-75, 25-70, 25-65, 25-60, 25-55, 25-50, 25-45, 25-40, 25-35, 25-30, 50-99, 50-90, 50-85, 50-80, 50-75, 50-70, 40-65, 50-60 or 50-55%. The platelet lysate may comprise a particular amount of the composition, for example, 5-99, 5-90, 5-85, 5-80, 5-75, 5-70, 5-65, 5-60, 5-55, 5-50, 5-45, 5-40, 5-35, 5-30, 5-25, 5-20, 5-15, 5-10, 10-99, 10-90, 10-85, 10-80, 10-75, 10-70, 10-65, 10-60, 10-55, 10-50, 10-150, 10- In certain aspects, the platelet lysate comprises 95% of the composition.

[0156] In embodiments where the composition comprises IL-2, the IL-2 may be present at a concentration of 1-5000, 1-4000, 1-3000, 1-2000, 10-1000, 100-5000, 100-4000, 100-3000, 100-1000, 100-1000, 100-500, 500-5000, 500-4000, 500-3000, 500-2000, 500-1000, 1000-5000, 1000-4000, 1000-3000, 1000-2000, or 2000-5000 U / mL, particularly including at a concentration of 100, 200, 300, 400, or 500 U / mL. In embodiments where the composition comprises IL-21, IL-21 may be present at a concentration of 10-3000, 10-2500, 10-2000, 10-1000, 10-500, 100-3000, 100-2000, 100-1000, 500-3000, 500-2000, 500-1000 or 1000-3000 ng / mL, particularly including at a concentration of 10, 15, 20 or 25 ng / mL. In particular instances, IL-15 is present in the composition at a concentration of 10-2000, 10-1000, 10-500, 100-2000, 100-1000, 100-500, 500-2000, 500-1000 or 1000-2000 ng / mL.

[0157] For cryopreservation, as an example, inactivated cells (e.g., NK cells for adoptive therapy, including cord blood NK cells) can be suspended in a GMP cryopreservation medium, which includes, for example, 5% DMSO, 95% human AB serum, 400 units of IL-2 / ml, and 20ng IL-21 / ml. For example, dry ice, liquid nitrogen, non-liquid nitrogen freezers, freezing by pouring, rate-controlled freezing methods (e.g., using a controlled rate freezer) and / or non-rate-controlled freezing methods can be used to freeze them. In some embodiments, after freezing, the inactivated cells can be stored in a liquid nitrogen storage unit in a vapor phase.

[0158] In some embodiments, the cryopreservation medium comprises glucose, a pH indicator, one or more salts, one or more amino acids and one or more vitamins. Examples of pH indicators include at least phenol red, bromophenol blue, methyl orange, bromocresol purple, Congo red, etc. Examples of salts include at least sodium chloride, sodium bicarbonate, disodium phosphate, potassium chloride, magnesium sulfate, calcium nitrate, or a combination thereof. Examples of amino acids include glutamine, arginine, asparagine, cysteine, leucine, isoleucine, lysine, serine, aspartic acid, glutamic acid, hydroxyproline, proline, threonine, tyrosine, valine, histidine, methionine, phenylalanine, glycine, tryptophan, reduced glutathione, or a combination thereof. In some embodiments, the amount of one or more amino acids in the culture medium is greater than one or more other amino acids, and one or more other amino acids may be present in the culture medium in the same amount. For example, in the culture medium, the amount of glutamine may or may not be the largest in the culture medium, and the second largest amount is arginine. In the culture medium, asparagine, cysteine, leucine, isoleucine or a combination thereof may or may not be present in substantially the same amount. In the culture medium, aspartic acid, glutamic acid, hydroxyproline, proline, threonine, tyrosine, valine or a combination thereof may or may not be present in substantially the same amount. In the culture medium, histidine, methionine, phenylalanine or a combination thereof may or may not be present in substantially the same amount. One or more specific vitamins may be present in the culture medium, including i-inositol; choline chloride; para-aminobenzoic acid, folic acid, nicotinamide, pyridoxine hydrochloride, thiazolidine hydrochloride; calcium pantothenate; biotin; riboflavin; cyanocobalamin; or a combination thereof, may be present in the culture medium. Vitamins may or may not be present in a specific amount in the culture medium. For example, i-inositol may be present in the largest amount, and choline chloride is the second largest amount. In some cases, certain vitamins may be present in substantially equal amounts in the culture medium, including p-aminobenzoic acid, folic acid, nicotinamide, pyridoxine hydrochloride, thiazolidine hydrochloride, or a combination thereof. The amounts of biotin and riboflavin in the culture medium may or may not be substantially equal. Cyanocobalamin may or may not be present as a minimum amount of any vitamin in the culture medium.

[0159] In some embodiments, the cells can be cultured in a medium substantially similar to or identical to RPMI 1640 medium (also referred to as RPMI medium), which is a growth medium developed by Moore et al. (Moore GE, Gerner RE, Franklin HA (1967). "Culture of normal human leukocytes". JAMA. 199(8):519–524) at the Roswell Park Memorial Institute.

[0160] In one specific example, 1 liter of RPMI 1640 contains or comprises the following: glucose (2 g); pH indicator (phenol red, 5 mg); salts (6 g sodium chloride, 2 g sodium bicarbonate, 1.512 g disodium phosphate, 400 mg potassium chloride, 100 mg magnesium sulfate, and 100 mg calcium nitrate); amino acids (300 mg glutamine; 200 mg arginine; 50 mg each of asparagine, cystine, leucine, and isoleucine; 40 mg lysine hydrochloride; 30 mg serine; 20 mg each of aspartic acid, glutamic acid, hydroxyproline, proline, threonine, tyrosine, and valine; 15 mg each of histidine, methionine, and phenylalanine; 10 mg glycine; 5 mg tryptophan; and 1 mg reduced glutathione); and vitamins (35 mg i-inositol; 3 mg choline chloride; 1 mg each of p-aminobenzoic acid, folic acid, nicotinamide, pyridoxine hydrochloride and thiazide hydrochloride; 0.25 mg calcium pantothenate; 0.2 mg each of biotin and riboflavin; and 0.005 mg cyanocobalamin).

[0161] In certain embodiments, the composition comprises: a) one or more of platelet lysate, PlasmaLyte, and Roswell Park Memorial Institute (RPMI) medium; (b) one or more of dextran, albumin, and DMSO, which may be formulated in dextrose or saline (e.g.); and (c) one or more of IL-2, IL-15, and IL-21. In certain embodiments, any composition comprises platelet lysate at 50% to 90% of the composition, including about 50% of the composition or about 90% of the composition. Where PlasmaLyte is utilized, PlasmaLyte may comprise about 32.5% to 70% of the composition, including about 32.5%, 35%, 50%, or 70% of the composition. RPMI may comprise 32.5% to 50% of the composition, including about 32.5%, 35%, or 50% of the composition. Where dextran is utilized, dextran may comprise about 25-40% of the composition, including about 25% or about 40% of the composition. Where albumin is utilized, albumin may comprise about 1-99% of the composition, including about 20% of the composition. Where DMSO is utilized, DMSO may comprise about 5-7.5% of the composition, including about 5% or 7.5% of the composition.

[0162] In some embodiments, the cells of the present disclosure can be stored in the following specific formulations for cryopreservation at any time. In some embodiments, the cells of the present disclosure can be stored in the following specific formulations for cryopreservation after treatment with an inactivating agent. Examples of specific formulations with specific concentrations as described below can be used.

[0163] Table 1 - Exemplary Cryopreservation Media

[0164]

[0165]

[0166] Table 2 - Exemplary cryopreservation media with specific concentrations

[0167]

[0168] III. Storage cells

[0169] The cells to be stored (e.g., cryopreserved) can be of any kind, including prokaryotic cells or eukaryotic cells, but in a specific embodiment, the cells are mammalian cells. In a specific embodiment, the cells are inactivated before storage (e.g., treated with one or more inactivating agents before cryopreservation). In a more specific embodiment, the mammalian cells are immune cells. In an even more specific embodiment, the immune cells are NK cells. In some embodiments, NK cells can be derived from any source described herein. In a specific embodiment, NK cells are derived from human CB.

[0170] In some embodiments, mammalian cells can be used for any type of research or therapeutic purposes. In specific embodiments, the cell is any type of immune cell, including NK cells, T cells, NK T cells, PBMC, antigen presenting cells (APC), B cells, monocytes, dendritic cells, macrophages, monocytes, neutrophils, induced pluripotent stem cells (iPSC), hematopoietic stem cells or any cells derived from hematopoietic stem cells, iPSC and / or MSC, differentiation or stereotyped cells from any organ, any fibroblasts, etc. In some examples, the cell may be or may not be a stem cell.

[0171] As described herein, cells are inactivated before storage (e.g., freezing). In addition, in some embodiments, cells are modified before and / or after inactivation and / or storage. For example, cells can be transfected or transduced with a vector or electroporated with a plasmid encoding a specific gene product (e.g., a gene product that confers cell therapy activity). In a specific embodiment, cells are transfected or transduced or electroporated with one or more antigen receptors, including T cell receptors (TCR) or chimeric antigen receptors (CAR), cytokines, homing receptors, or any other genes. In a particular case, the cell is an immune cell expressing CAR, such as an NK cell expressing CAR. In a particular case, the cell is gene-edited.

[0172] In certain embodiments, the cells can be stored in a suitable container at various concentrations and / or various volumes. In some embodiments, the cells can be stored at a concentration of at least about or about 3×10 4 , 3×10 5 , 3×10 6 , 5×10 6 , 1×10 7 , 2.5×10 7 , 5×10 7 or 1×10 8In some embodiments, the cells can be stored in one or more vials having a size of at least about or about 0.5 mL, 1 mL, 2 mL, 6 mL, 20 mL, 50 mL, 100 mL, 150 mL, or 200 mL, or any range derivable therein.

[0173] In certain embodiments, NK cells are derived from human peripheral blood mononuclear cells (PBMC), unstimulated leukocyte removal products (PBSC), human embryonic stem cells (hESC), induced pluripotent stem cells (iPSC), bone marrow or umbilical cord blood by methods well known in the art. Specifically, NK cells can be separated from umbilical cord blood (CB), peripheral blood (PB), bone marrow or stem cells. In a specific embodiment, immune cells are separated from the collected CB. CB can be collected from 2, 3, 4, 5, 6, 7, 8, 10 or more units. Immune cells can be autologous or allogeneic. Separated NK cells can be fully matched, fully mismatched, haplotype matched (half-matched) or more than haplotype but less than fully matched with the subject to be administered cell therapy. NK cells can be detected by specific surface markers (such as CD16 and CD56 in people).

[0174] In certain aspects, the starting population of NK cells can be obtained by isolating mononuclear cells using ficoll density gradient centrifugation. Any cells expressing CD3, CD14 and / or CD19 can be removed from the cell culture, and the cell culture can be characterized to determine the expression of CD56. + / CD3 - In some procedures, cells can be positively selected using CD56 or other specific NK cell antibodies.

[0175] Cells can be expanded in the presence of APC (e.g., universal APC and / or artificial APC). Amplification can last for about 2-30 days or longer, such as 3-20 days, especially 12-16 days, such as 12, 13, 14, 15, 16, 17, 18 or 19 days, especially about 14 days. NK cells and APC can be present in a ratio of about 3: 1 to 1: 3, such as 2: 1, 1: 1, 1: 2, especially about 1: 2. The amplified culture may further include cytokines to promote amplification, such as IL-2, IL-2, IL-15, IL-21 and / or IL-18. The cytokine can be present in a concentration of about 10 to 500U / mL, such as 100 to 300U / mL, especially about 200U / mL. Cytokines can be supplemented in the amplified culture, for example, every 2 to 3 days. APCs may be added to the culture at least once more, for example after transduction of a transgenic (e.g., CAR, TCR, cytokine, etc.). In a particular embodiment, the cytokine is present in the cryopreservation medium in an amount to avoid providing a therapeutic effect to an individual after receiving the cell (e.g., if and when the culture medium is included with the cell when the cell is administered to the subject). Due to the residual culture medium when preparing the cells for administration, the cells may be included in at least some cryopreservation medium, or the cells may be included in at least some cryopreservation medium according to the intended design. After thawing the cells, the cells may or may not be washed before being administered to the individual.

[0176] In some specific embodiments, the starting population of cells is MNC separated from a single CB unit by a ficoll density gradient. The cells can then be washed and depleted of CD3, CD14 and CD19 positive cells therefrom, for example by using CliniMACS immunomagnetic beads (Miltenyi Biotec). Unlabeled enriched CB-NK cells can be collected, washed with CliniMACS buffer, counted and combined with irradiated (e.g., 100 Gy) APCs, for example, at a 1:2 ratio. The cell mixture (e.g., 1 x 10 6 Cells / mL) can be transferred to a cell culture flask containing NK complete medium (e.g., 90% stem cell growth medium, 10% FBS, 2mM L-glutamine) and IL-2 (e.g., 50 to 500, e.g., 100 to 300, e.g., 200 U / mL). The cells can be incubated at 37° C. in 5% CO2. On day 3, the cells can be collected by centrifugation and resuspended in NK complete medium (e.g., 1 x 10 cells / mL) containing IL-2 (e.g., 50 to 500, e.g., 100 to 300, e.g., 200 U / mL). 6The medium can be replaced with 100 cells / mL. The cells can be incubated at 37°C in 5% CO2. On day 5, the number of wells required for RetroNectin transduction can be determined by the number of CB-NK cells in culture. The RetroNectin solution can be plated into the wells of a 24-well culture plate. The plate can be sealed and stored in a 4°C refrigerator.

[0177] In some embodiments, on day 6, a second NK selection as described on day 0 can be performed prior to transduction of CB-NK cells. Cells can be washed with CliniMACS buffer, centrifuged and centrifuged at 0.5 x 10 6 / mL resuspended in NK complete medium with IL-2 (e.g. 100 to 1000, especially 600 U / mL). The RetroNectin plate can then be washed with NK complete medium and incubated at 37°C until use. The NK complete medium in each well can be replaced with retroviral supernatant, followed by centrifugation of the plate at 32°C. The retroviral supernatant can then be aspirated and replaced with fresh retroviral supernatant. Containing 0.5x 10 6 A CB-NK cell suspension of 10 cells and 600U / mL IL-2 can be added to each well, and the plate can be centrifuged. The plate can then be incubated at 37°C and 5% CO2. On day 9, the CAR-transduced CB-NK cells can be removed from the transduction plate, collected by centrifugation and stimulated with irradiated (e.g., 100Gy) aAPC in NK complete medium with 200U / mL IL-2, for example at a ratio of 1:2. Incubate the cell culture flask at 37°C at 5% CO2. On day 12, a medium change can be performed. On day 14, cells can be collected by centrifugation, the supernatant can be aspirated and the cells can be resuspended in fresh NK complete medium containing 200U / mL IL-2. Incubate the cell culture flask at 37°C at 5% CO2. If there are more than 1x10 5 CD3 + cells / kg, CD3 can be measured using CliniMACS CD3 reagent + Cells are subjected to magnetic immunodepletion. On day 14 or 15, cells are harvested and then inactivated by treatment with an inactivating agent as described herein. After an appropriate time of inactivation, cells can be prepared for storage (e.g., cryopreservation). After any suitable storage period, cells can be thawed and used for any suitable purpose, such as, but not limited to, immunotherapy and / or other modifications.

[0178] The expanded NK cells can secrete type I cytokines (e.g., interferon-γ, tumor necrosis factor-α, and granulocyte-macrophage colony stimulating factor (GM-CSF)), as well as other cytokines and chemokines, which activate both innate and acquired immune cells. The measurement of these cytokines can be used to determine the activation state of NK cells. In addition, other methods known in the art for determining NK cell activation can be used to characterize the NK cells of the present invention.

[0179] In certain embodiments, the cells are manipulated to express: one or more engineered antigen receptors (including one or more chimeric antigen receptors and / or one or more engineered TCRs); one or more cytokines; one or more suicide genes; CD47; HLA-G; HLA-E; or a combination thereof.

[0180] A. Engineered Antigen Receptors

[0181] In some embodiments, the cells to be inactivated and cryopreserved are manipulated to express one or more engineered antigen receptors prior to inactivation and cryopreservation and / or following inactivation, cryopreservation, and subsequent thawing.

[0182] In some embodiments, cells (e.g., NK cells) can be genetically modified to express one or more engineered antigen receptors, including at least one or more chimeric antigen receptors (CARs) and / or one or more TCRs. In certain embodiments, the engineered antigen receptor is intended to target one or more cancer antigens.

[0183] In some embodiments, the engineered antigen receptor includes a CAR, including activation or stimulatory CAR, costimulatory CAR (see WO 2014 / 055668) and / or inhibitory CAR (iCAR, see Fedorov et al., 2013). CAR generally includes an extracellular antigen (or ligand) binding domain connected to (in some aspects, via a joint and / or one or more transmembrane domains) one or more intracellular signaling components. Such molecules generally mimic or approximate the signal of a natural antigen receptor, the signal of a combination of such receptors and costimulatory receptors, and / or the signal of a separate costimulatory receptor.

[0184] In some embodiments, cells (e.g., NK cells) can be modified to encode at least one CAR, and CAR can be, for example, the first generation, the second generation, or the third generation or subsequent generations. CAR may or may not have bispecificity for two or more different antigens. CAR may include one or more costimulatory domains. NK cells can also be modified to express receptors to enhance their binding to antibodies, such as CD16, CD32, and / or CD64 receptors. Each costimulatory domain may include, for example, TNFR superfamily members, CD28, CD137 (4-1BB), CD134 (OX40), DAP10, DAP12, CD27, CD2, CD5, ICAM-1, LFA-1 (CD11a / CD18), Lck, TNFR-I, TNFR-II, Fas, CD30, CD27, NKG2D, 2B4M, CD40, one or more costimulatory domains or combinations thereof. In a specific embodiment, CAR includes CD3zeta. In certain embodiments, the CAR lacks one or more specific co-stimulatory domains; for example, the CAR can lack 4-1BB and / or lack CD28.

[0185] In a specific embodiment, the CAR polypeptide in the cell includes an extracellular spacer domain connecting the antigen binding domain and the transmembrane domain, and this can be referred to as a hinge. The extracellular spacer domain may include but is not limited to an Fc fragment of an antibody or its fragment or derivative, a hinge region of an antibody or its fragment or derivative, an antibody CH2 region, an antibody CH3 region, an artificial spacer sequence, or a combination thereof. Examples of extracellular spacer domains include but are not limited to CD8-alpha hinges, CD28, artificial spacers made of polypeptides such as Gly3, or CH1, CH3 domains of IgG (e.g., human IgG1 or IgG4). In certain cases, the extracellular spacer domain may include (i) hinge, CH2 and CH3 regions of IgG4, (ii) hinge regions of IgG4, (iii) hinge and CH2 of IgG4, (iv) hinge regions of CD8-alpha or CD4, (v) hinge, CH2 and CH3 regions of IgG1, (vi) hinge regions of IgG1 or (vii) hinge and CH2 of IgG1, (viii) hinge regions of CD28, or combinations thereof. In certain embodiments, the hinge is from IgG1, and in certain aspects, the CAR polypeptide includes a specific IgG1 hinge amino acid sequence or is encoded by a specific IgG1 hinge nucleic acid sequence.

[0186] In some embodiments, the transmembrane domain in CAR may be derived from natural or synthetic sources. When the source is natural, in some aspects, the domain is derived from any membrane-bound or transmembrane protein. The transmembrane region includes those derived from the following (i.e., at least including one or more transmembrane regions): α, β or ζ chains of T cell receptors, CD28, CD3ζ, CD3ε, CD3γ, CD3δ, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD30, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154, ICOS / CD278, GITR / CD357, NKG2D and DAP molecules (e.g., DAP10 or DAP12). Alternatively, in some embodiments, the transmembrane domain is synthetic. In some aspects, the synthetic transmembrane domain mainly comprises hydrophobic residues, such as leucine and valine. In some aspects, a triplet of phenylalanine, tryptophan, and valine can be found at each end of the synthetic transmembrane domain.

[0187] Certain embodiments of the present disclosure relate to the use of nucleic acids, including nucleic acids encoding antigen-specific CAR polypeptides, including CAR (hCAR) that has been humanized to reduce immunogenicity, which includes an intracellular signaling domain, a transmembrane domain, and an extracellular domain comprising one or more signaling motifs. In certain embodiments, CAR can recognize an epitope comprising a shared space between one or more antigens. In certain embodiments, the binding region may include a complementary determining region of a monoclonal antibody, a variable region of a monoclonal antibody, and / or an antigen binding fragment thereof. In another embodiment, the specificity is derived from a peptide (e.g., a cytokine) bound to a receptor.

[0188] It is expected that human CAR nucleic acids can be human genes for enhancing cellular immunotherapy for human patients. In certain embodiments, the present invention includes full-length CAR cDNA or coding regions. The antigen binding region or domain may include a V fragment of a single chain variable fragment (scFv) derived from a specific human monoclonal antibody. H and V L Chain fragments, such as those described in U.S. Patent 7,109,304, which is incorporated herein by reference. The fragment can also be any number of different antigen binding domains of human antigen-specific antibodies. In a more specific embodiment, the fragment is an antigen-specific scFv encoded by a sequence optimized for human codon usage for expression in human cells. CAR can have bispecificity for two different antigen targets, or trispecificity for three different antigen targets, and so on.

[0189] The arrangement can be a multimer, such as a diabody or a multimer. The multimer is most likely formed by cross-pairing the variable parts of the light chain and the heavy chain into a diabody. The hinge portion of the construct can have a variety of alternatives, from complete deletion to maintaining the first cysteine, to proline instead of serine replacement, truncated to the first cysteine. The Fc portion can be deleted. Any stable and / or dimerized protein can achieve this purpose. Only one Fc domain can be used, such as the CH2 or CH3 domain of a human immunoglobulin. The hinge region, CH2 region, and CH3 region of a human immunoglobulin modified to improve dimerization can also be used. It is also possible to use only the hinge portion of an immunoglobulin. A portion of CD8α can also be used.

[0190] In certain embodiments, CAR can be co-expressed with one or more cytokines to improve persistence when the amount of tumor-associated antigen is low.For example, CAR can be co-expressed with one or more cytokines (eg, IL-7, IL-2, IL-15, IL-12, IL-23, IL-18, IL-21, IL-7, GMCSF or a combination thereof).In some embodiments, cells (eg, NK cells) expressing CAR are engineered to express one or more heterologous cytokines and / or are engineered to raise the normal expression of one or more heterologous cytokines.Cells may or may not be transduced or transfected for one or more cytokines on the same vector as other genes.In certain embodiments, engineered antigen receptors are co-expressed with cytokine IL-15.

[0191] The sequence of the open reading frame encoding the engineered chimeric receptor can be obtained from a genomic DNA source, a cDNA source, or can be synthesized (e.g., via PCR) or a combination thereof. Depending on the size of the genomic DNA and the number of introns, it may be desirable to use cDNA or a combination thereof, as introns have been found to stabilize mRNA. In addition, it may be further advantageous to use endogenous or exogenous non-coding regions to stabilize mRNA.

[0192] It is contemplated that the chimeric construct can be introduced into any type of immune cell as naked DNA or in a suitable vector. Methods for stably transfecting cells using naked DNA by electroporation are known in the art. See, e.g., U.S. Patent No. 6,410,319. Naked DNA generally refers to DNA encoding a chimeric receptor contained in a plasmid expression vector in a suitable orientation for expression.

[0193] Alternatively, a viral vector (e.g., a retroviral vector, an adenoviral vector, an adeno-associated viral vector, or a lentiviral vector) or a non-viral method can be used to introduce the chimeric construct into immune cells. Suitable vectors used according to the methods of the present disclosure are non-replicative in immune cells. Many viral-based vectors are known, in which the copy number of the virus maintained in the cell is low enough to maintain the viability of the cell, such as vectors based on HIV, SV40, EBV, HSV, or BPV. Non-viral vectors include plasmids, transposons, nanoparticles, liposomes, lipids, metals, or combinations thereof.

[0194] In some embodiments, the genetically engineered antigen receptor includes a recombinant TCR and / or a TCR cloned from a naturally occurring T cell."T cell receptor" or "TCR" refers to a molecule comprising variable α and β chains (also referred to as TCRα and TCRβ, respectively) or variable γ and δ chains (also referred to as TCRγ and TCRδ, respectively) and capable of specifically binding to an antigenic peptide bound to an MHC receptor. In some embodiments, TCR is in the αβ form.

[0195] Generally, TCRs in the form of αβ and γδ are usually similar in structure, but the T cells expressing them may have different anatomical locations or functions. TCR can be found on the cell surface or in a soluble form. Generally, TCR is found on the surface of T cells (or T lymphocytes), and is generally responsible for identifying antigens bound to major histocompatibility complex (MHC) molecules. In some embodiments, TCR may also include constant domains, transmembrane domains and / or short cytoplasmic tails (see, e.g., Janeway et al., 1997). For example, in some aspects, each chain of TCR may have an N-terminal immunoglobulin variable domain, an immunoglobulin constant domain, a transmembrane region and a short cytoplasmic tail at the C-terminus. In some embodiments, TCR is associated with the invariant protein of the CD3 complex involved in mediating signal transduction. Unless otherwise indicated, the term "TCR" should be understood to encompass its functional TCR fragment. The term also encompasses complete or full-length TCRs, including TCRs in the form of αβ or γδ.

[0196] Therefore, for the purposes of this article, reference to a TCR includes any TCR or functional fragment, such as an antigen binding portion of a TCR that binds to a specific antigenic peptide bound to an MHC molecule (i.e., an MHC-peptide complex). "Antigen binding portion" or "antigen binding fragment" of a TCR is used interchangeably and refers to a molecule that contains a portion of the structural domain of a TCR but binds to an antigen (e.g., an MHC-peptide complex) bound by a complete TCR. In some cases, the antigen binding portion comprises a variable domain of a TCR, such as a variable α chain and a variable β chain of a TCR, which is sufficient to form a binding site that binds to a specific MHC-peptide complex, such as typically each chain comprising three complementary determining regions.

[0197] In some embodiments, the variable domains of the TCR chains associate to form a loop or complementary determining region (CDR) similar to an immunoglobulin, which confers antigen recognition and determines peptide specificity by forming the binding site of the TCR molecule and determining peptide specificity. Typically, like immunoglobulins, CDRs are separated by framework regions (FRs) (see, e.g., Jores et al., 1990; Chothia et al., 1988; Lefranc et al., 2003). In some embodiments, CDR3 is the main CDR responsible for recognizing processed antigens, although it has also been shown that the CDR1 of the α chain interacts with the N-terminal portion of the antigenic peptide, while the CDR1 of the β chain interacts with the C-terminal portion of the peptide. CDR2 is considered to recognize MHC molecules. In some embodiments, the variable region of the β chain may include an additional hypervariable (HV4) region.

[0198] In some embodiments, the TCR chain comprises a constant domain. For example, like an immunoglobulin, the extracellular portion of the TCR chain (e.g., an alpha chain, a beta chain) can comprise two immunoglobulin domains, namely a variable domain at the N-terminus (see, e.g., V a or Vp; usually amino acids 1 to 116 based on Kabat numbering, Kabat et al., "Sequences of Proteins of Immunological Interest, USDept. Health and Human Services, Public Health Service National Institutes of Health, 1991, 5 th ed.), and the constant domains adjacent to the cell membrane (e.g., the α chain constant domain or C a, typically amino acids 117 to 259 based on Kabat, and a beta chain constant domain or Cp, typically amino acids 117 to 295 based on Kabat). For example, in some cases, the extracellular domain of a TCR formed by two chains comprises two membrane proximal constant domains and two membrane distal variable domains comprising CDRs. The constant domain of the TCR domain comprises a short linker sequence in which cysteine ​​residues form a disulfide bond, thereby forming a connection between the two chains. In some embodiments, the TCR may have additional cysteine ​​residues in each of the alpha and beta chains, such that the TCR comprises two disulfide bonds in the constant domain.

[0199] In some embodiments, the TCR chain may include a transmembrane domain. In some embodiments, the transmembrane domain is positively charged. In some cases, the TCR chain includes a cytoplasmic tail. In some cases, the structure allows TCR to associate with other molecules (e.g., CD3). For example, a TCR containing a constant domain with a transmembrane region can anchor the protein in the cell membrane and associate with the invariant subunit of the CD3 signal transduction device or complex.

[0200] Generally, CD3 is a multiprotein complex, which can have three different chains (γ, δ and ε) and ζ chain in mammals. For example, in mammals, the complex can contain a homodimer of CD3γ chain, CD3δ chain, two CD3ε chains and CD3ζ chain. CD3γ, CD3δ and CD3ε chains are highly correlated cell surface proteins of the immunoglobulin superfamily comprising a single immunoglobulin domain. The transmembrane region of CD3γ, CD3δ and CD3ε chains is negatively charged, which is a feature that allows these chains to associate with positively charged T cell receptor chains. The intracellular tails of CD3γ, CD3δ and CD3ε chains each contain a conserved motif, referred to as tyrosine-based immunoreceptor activation motifs or ITAMs, and each CD3ζ chain has three. Generally, ITAMs are related to the signal transduction ability of TCR complexes. These auxiliary molecules have negatively charged transmembrane regions and play a role in propagating signals from TCR to cells. CD3- and ζ- chains form so-called T cell receptor complexes together with TCR.

[0201] In some embodiments, TCR can be a heterodimer of two chains α and β (or optionally γ and δ), or it can be a single-chain TCR construct. In some embodiments, TCR is a heterodimer comprising two separate chains (α and β chains or γ and δ chains), which are, for example, connected by one or more disulfide bonds. In some embodiments, the TCR for the target antigen (e.g., cancer antigen) is identified and introduced into the cell. In some embodiments, the nucleic acid encoding TCR can be obtained from a variety of sources, such as by polymerase chain reaction (PCR) amplification of publicly available TCR DNA sequences. In some embodiments, TCR is obtained from biological sources, such as obtained from cells, such as obtained from T cells (e.g., cytotoxic T cells), T cell hybridomas, or other publicly available sources. In some embodiments, T cells can be obtained from cells separated in vivo. In some embodiments, high-affinity T cell clones can be isolated from patients, and TCR is isolated. In some embodiments, T cells can be cultured T cell hybridomas or clones. In some embodiments, TCR clones directed against a target antigen have been generated in transgenic mice engineered with human immune system genes (e.g., human leukocyte antigen system or HLA). See, for example, tumor antigens (see, for example, Parkhurst et al., 2009 and Cohen et al., 2005). In some embodiments, phage display is used to isolate TCRs directed against a target antigen (see, for example, Varela-Rohena et al., 2008 and Li, 2005). In some embodiments, a TCR or antigen binding portion thereof can be synthetically generated based on knowledge of the TCR sequence.

[0202] B. Antigen

[0203] The CAR and TCR of the present disclosure target one or more specific antigens.The antigen targeted by the genetically engineered antigen receptor includes an antigen expressed in the context of a disease, disorder or cell type targeted by adoptive cell therapy.Diseases and disorders include hyperplastic, neoplastic and malignant diseases and disorders, including cancer and tumors, including blood cancers, immune system cancers, such as lymphomas, leukemias and / or myeloma, such as B, T and myeloid leukemias, lymphomas and multiple myeloma.In some embodiments, compared with normal or non-targeted cells or tissues, antigens are selectively expressed or overexpressed on cells (such as tumors or pathogenic cells) of diseases or disorders.In other embodiments, antigens are expressed on normal cells and / or expressed on engineered cells.

[0204] The antigen targeted by genetically engineered antigen receptors is included in the antigen expressed in the background of the disease, illness or cell type targeted by adoptive cell therapy. These diseases and illnesses include hyperplasia, tumor and malignant diseases and illnesses, including cancer and tumors, including blood cancers, immune system cancers, such as lymphomas, leukemias and / or myeloma, such as B, T and myeloid leukemias, lymphomas and multiple myeloma. In some embodiments, compared with normal or non-targeted cells or tissues, antigens are selectively expressed or overexpressed on the cells (such as tumors or pathogenic cells) of diseases or illnesses. In other embodiments, antigens are expressed on normal cells and / or expressed on engineered cells.

[0205] The present method can target any suitable antigen. In some cases, the antigen may be associated with certain cancer cells but not with non-cancerous cells. Exemplary antigens include, but are not limited to, antigenic molecules from infectious pathogens, self / autoantigens, tumor / cancer-associated antigens, and tumor neoantigens (Linnemann et al., 2015). In particular aspects, the antigens include CD19, EBNA, CD123, HER2, CA-125, TRAIL / DR4, CD20, CD70, CD38, trop2, HLA-G, CD123, CLL1, carcinoembryonic antigen, alpha-fetoprotein, CD56, AKT, Her3, epithelial tumor antigen, CD319 (CS1), ROR1, folate binding protein, HIV-1 envelope glycoprotein gp120, HIV-1 envelope glycoprotein gp41, CD5, CD23, CD30, HERV-K, IL-11Ralpha, kappa chain, lambda chain, CSPG4, CD33 , CD47, CLL-1, U5snRNP200, CD200, BAFF-R, BCMA, CD99, p53, mutant p53, Ras, mutant ras, c-Myc, cytoplasmic serine / threonine kinases (e.g., A-Raf, B-Raf and C-Raf, cyclin-dependent kinases), MAGE-A1, MAGE-A2, MAGE-A3, MAGE-A4, MAGE-A6, MAGE-A10, MAGE-A12, MART-1, melanoma-associated antigen, BAGE, DAM-6, -10, GAGE-1, -2, - 8, GAGE-3, -4, -5, -6, -7B, NA88-A, MC1R, mda-7, gp75, Gp100, PSA, PSM, tyrosinase, tyrosinase-related protein, TRP-1, TRP-2, ART-4, CAMEL, CEA, Cyp-B, hTERT, hTRT, iCE, MUC1, MUC2, phosphatidylinositol 3-kinase (PI3Ks), TRK receptor, PRAME, P15, RU1, RU2, SART-1, SART-3, Wilms tumor antigen (WT1), AFP, -catenin / m, caspase Dongmei-8 / m, CDK-4 / m, ELF2M, GnT-V, G250, HAGE, HSP70-2M, HST-2, KIAA0205, MUM-1, MUM-2, MUM-3, myosin / m, RAGE, SART-2, TRP-2 / INT2, 707-AP, annexin II, CDC27 / m, TPI / mbcr-abl, BCR-ABL, interferon regulatory factor 4 (IRF4), ETV6 / AML, LDLR / FUT, Pml / RAR, tumor-associated calcium signal transducer 1 (TACSTD1) TACSTD2,Receptor tyrosine kinases (e.g., epidermal growth factor receptor (EGFR) (especially EGFRvIII), platelet-derived growth factor receptor (PDGFR), vascular endothelial growth factor receptor (VEGFR)), VEGFR2, cytoplasmic tyrosine kinases (e.g., src family, syk-ZAP70 family), integrin-linked kinase (ILK), signal transducer and activator of transcription STAT3, STATS and STATE, hypoxia-inducible factors (e.g., HIF-1 and HIF-2), nuclear factor-κB (NF-B), Notch receptors (e.g., Notch1-4), NY ESO 1, c-Met, mammalian target of rapamycin (mTOR), WNT, extracellular signal-regulated kinase (ERK) and its regulatory subunits, PMSA, PR-3, MDM2, mesothelin, renal cell carcinoma-5T4, SM22-alpha, carbonic anhydrase I (CAI) and IX (CAIX) (also known as G250), STEAD, TEL / AML1, GD2, proteinase 3, hTERT, sarcoma translocation breakpoints, EphA2, ML-IAP, EpCAM, ERG (TMPRSS2ETS fusion gene), NA17, PAX3, ALK, androgen receptor, cyclin B1, polysialic acid, MYCN, RhoC, GD3, fucosylated GM1, mesothelial cells, PSCA, sLe, PLAC1, GM3, BORIS, Tn, GLoboH, NY-BR-1, RGsS, SAGE, SART3, STn, PAX5, OY-TES1, sperm protein 17, LCK, HMWMAA, AKAP-4, SSX2, XAGE1, B7H3, legumain, TIE2, Page4, MAD-CT-1, FAP, MAD-CT-2, fos-related antigen 1, CBX2, CLDN6, SPANX, TPTE, ACTL8, ANKRD30A, CDKN2A, MAD2L1, CTAG1B, SUNC1 and LRRN1. Examples of antigen sequences are known in the art, for example, in, In the database: CD19 (accession number NG_007275.1), EBNA (accession number NG_002392.2), WT1 (accession number NG_009272.1), CD123 (accession number NC_000023.11), NY-ESO (accession number NC_000023.11), EGFRvIII (accession number NG_007726.3), MUC1 (accession number NG_029383.1), HER2 (accession number NG_007 503.1), CA-125 (Accession No. NG_055257.1), WT1 (Accession No. NG_009272.1), Mage-A3 (Accession No. NG_013244.1), Mage-A4 (Accession No. NG_013245.1), Mage-A10 (Accession No. NC_000023.11), TRAIL / DR4 (Accession No. NC_000003.12) and / or CEA (Accession No. NC_000019.10).

[0206] Tumor-associated antigens can be derived from prostate cancer, breast cancer, colorectal cancer, lung cancer, pancreatic cancer, kidney cancer, mesothelioma cancer, ovarian cancer, liver cancer, brain cancer, bone cancer, stomach cancer, spleen cancer, testicular cancer, cervical cancer, anal cancer, gallbladder cancer, thyroid cancer or melanoma cancer. Exemplary tumor-associated antigens or tumor cell-derived antigens include MAGE1, 3 and MAGE4 (or other MAGE antigens, such as those disclosed in International Patent Publication No. WO99 / 40188); PRAME; BAGE; RAGE, Lage (also known as NYESO1); SAGE; and HAGE or GAGE. Non-limiting examples of these tumor antigens are expressed in a variety of tumor types, such as melanoma, lung cancer, sarcoma and bladder cancer. See, for example, U.S. Patent No. 6,544,518. Prostate cancer tumor-associated antigens include, for example, prostate-specific membrane antigen (PSMA), prostate-specific antigen (PSA), prostatic acid phosphate, NKX3.1 and prostate six transmembrane epithelial antigen (STEAP).

[0207] Other tumor-associated antigens include Plu-1, HASH-1, HasH-2, Cripto, and Criptin. In addition, tumor antigens can be self-peptide hormones, such as full-length gonadotropin-releasing hormone (GnRH), a short 10-amino acid long peptide that can be used to treat many cancers.

[0208] Antigens may include epitope regions or epitope peptides derived from genes that are mutated in tumor cells or from genes that are transcribed at different levels in tumor cells compared to normal cells, such as telomerase, survivin, mesothelin, mutated ras, bcr / abl rearrangement, Her2 / neu, mutated or wild-type p53, cytochrome P450 1B1, and abnormally expressed intronic sequences such as N-acetylglucosamine transferase-V; clonal rearrangements of immunoglobulin genes that produce unique idiotypes in myeloma and B-cell lymphoma; tumor antigens including epitope regions or epitope peptides derived from oncoviral processes, such as human papillomavirus proteins E6 and E7; Epstein bar virus protein LMP2; non-mutated oncofetal proteins with tumor-selective expression, such as carcinoembryonic antigen and alpha-fetoprotein.

[0209] In other embodiments, the antigen is obtained or derived from a pathogenic microorganism or an opportunistic pathogenic microorganism (also referred to herein as an infectious microorganism) (e.g., a virus, fungus, parasite, and bacteria). In certain embodiments, the antigen derived from such a microorganism comprises a full-length protein.

[0210] Exemplary pathogenic organisms whose antigens are believed to be useful in the methods described herein include human immunodeficiency virus (HIV), herpes simplex virus (HSV), respiratory syncytial virus (RSV), cytomegalovirus (CMV), Epstein-Barr virus (EBV), influenza A, B and C viruses, vesicular stomatitis virus (VSV), vesicular stomatitis virus (VSV), polyomaviruses (e.g., BK virus and JC virus), adenovirus, Staphylococcus (including methicillin-resistant Staphylococcus aureus (MRSA)) and Streptococcus (including Streptococcus pneumoniae). It will be appreciated by those skilled in the art that many pathogenic organisms are available in publications and public databases (e.g., and ) are used to identify proteins derived from these and other pathogenic microorganisms and nucleotide sequences encoding these proteins for use as antigens described herein.

[0211] Antigens derived from human immunodeficiency virus (HIV) include any HIV virion structural protein (e.g., gp120, gp41, p17, p24), protease, reverse transcriptase, or HIV proteins encoded by tat, rev, nef, vif, vpr, and vpu.

[0212] Antigens derived from herpes simplex viruses (e.g., HSV1 and HSV2) include, but are not limited to, proteins expressed by HSV late genes. The late genome primarily encodes proteins that form viral particles. Such proteins include five proteins from (UL), which form the viral capsid: UL6, UL18, UL35, UL38, and major capsid proteins UL19, UL45, and UL27, each of which can be used as an antigen as described herein. Other exemplary HSV proteins contemplated for use as antigens herein include ICP27 (H1, H2), glycoprotein B (gB), and glycoprotein D (gD) proteins. The HSV genome contains at least 74 genes, each of which encodes a protein that may be used as an antigen.

[0213] Antigens derived from cytomegalovirus (CMV) include CMV structural proteins, viral antigens expressed in the early and early stages of viral replication, glycoproteins I and III, capsid proteins, coat proteins, lower matrix proteins pp65 (ppUL83), p52 (ppUL44), IE1 and 1E2 (UL123 and UL122), protein products from the UL128-UL150 gene cluster (Rykman et al., 2006), envelope glycoprotein B (gB), gH, gN and pp150. It will be appreciated by those skilled in the art that CMV proteins used as antigens described herein can be identified in public databases, such as and (See, e.g., Bennekov et al., 2004; Loewendorf et al., 2010; Marschall et al., 2009).

[0214] Antigens derived from Epstein-Ban virus (EBV) contemplated for use in certain embodiments include EBV lytic proteins gp350 and gp110, EBV proteins produced during latent infection, including Epstein-Ban nuclear antigen (EBNA)-1, EBNA-2, EBNA-3A, EBNA-3B, EBNA-3C, EBNA-leader protein (EBNA-LP), and latent membrane protein (LMP)-1, LMP-2A, and LMP-2B (see, e.g., Lockey et al., 2008).

[0215] Antigens derived from respiratory syncytial virus (RSV) contemplated for use herein include any of the 11 proteins encoded by the RSV genome, or antigenic fragments thereof: NS1, NS2, N (nucleocapsid protein), M (matrix protein) SH, G and F (viral capsid proteins), M2 (second matrix protein), M2-1 (elongation factor), M2-2 (transcription regulation), RNA polymerase, and phosphoprotein P.

[0216] Antigens derived from vesicular stomatitis virus (VSV) contemplated for use herein include any of the five major proteins encoded by the VSV genome, and antigenic fragments thereof: large protein (L), glycoprotein (G), nucleoprotein (N), phosphoprotein (P), and matrix protein (M) (see, e.g., Rieder et al., 1999).

[0217] Antigens derived from influenza viruses contemplated for use in certain embodiments include hemagglutinin (HA), neuraminidase (NA), nucleoprotein (NP), matrix proteins M1 and M2, NS1, NS2 (NEP), PA, PB1, PB1-F2, and PB2.

[0218] Exemplary viral antigens also include, but are not limited to, adenovirus polypeptides, alphavirus polypeptides, calicivirus polypeptides (e.g., calicivirus capsid antigens), coronavirus polypeptides, canine distemper virus polypeptides, Ebola virus polypeptides, enterovirus polypeptides, flavivirus polypeptides, hepatitis virus (AE) polypeptides (hepatitis B core or surface antigens, hepatitis C virus E1 or E2 glycoproteins, core or nonstructural proteins), herpesvirus polypeptides (including herpes simplex virus or varicella zoster virus glycoproteins), infectious peritonitis virus polypeptides, leukemia virus polypeptides, Marburg virus polypeptides, orthomyxovirus polypeptides, papillomavirus polypeptides, parainfluenza virus polypeptides (e.g., hemagglutinin and neuraminidase polypeptides), paramyxovirus polypeptides, parvovirus polypeptides, swine fever virus polypeptides, picornavirus polypeptides (e.g., poliovirus capsid polypeptides), poxvirus polypeptides (e.g., vaccinia virus polypeptides), rabies virus polypeptides (e.g., rabies virus glycoprotein G), reovirus polypeptides, retrovirus polypeptides, and rotavirus polypeptides.

[0219] In certain embodiments, the antigen may be a bacterial antigen. In certain embodiments, the bacterial antigen of interest may be a secreted polypeptide. In certain other embodiments, the bacterial antigen includes an antigen that is exposed on the outer cell surface of the bacteria by one or more portions of the polypeptide.

[0220] Antigens from Staphylococcus species, including methicillin-resistant Staphylococcus aureus (MRSA), contemplated for use include virulence regulators, such as the Agr system, Sar and Sae, the Arl system, Sar homologs (Rot, MgrA, SarS, SarR, SarT, SarU, SarV, SarX, SarZ, and TcaR), the Srr system, and TRAP. Other Staphylococcal proteins that may be used as antigens include the Clp protein, HtrA, MsrR, aconitase, CcpA, SvrA, Msa, CfvA, and CfvB (see, e.g., Staphylococcus: Molecular Genetics, 2008 Caister Academic Press, Ed. Jodi Lindsay). The genomes of two Staphylococcus aureus (N315 and Mu50) have been sequenced and are publicly available, e.g., at PATRIC (PATRIC: The VBI Patho Systems Resource Integration Center, Snyder et al., 2007). As will be appreciated by those skilled in the art, Staphylococcal proteins used as antigens may also be found in other public databases (e.g. and ) was identified.

[0221] Antigens derived from Streptococcus pneumoniae contemplated for use in certain embodiments described herein include pneumolysin, PspA, choline binding protein A (CbpA), NanA, NanB, SpnHL, PavA, LytA, Pht, and pili proteins (RrgA; RrgB; RrgC). Antigenic proteins of Streptococcus pneumoniae are also known in the art and can be used as antigens in certain embodiments (see, e.g., Zysk et al., 2000). The complete genome sequence of a virulent strain of Streptococcus pneumoniae has been sequenced, and as will be appreciated by those skilled in the art, the Streptococcus pneumoniae proteins used herein can also be identified in other public databases, such as and According to the present disclosure, proteins of particular interest as antigens include virulence factors and proteins predicted to be exposed on the surface of pneumococci (see, e.g., Frolet et al., 2010).

[0222] Examples of bacterial antigens that can be used as antigens include, but are not limited to, Actinomyces polypeptides, Bacillus polypeptides, Bacteroides polypeptides, Bordetella polypeptides, Bartonella polypeptides, Borrelia polypeptides (e.g., B. Burgdorferi OspA), Brucella polypeptides, Campylobacter polypeptides, Capnocytophaga polypeptides, Chlamydia polypeptides, Rods, Corynebacterium polypeptides, Coxiella polypeptides, Dermatophilus polypeptides, Enterococcus polypeptides, Ehrlichia polypeptides, Escherichia polypeptides, Francisella polypeptides, Fusobacterium polypeptides, Haemobartonella polypeptides, Haemophilus polypeptides (e.g., Haemophilus influenzae type b outer membrane proteins), Helicobacter polypeptides peptides, Klebsiella peptides, L-bacterial peptides, Leptospira peptides, Listeria peptides, Mycobacteria peptides, Mycoplasma peptides, Neisseria peptides, Neorickettsia peptides, Nocardia peptides, Pasteurella peptides, Peptococcus peptides, Peptostreptococcus peptides, Pneumococcus peptides, ccus) polypeptides (i.e., Streptococcus pneumoniae polypeptides) (see description herein), Proteus polypeptides, Pseudomonas polypeptides, Rickettsia polypeptides, Rochalimaea polypeptides, Salmonella polypeptides, Shigella polypeptides, Staphylococcal polypeptides, Group A Streptococcus polypeptides (e.g., Streptococcus pyogenes M protein), Group B Streptococcus (S. agalactiae) polypeptides, Treponema polypeptides, and Yersinia polypeptides (e.g., Y pestis F1 and V antigens).

[0223] Examples of fungal antigens include, but are not limited to, Absidia polypeptides, Acremonium polypeptides, Alternaria polypeptides, Aspergillus polypeptides, Basidiobolus polypeptides, Bipolaris polypeptides, Blastomyces polypeptides, Candida polypeptides, Coccidioides polypeptides, Conidiobolus polypeptides, Cryptococcus polypeptides, Curvalaria polypeptides, Epidermophyton polypeptides, Exophiala polypeptides, Geotrichum polypeptides, Histoplasma polypeptides, Madurella polypeptides, Malassezia polypeptides, Microsporum polypeptides, peptides, Moniliella polypeptides, Mortierella polypeptides, Mucor polypeptides, Paecilomyces polypeptides, Penicillium polypeptides, Philalemonium polypeptides, Phialophora polypeptides, Prototheca polypeptides, Pseudallescheria polypeptides, Pseudo microdochium polypeptides, Pythium polypeptides, Rhinosporidium polypeptides, Rhizopus polypeptides, Scolecobasidium polypeptides, Sporothrix polypeptides, Stemphylium polypeptides, Trichophyton polypeptides, Trichosporon polypeptides, and Xylohypha polypeptides.

[0224] Examples of protozoan parasite antigens include, but are not limited to, Babesia polypeptides, Balantidium polypeptides, Besnoitia polypeptides, Cryptosporidium polypeptides, Eimeria polypeptides, Encephalitozoon polypeptides, Entamoeba polypeptides, Giardia polypeptides, Hammondia polypeptides, Hepatozoon polypeptides, Isospora polypeptides, Leishmania polypeptides, Microsporidia polypeptides, Neospora polypeptides, Nosema polypeptides, Pentatrichomonas polypeptides, Plasmodium polypeptides.Examples of helminth parasite antigens include, but are not limited to, Acanthocheilonema polypeptides, Aelurostrongylus polypeptides, Ancylostoma polypeptides, Angiostrongylus polypeptides, Ascaris polypeptides, Brugia polypeptides, Bunostomum polypeptides, Capillaria polypeptides, Chabertia polypeptides, Cooperia polypeptides, Crenosoma polypeptides, Dictyocaulus polypeptides, polypeptides, Dioctophyme polypeptides, Dipetalonema polypeptides, Diphyllobothrium polypeptides, Diplydium polypeptides, Dirofilaria polypeptides, Dracunculus polypeptides, Enterobius polypeptides, Filaroides polypeptides, Haemonchus polypeptides, Lagochilascaris polypeptides, Loa polypeptides, Mansonella polypeptides, Muellerius polypeptides, Nan ophyetus polypeptide, Necator polypeptide, Nematodirus polypeptide, Oesophagostomum polypeptide, Onchocerca polypeptide, Opisthorchis polypeptide, Ostertagia polypeptide, Parafilaria polypeptide, Paragonimus polypeptide, Parascaris polypeptide, Physaloptera polypeptide, Protostrongylus polypeptide, Setaria polypeptide , Spirocerca polypeptides, Spirometra polypeptides, Stephanofilaria polypeptides, Strongyloides polypeptides, Strongylus polypeptides, Thelazia polypeptides, Toxascaris polypeptides, Toxocara polypeptides, Trichinella polypeptides, Trichostrongylus polypeptides, Trichuris polypeptides, Uncinaria polypeptides, and Wuchereria polypeptides.falciparum circumsporozoite (PfCSP)), sporozoite surface protein 2 (PfSSP2), carboxyl terminus of liver state antigen 1 (PfLSA1 c-term) and exportin 1 (PfExp-1), Pneumocystis polypeptides, Sarcocystis polypeptides, Schistosoma polypeptides, Theileria polypeptides, Toxoplasma polypeptides and Trypanosoma polypeptides.

[0225] Examples of ectoparasite antigens include, but are not limited to, polypeptides (including antigens as well as allergens) from: fleas; ticks, including hard ticks and soft ticks; flies, such as midges, mosquitoes, sand flies, black flies, horse flies, horn flies, deer flies, tsetse flies, biting flies, myiasis-causing flies and biting mosquitoes; ants; spiders, lice; mites; and true bugs, such as bed bugs and kissing bugs.

[0226] In certain embodiments, the techniques disclosed herein that utilize genetically modified immune cells (e.g., NK cells) include (i) non-viral gene transfer using an electroporation device (e.g., a nucleofector), (ii) CARs that signal through an endodomain (e.g., CD28 / CD3-ζ, CD137 / CD3-ζ, or other combinations), (iii) CARs with variable lengths of extracellular domains that link the antigen recognition domain to the cell surface, and in some cases, (iv) artificial antigen presenting cells (aAPCs) derived from K562 that are capable of robustly expanding CARs in number. + Immune cells (Singh et al., 2008; Singh et al., 2011).

[0227] As shown herein, in some embodiments, cells comprising one or more engineered antigen receptors (e.g., CAR) have increased expression of the engineered antigen receptor relative to other comparable cells that were not inactivated before cryopreservation after inactivation, cryopreservation and thawing. In some embodiments, relative to appropriate control cells, such cells have higher engineered antigen receptor-mediated signal transduction.

[0228] C.Suicide gene

[0229] In certain embodiments, the cells described herein include suicide genes to control their use and allow cell therapy to be terminated at a desired event and / or time. In some embodiments, suicide genes are used in transduced cells for the purpose of inducing the death of transduced cells when needed. The immune effector cells of the present disclosure that have been modified to accommodate the vectors encompassed by the present disclosure may include one or more suicide genes. In some embodiments, the term "suicide gene" as used herein is defined as a gene whose gene product is converted into a compound that kills its host cell after administration of a prodrug or other agent. In other embodiments, the suicide gene encodes a gene product that, when needed, is targeted by an agent (e.g., an antibody) targeting the suicide gene product.

[0230] In some cases, cell therapy may utilize one or more suicide genes of any type when the individual receiving the cell therapy and / or who has received the cell therapy exhibits one or more symptoms of one or more adverse events such as cytokine release syndrome, neurotoxicity, anaphylaxis / allergic reaction, and / or on-target / off-target tumor toxicity (as examples) or is considered to be at risk (including imminent) of one or more symptoms. The use of suicide genes may be part of a treatment plan or may be used only when it is recognized that they are needed. In some cases, cell therapy is terminated by using an agent that targets a suicide gene or a gene product thereof because treatment is no longer needed.

[0231] In some embodiments, the use of suicide genes can be initiated when an individual experiences at least one adverse event, and the adverse event can be identified by any means, including routine monitoring, which can be continuous or not from the start of cell therapy. Adverse events can be detected after examination and / or testing. In the case of an individual suffering from cytokine release syndrome (also known as cytokine storm), the individual may have elevated inflammatory cytokines (by way of example only: interferon-γ, granulocyte macrophage colony stimulating factor, IL-10, IL-6, and TNF-α); fever; fatigue; for example, hypotension; hypoxia, tachycardia; nausea; capillary leakage; heart / kidney / liver dysfunction; or a combination thereof. In the case of an individual with neurotoxicity, the individual may have confusion, delirium, dysplasia, and / or seizures. In some cases, the individual is tested for markers associated with the onset and / or severity of cytokine release syndrome (e.g., C-reactive protein, IL-6, TNF-α, and / or ferritin).

[0232] Examples of suicide genes include engineered non-secretable (including membrane-bound) tumor necrosis factor (TNF)-alpha mutant polypeptides (see PCT / US19 / 062009, which is incorporated herein by reference in its entirety), and they may be affected by the delivery of antibodies that bind to TNF-alpha mutants. Examples of suicide gene / prodrug combinations that can be used are herpes simplex virus-thymidine kinase (HSV-tk) and ganciclovir, acyclovir, or FIAU; oxidoreductase and cycloheximide; cytosine deaminase and 5-fluorocytosine; thymidine kinase thymidylate kinase (Tdk::Tmk) and AZT; and deoxycytidine kinase and cytosine arabinoside. Escherichia coli purine nucleoside phosphorylase, a so-called suicide gene that converts the prodrug 6-methylpurine deoxynucleoside to the toxic purine 6-methylpurine, can be used. As examples, other suicide genes include CD20, CD52, inducible caspase 9, purine nucleoside phosphorylase (PNP), cytochrome p450 enzymes (CYP), carboxypeptidase (CP), carboxylesterase (CE), nitroreductase (NTR), guanine ribosyltransferase (XGRTP), glycosidase, methionine-α,γ-lyase (MET), and thymidine phosphorylase (TP).

[0233] In certain embodiments, any vector encoding an engineered antigen receptor (e.g., CAR and / or TCR) or a cell (e.g., NK cell) as described herein includes one or more suicide genes. The suicide gene may be located on the same vector as the engineered antigen receptor, or may not be located on the same vector. For example, in the case where the suicide gene and the engineered antigen receptor are located on the same vector, the suicide gene and the engineered antigen receptor may be separated by IRES or 2A (e.g., P2A, T2A, etc.) elements.

[0234] D. Cytokines

[0235] In some embodiments, cells disclosed herein (e.g., NK cells) are engineered to express one or more heterologous cytokines and / or are engineered to upregulate normal expression of one or more heterologous cytokines. Cells may or may not be transduced or transfected for one or more cytokines on the same vector as other genes.

[0236] One or more cytokines can be co-expressed from the vector, including as polypeptides separated from the engineered antigen receptor and / or suicide gene. For example, interleukin-15 (IL-15) is confined to tissues, and it is only observed at any level in serum or systemic under pathological conditions. IL-15 has a variety of properties suitable for adoptive therapy. IL-15 is a homeostatic cytokine that induces the development and cell proliferation of natural killer cells, promotes the eradication of established tumors by alleviating functional inhibition of tumor-resident cells, and inhibits activation-induced cell death (AICD). In addition to IL-15, other cytokines are also considered. These include, but are not limited to, cytokines, chemokines, and other molecules that contribute to the activation and proliferation of cells for human applications. NK cells expressing IL-15 are able to continuously support cytokine signaling, which is useful for their survival after infusion.

[0237] In a specific embodiment, the cell expresses one or more exogenously provided cytokines. As an example, the cytokine is IL-15, IL-12, IL-2, IL-18, IL-21, IL-23, GMCSF or a combination thereof. The cytokine can be provided to cells (e.g., NK cells) exogenously because it is expressed by an expression vector in the cell. In another case, when manipulating the regulation of the expression of endogenous cytokines, for example, genetic recombination is performed at the promoter site of the cytokine, and the endogenous cytokines in the cell are upregulated. In the case where the cytokine is provided to the cell on the expression construct, the cytokine can be encoded by the same vector as the suicide gene and / or CAR. In some embodiments, the present disclosure relates to the inactivation and optional storage of NK cells, wherein the NK cells include one or more CARs, IL-15 and optionally suicide genes.

[0238] E. Knockout or knockdown of endogenous genes

[0239] In some embodiments, the inactivated and cryopreserved cells of the present disclosure are modified to alter the expression of certain genes, such as glucocorticoid receptor, TGFβ receptor (e.g., TGFβ-RII) and / or CISH. In one embodiment, immune cells can be modified to express a dominant negative TGFβ receptor II (TGFβRIIDN), which can act as a cytokine reservoir to deplete endogenous TGFβ.

[0240] Cytokine signaling is essential for the normal function of hematopoietic cells. SOCS family proteins play an important role in the negative regulation of cytokine signaling, acting as an intrinsic brake. CIS (a member of the SOCS protein family encoded by the CISH gene) has been identified as an important checkpoint molecule in mouse NK cells. Therefore, in some embodiments, the present invention relates to CISH knockout in immune cells to improve, for example, NK cells and CD8 + T cell cytotoxicity. This approach could be used alone or in combination with other checkpoint inhibitors to improve anti-tumor activity.

[0241] In some embodiments, altered gene expression is achieved by disruption of a gene, such as knockout, insertion, missense or frameshift mutation (e.g., biallelic frameshift mutation), deletion of all or part of a gene (e.g., one or more exons or portions thereof), and / or knocking in. For example, altered gene expression can be achieved by sequence-specific or targeted nucleases, including DNA-binding targeted nucleases (e.g., zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs)), and RNA-guided nucleases specifically designed to target sequences of a gene or a portion thereof (e.g., CRISPR-associated nucleases (Cas)).

[0242] In some embodiments, the expression, activity and / or function of a gene is altered by disrupting a gene. In some aspects, a gene is modified such that its expression is reduced by at least or about 20, 30 or 40%, generally at least or about 50, 60, 70, 80, 90 or 95%, compared to expression in the absence of the genetic modification or the components introduced to achieve the modification.

[0243] In some embodiments, the change is transient or reversible, such that gene expression is restored at a later time. In other embodiments, the change is not reversible or transient, e.g., is permanent.

[0244] In some embodiments, the genetic alteration is performed by inducing one or more double-strand breaks and / or one or more single-strand breaks in the gene, typically in a targeted manner. In some embodiments, the double-strand or single-strand breaks are performed by a nuclease, e.g., an endonuclease, e.g., a gene-targeted nuclease. In some aspects, the breaks are induced in the coding region of the gene, e.g., in an exon. For example, in some embodiments, the induction occurs near the N-terminal portion of the coding region, e.g., in the first exon, in the second exon, or in a subsequent exon.

[0245] In some aspects, double-strand or single-strand breaks are repaired via a cell repair process, such as by non-homologous end joining (NHEJ) or homology-mediated repair (HDR). In some aspects, the repair process is fallible and causes gene disruption, such as frameshift mutation, for example, biallelic frameshift mutation, which can cause the complete knockout of a gene. For example, in some aspects, the destruction includes induction deletion, mutation and / or insertion. In some embodiments, the destruction causes the presence of an early stop codon. In some aspects, the presence of insertion, deletion, translocation, frameshift mutation and / or premature stop codon causes the expression of a gene, activity and / or functional destruction.

[0246] In some embodiments, the gene alteration is achieved using antisense technology, such as by RNA interference (RNAi), short interfering RNA (siRNA), short hairpin (shRNA) and / or ribozymes for selective suppression or inhibition of gene expression. siRNA technology is such an RNAi: it uses a double-stranded RNA molecule having a sequence homologous to the nucleotide sequence of the mRNA transcribed from the gene and a sequence complementary to the nucleotide sequence. The siRNA is generally homologous / complementary to one region of the mRNA transcribed from the gene, or can be an siRNA comprising multiple RNA molecules homologous / complementary to different regions. In some aspects, the siRNA is contained in a polycistronic construct.

[0247] In some embodiments, the cells of the present disclosure may also include gene editing of cells to remove 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more endogenous genes in the cells. In some cases, gene editing occurs in NK cells expressing one or more heterologous antigen receptors, while in other cases, gene editing occurs in NK cells that do not express heterologous antigen receptors but will eventually express one or more heterologous antigen receptors (at least in some cases). In specific embodiments, the NK cells of gene editing are amplified and / or activated NK cells. In specific embodiments, the NK cells of gene editing are inactivated or previously inactivated NK cells.

[0248] In certain cases, one or more endogenous genes of NK cells are modified, for example, disrupted in expression, wherein expression is partially or completely reduced. In certain cases, one or more genes are knocked out or knocked out using the methods of the present disclosure. In certain cases, multiple genes are knocked out or knocked out in the same step as the process of the present disclosure. The genes edited in NK cells can be of any kind, but in certain embodiments, these genes are genes whose gene products inhibit NK cell activity and / or proliferation. In certain cases, the genes edited in NK cells enable NK cells to function more effectively in the tumor microenvironment. In certain instances, the gene is one or more of NKG2A, SIGLEC-7, LAG3, TIM3, CISH, FOXO1, TGFBR2, TIGIT, CD96, ADORA2, NR3C1, PD1, PDL-1, PDL-2, CD47, SIRPA, SHIP1, ADAM17, RPS6, 4EBP1, CD25, CD40, IL21R, ICAM1, CD95, CD80, CD86, IL10R, TDAG8, CD5, CD7, SLAMF7, CD38, LAG3, TCR, β2-microglobulin, HLA, CD73, CREB1, CREM, ICER, and CD39. In certain embodiments, the TGFBR2 gene is knocked out or knocked down in NK cells.

[0249] 1. ZFP and ZFN

[0250] In some embodiments, the DNA targeting molecule comprises a DNA binding protein, such as one or more zinc finger proteins (ZFPs) or transcription activator-like proteins (TALs) fused to an effector protein (e.g., an endonuclease). Examples include ZFNs, TALEs, and TALENs.

[0251] In some embodiments, the DNA targeting molecule includes one or more zinc finger proteins (ZFPs) or domains thereof that bind to DNA in a sequence-specific manner. A ZFP or domain thereof is a domain within a protein or larger protein that binds to DNA in a sequence-specific manner through one or more zinc fingers (regions of amino acid sequences within the binding domain, the structure of which is stabilized by the coordination of zinc ions). The term zinc finger DNA binding protein is often abbreviated as zinc finger protein or ZFP. ZFPs are artificial ZFP domains that target specific DNA sequences (usually 9-18 nucleotides in length, generated by the assembly of individual "fingers").

[0252] ZFPs include those in which the single finger domain is about 30 amino acids in length and contains an alpha helix containing two invariant histidine residues coordinated by zinc to two cysteines of a single beta turn and having 2, 3, 4, 5 or 6 fingers. In general, the sequence specificity of a ZFP can be altered by making amino acid substitutions at the four helical positions (-1, 2, 3 and 6) of the zinc finger recognition helix. Thus, in some embodiments, a ZFP or a molecule containing a ZFP is not naturally occurring, e.g., engineered to bind to a selected target site.

[0253] In some embodiments, the DNA targeting molecule is or comprises a zinc finger DNA binding domain fused to a DNA cleavage domain to form a zinc finger nuclease (ZFN). In some embodiments, the fusion protein comprises a cleavage domain (or cleavage half-domain) from at least one type IIS restriction enzyme and one or more zinc finger binding domains that may or may not be modified. In some embodiments, the cleavage domain is from the type IIS restriction endonuclease Fok I. Fok I generally catalyzes double-stranded cleavage of DNA, cleaving at 9 nucleotides from its recognition site on one chain and 13 nucleotides from its recognition site on the other chain.

[0254] Many gene-specific modified zinc fingers are commercially available. For example, Sangamo Biosciences (Richmond, CA, USA) has developed a platform (CompoZr) for zinc finger construction in collaboration with Sigma-Aldrich (St. Louis, MO, USA), allowing researchers to completely bypass zinc finger construction and verification, and provide zinc fingers specifically targeted to thousands of proteins (Gaj et al., Trends in Biotechnology, 2013, 31 (7), 397-405). In some embodiments, commercially available zinc fingers are used or custom designed. (See, for example, Sigma-Aldrich catalog numbers CSTZFND, CSTZFN, CTil-1KT, and PZD0020).

[0255] 2. TAL, TALE and TALEN

[0256] In some embodiments, the DNA targeting molecule comprises a naturally occurring or engineered (non-naturally occurring) transcription activator-like protein (TAL) DNA binding domain, such as in a transcription activator-like protein effector (TALE) protein, see, e.g., U.S. Patent Publication No. 2011 / 0301073, which is incorporated herein by reference in its entirety.

[0257] A TALE DNA binding domain or TALE is a polypeptide comprising one or more TALE repeat domains / units. The repeat domains are involved in the binding of TALE to its cognate target DNA sequence. A single "repeat unit" (also referred to as a "repeat sequence") is typically 33 to 35 amino acids in length and exhibits at least some sequence homology to other TALE repeat sequences within naturally occurring TALE proteins. Each TALE repeat unit comprises 1 or 2 DNA binding residues, typically constituting a repeat variable di-residue (RVD) at position 12 and / or 13 of the repeat sequence. The natural (canonical) code for DNA recognition of these TALEs has been determined, such that the HD sequences at positions 12 and 13 result in binding to cytosine (C), NG binds to T, NI binds to A, NN binds to G or A, NO binds to T and non-canonical (atypical) RVDs are also known. In some embodiments, TALEs can be targeted to any gene by designing a TAL array with specificity for a target DNA sequence. The target sequence generally starts with thymidine.

[0258] In some embodiments, the molecule is a DNA binding endonuclease, such as a TALE nuclease (TALEN). In some aspects, the TALEN is a fusion protein comprising a DNA binding domain derived from a TALE and a nuclease catalytic domain that cleaves a nucleic acid target sequence.

[0259] In some embodiments, TALEN recognizes and cracks the target sequence of gene. In some aspects, the cracking of DNA causes double-strand breaks. In some aspects, the fracture stimulates the rate of homologous recombination or non-homologous end joining (NHEJ). Generally speaking, NHEJ is an imperfect repair process, which often causes changes in the DNA sequence at the cleavage site. In some aspects, the repair mechanism is related to keeping two DNA ends by directly re-binding or connecting via the so-called micro-homology-mediated end connection. In some embodiments, the repair via NHEJ causes a small insertion or deletion and can be used for destruction, thereby suppressing the gene. In some embodiments, the modification can be a substitution, a deletion or an addition of at least one nucleotide. In some aspects, the cell in which the mutagenic event (that is, the mutagenic event subsequent to the NHEJ event) of cleavage induction has occurred can be identified and / or selected by methods well known in the art.

[0260] In some embodiments, TALE repeats are assembled to specifically target genes (Gaj et al., 2013). A TALEN library targeting 18,740 human protein-coding genes has been constructed (Kim et al., 2013). Custom-designed TALE arrays are commercially available from Cellectis Bioresearch (Paris, France), Transposagen Biopharmaceuticals (Lexington, KY, USA) and Life Technologies (Grand Island, NY, USA). Specifically, TALEN targeting CD38 is commercially available (see Gencopoeia, catalog numbers HTN222870-1, HTN222870-2 and HTN222870-3). Exemplary molecules are described in, for example, U.S. Patent Publication Nos. US 2014 / 0120622 and 2013 / 0315884.

[0261] In some embodiments, TALENs are introduced as trans genes encoded by one or more plasmid vectors. In some aspects, the plasmid vectors may contain a selection marker that provides for identification and / or selection of cells that accept the vector.

[0262] 3. RGEN (CRISPR / Cas system)

[0263] In some embodiments, one or more DNA binding nucleic acids are used to change, for example, via RNA-guided endonucleases (RGENs). For example, regular clustered interspaced short palindromic repeats (CRISPR) and CRISPR-related (Cas) proteins can be used to change. In general, "CRISPR system" refers to the transcripts and other components involved in the expression of CRISPR-related ("Cas") genes or the activity of the gene, including sequences encoding Cas genes, tracr (trans-activated CRISPR) sequences (e.g., tracrRNA or active partial tracrRNA), tracr pairing sequences (in the case of endogenous CRISPR systems, including "direct repeats" and partial direct repeats processed by tracrRNA), guide sequences (in the case of endogenous CRISPR systems, also referred to as "intervals") and / or other sequences and transcripts from CRISPR loci. The method using the CRISPR system is well known in the art, but is only briefly described herein.

[0264] CRISPR / Cas nuclease or CRISPR / Cas nuclease system may include: a non-coding RNA molecule (guide) RNA, which binds to DNA with sequence specificity; and a Cas protein (e.g., Cas9) having nuclease functionality (e.g., two nuclease domains). One or more elements of a CRISPR system may be derived from a type I, type II, or type III CRISPR system. For example, from a specific organism comprising an endogenous CRISPR system, such as Streptococcus pyogenes.

[0265] In some aspects, Cas nuclease and gRNA (including crRNA specific for target sequence and fixed tracrRNA fusion) are introduced into cells. In general, the target site at the 5' end of gRNA uses complementary base pairing to target Cas nuclease to the target site, for example, gene. The target site can be selected based on the position of the 5' adjacent motif (PAM) sequence of the adjacent pre-spacer sequence, and the PAM sequence is, for example, generally NGG or NAG. In this regard, gRNA targets the desired sequence by modifying the first 20, 19, 18, 17, 16, 15, 14, 14, 12, 11 or 10 nucleotides of the guide RNA to correspond to the target DNA sequence. In general, the CRISPR system is characterized by promoting the formation of CRISPR complex elements at the site of the target sequence. Generally, "target sequence" generally refers to a sequence that the design guide sequence has complementarity with it, wherein the hybridization between the target sequence and the guide sequence promotes the formation of CRISPR complexes. Complete complementarity is not required, provided that there is sufficient complementarity to cause hybridization and promote the formation of CRISPR complexes.

[0266] The CRISPR system can induce double-strand breaks (DSBs) at the target site, followed by destruction or changes as discussed herein. In other embodiments, Cas9 variants considered as "nickases" are used to nick single strands at the target site. Paired nickases can be used, for example, to improve specificity, each guided by a pair of different gRNA targeting sequences, so that 5' overhangs are introduced while introducing the nick. In other embodiments, Cas9 with catalytic activity loss is fused to a heterologous effector domain (e.g., a transcriptional repressor or activator) to affect gene expression.

[0267] The target sequence can include any polynucleotide, such as a DNA or RNA polynucleotide. The target sequence can be located in the nucleus or cytoplasm of a cell, such as in an organelle of a cell. Generally speaking, a sequence or template that can be used to reorganize into a targeting locus comprising a target sequence is referred to as an "editing template" or "editing polynucleotide" or "editing sequence". In some aspects, an exogenous template polynucleotide can be referred to as an editing template. In some aspects, the recombination is homologous recombination.

[0268] Typically, in the case of an endogenous CRISPR system, formation of a CRISPR complex (comprising a guide sequence hybridized to a target sequence and complexed with one or more Cas proteins) results in cleavage of one or both strands within or near the target sequence (e.g., within 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 50 or more base pairs from the target sequence). A tracr sequence, which may comprise or consist of all or a portion of a wild-type tracr sequence (e.g., about 20, 26, 32, 45, 48, 54, 63, 67, 85 or more nucleotides of a wild-type tracr sequence) can also form part of a CRISPR complex, for example by hybridizing to all or a portion of a tracr mate sequence (which is operably linked to a guide sequence) along at least a portion of the tracr sequence. The tracr sequence has sufficient complementarity to the tracr mate sequence to hybridize and participate in the formation of the CRISPR complex, e.g., at least 50%, 60%, 70%, 80%, 90%, 95% or 99% sequence complementarity along the length of the tracr mate sequence when optimally aligned.

[0269] One or more vectors driving the expression of one or more elements in the CRISPR system can be introduced into the cell so that the expression of the elements of the CRISPR system guides the formation of the CRISPR complex at one or more target sites. The components can also be delivered to the cell as proteins and / or RNA. For example, the Cas enzyme, the guide sequence connected to the tracr-pairing sequence, and the tracr sequence can each be operably connected to the separate regulatory elements of the separate vectors. Alternatively, two or more of the elements expressed from the same or different regulatory elements can be combined in a single vector, wherein one or more additional vectors provide any components of the CRISPR system not included in the first vector. The vector may include one or more insertion sites, such as restriction endonuclease recognition sequences (also referred to as "cloning sites"). In some embodiments, one or more insertion sites are located upstream and / or downstream of one or more sequence elements of one or more vectors. When using multiple different guide sequences, a single expression construct can be used to target multiple different, corresponding target sequences in the cell to CRISPR activity.

[0270] The vector may comprise a regulatory element operably linked to an enzyme-coding sequence encoding a CRISPR enzyme (e.g., a Cas protein). Non-limiting examples of Cas proteins include: Cas1, Cas1B, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, Cas9 (also known as Csn1 and Csx12), Cas10, Csy1, Csy2, Csy3, Cse1, Cse2, Csc1, Csc2, Csa5, Csn2, Csm2, Csm3, Csm4, Csm5, Csm6, Cmr1, Cmr3, Cmr4, Cmr5, Cmr6, Csb1, Csb2, Csb3, Csx17, Csx14, Csx10, Csx16, CsaX, Csx3, Csx1, Csx15, Csf1, Csf2, Csf3, Csf4, homologs thereof, or modified forms thereof. These enzymes are known; for example, the amino acid sequence of the Streptococcus pyogenes Cas9 protein can be found in the SwissProt database accession number Q99ZW2.

[0271] The CRISPR enzyme can be Cas9 (e.g., from Streptococcus pyogenes or Streptococcus pneumoniae). The CRISPR enzyme can guide the cleavage of one or both chains at the target sequence position (e.g., within the target sequence and / or within the complementary sequence of the target sequence). The vector can encode a CRISPR enzyme that is mutated relative to the corresponding wild-type enzyme, so that the mutated CRISPR enzyme lacks the ability to cleave one or both chains of the target polynucleotide containing the target sequence. For example, an aspartate to alanine substitution (D10A) in the RuvC I catalytic domain of Cas9 from Streptococcus pyogenes converts Cas9 from a nuclease that cleaves two chains to a nickase (cleaving a single chain). In some embodiments, the Cas9 nickase can be used in combination with a guide sequence (e.g., two guide sequences that target the sense and antisense chains of a DNA target, respectively). This combination allows the two chains to be nicked and used to induce NHEJ or HDR.

[0272] In some embodiments, the enzyme coding sequence encoding the CRISPR enzyme is codon-optimized for expression in a specific cell (e.g., a eukaryotic cell). The eukaryotic cell may be a cell of a specific organism or may be derived from a specific organism, such as a mammal, including but not limited to humans, mice, rats, rabbits, dogs, or non-human primates. In general, codon optimization refers to the process of modifying a nucleic acid sequence to increase expression in the host cell by replacing at least one codon of the native sequence with a codon that is more frequently or most frequently used in the genes of the host cell of interest while maintaining the native amino acid sequence. Various species exhibit specific preferences for specific codons for specific amino acids. Codon preference (differences in codon usage between organisms) is often associated with the efficiency of translation of messenger RNA (mRNA), which in turn is believed to be particularly dependent on the properties of the codons being translated and the availability of specific transfer RNA (tRNA) molecules. The predominance of the selected tRNA in the cell is generally a reflection of the most frequently used codons in peptide synthesis. Therefore, genes can be customized based on codon optimization for optimal gene expression in a given organism.

[0273] In general, a guide sequence is any polynucleotide having sufficient complementarity to a target polynucleotide to hybridize with the target sequence and direct sequence-specific binding of the CRISPR complex to the target sequence. In some embodiments, the degree of complementarity between a guide sequence and its corresponding target sequence is about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99% or more when optimally aligned using an appropriate alignment algorithm or more than about 50%, 60%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99% or more.

[0274] Exemplary gRNA sequences for NR3CS (glucocorticoid receptor) include Ex3NR3C1 sG1 5-TGC TGTTGA GGA GCT GGA-3 (SEQ ID NO: 1) and Ex3 NR3C1 sG2 5-AGC ACA CCA GGC AGA GTT-3 (SEQID NO: 2). Exemplary gRNA sequences for TGF-β receptor 2 include EX3 TGFBR2 sG1 5-CGG CTG AGG AGCGGA AGA-3 (SEQ ID NO: 3) and EX3 TGFBR2 sG2 5-TGG-AGG-TGA-GCA-ATC-CCC-3 (SEQ ID NO: 4). The T7 promoter, target sequence, and overlapping sequence can have the sequence TTAATACGACTCACTATAGG (SEQ ID NO: 5) + target sequence + gttttagagctagaaatagc (SEQ ID NO: 6).

[0275] Optimal alignment can be determined using any suitable algorithm for aligning sequences, non-limiting examples of which include the Smith-Waterman algorithm, the Needleman-Wunsch algorithm, algorithms based on the Burrows-Wheeler Transform (e.g., Burrows Wheeler Aligner), Clustal W, Clustal X, BLAT, Novoalign (Novocraft Technologies), ELAND (Illumina, San Diego, Calif.), SOAP (available at soap.genomics.org.cn), and Maq (available at maq.sourceforge.net).

[0276] The CRISPR enzyme can be part of a fusion protein comprising one or more heterologous protein domains. The CRISPR enzyme fusion protein can include any additional protein sequence, and optionally a linker sequence between any two domains. Examples of protein domains that can be fused to the CRISPR enzyme include, but are not limited to, epitope tags, reporter gene sequences, and protein domains having one or more of the following activities: methylase activity, demethylase activity, transcriptional activation activity, transcriptional repression activity, transcriptional release factor activity, histone modification activity, RNA cleavage activity, and nucleic acid binding activity. Non-limiting examples of epitope tags include histidine (His) tags, V5 tags, FLAG tags, influenza hemagglutinin (HA) tags, Myc tags, VSV-G tags, and thioredoxin (Trx) tags. Examples of reporter genes include, but are not limited to, glutathione-5-transferase (GST), horseradish peroxidase (HRP), chloramphenicol acetyltransferase (CAT) β-galactosidase, β-glucuronidase, luciferase, green fluorescent protein (GFP), HcRed, DsRed, cyan fluorescent protein (CFP), yellow fluorescent protein (YFP), and autofluorescent proteins (including blue fluorescent protein (BFP)). The CRISPR enzyme can be fused to a gene sequence encoding a protein or protein fragment that binds to a DNA molecule or binds to other cellular molecules, including, but not limited to, maltose binding protein (MBP), S-tag, Lex A DNA binding domain (DBD) fusion, GAL4A DNA binding domain fusion, and herpes simplex virus (HSV) BP16 protein fusion. Additional domains that may form part of a fusion protein comprising a CRISPR enzyme are described in US20110059502, which is incorporated herein by reference.

[0277] D. Delivery Method

[0278] Cells encompassed herein may contain recombinant vectors. In some embodiments, cells may be transformed, transfected and / or transduced before inactivation and cryopreservation or after thawing after inactivation and cryopreservation. One skilled in the art can construct vectors by standard recombinant techniques (see, e.g., Sambrook et al., 2001 and Ausubel et al., 1996, both incorporated herein by reference) to express antigen receptors of the present disclosure. Vectors include, but are not limited to, plasmids, cosmids, viruses (bacteriophages, animal viruses, and plant viruses), and artificial chromosomes (e.g., YACs), such as retroviral vectors (e.g., vectors derived from Moloney murine leukemia virus vectors (MoMLV), MSCV, SFFV, MPSV, SNV, etc.), lentiviral vectors (e.g., vectors derived from HIV-1, HIV-2, SIV, BIV, FIV, etc.), adenovirus (Ad) vectors (including replication-competent, replication-defective, and enteropathic forms thereof), adeno-associated virus (AAV) vectors, simian virus 40 (SV-40) vectors, bovine papilloma virus vectors, Epstein-Barr virus vectors, herpes virus vectors, vaccinia virus vectors, Harvey murine sarcoma virus vectors, murine mammary tumor virus vectors, Rous sarcoma virus vectors, parvovirus vectors, poliovirus vectors, vesicular stomatitis virus vectors, maraba virus vectors, and group B adenovirus enadenotucirev vectors.

[0279] 1. Viral vectors

[0280] In certain aspects of the present invention, a viral vector encoding an antigen receptor can be provided. When generating a recombinant viral vector, a gene or coding sequence of a heterologous (or non-natural) protein is usually used to replace a non-essential gene. A viral vector is a type of expression construct that utilizes a viral sequence to introduce nucleic acid and possibly protein into a cell. The ability of certain viruses to infect cells or enter cells and integrate into the host cell genome via receptor-mediated endocytosis and to stably and effectively express viral genes makes it an attractive candidate for transferring exogenous nucleic acids to cells (e.g., mammalian cells). Non-limiting examples of viral vectors that can be used to deliver nucleic acids in certain aspects of the present invention are described below.

[0281] Lentiviruses are complex retroviruses that contain, in addition to the common retroviral genes gag, pol, and env, other genes with regulatory or structural functions. Lentivirus vectors are well known in the art (see, e.g., U.S. Patents 6,013,516 and 5,994,136).

[0282] Recombinant lentiviral vectors are capable of infecting non-dividing cells and can be used for in vivo and in vitro gene transfer and nucleic acid sequence expression. For example, U.S. Pat. No. 5,994,136 describes a recombinant lentivirus capable of infecting non-dividing cells, wherein suitable host cells are transfected with two or more vectors having packaging functions (i.e., gag, pol and env and rev and tat), which is incorporated herein by reference.

[0283] 2. Regulatory elements

[0284] The expression cassette included in the vector of the present disclosure particularly comprises (along the 5' to 3' direction) a eukaryotic transcription promoter operably connected to a protein coding sequence, a splicing signal including an intervening sequence and a transcription termination / polyadenylation sequence. The promoter and enhancer controlling the transcription of protein coding genes in eukaryotic cells are composed of a variety of genetic elements. The cellular machinery is able to collect and integrate the regulatory information conveyed by each element, thereby allowing different genes to evolve unique, usually complex transcriptional regulatory patterns. The promoter used in the context of the present disclosure includes constitutive, inducible and tissue-specific promoters.

[0285] 3. Promoter / enhancer

[0286] The expression construct provided herein comprises a promoter that drives the expression of an antigen receptor. The promoter generally comprises a sequence for locating the start site of RNA synthesis. The most well-known example is the TATA box, but in some promoters lacking the TATA box, such as, for example, the promoter of the mammalian terminal deoxynucleotidyl transferase gene and the promoter of the SV40 late gene, the discrete elements covering the start site themselves help fix the start position. Other promoter elements regulate the frequency of transcription initiation. Usually, these are located in the 30110bp region upstream of the start site, although it has been shown that many promoters also contain functional elements downstream of the start site. In order to make the coding sequence "under the control of the promoter", the 5' end of the transcription start site of the transcription reading frame is positioned at the "downstream" (i.e. 3') of the selected promoter. The "upstream" promoter stimulates the transcription of DNA and promotes the expression of the encoded RNA.

[0287] The spacing between promoter elements is often flexible so that promoter function is retained when the elements are inverted or moved relative to each other. In the tk promoter, the spacing between promoter elements can be increased to 50 bp before activity begins to decline. Depending on the promoter, it appears that individual elements can act cooperatively or independently to activate transcription. A promoter may or may not be used in conjunction with an "enhancer," which refers to a cis-acting regulatory sequence involved in the transcriptional activation of a nucleic acid sequence.

[0288] The promoter may be a promoter naturally associated with a nucleic acid sequence, such as one that can be obtained by isolating a 5′ non-coding sequence upstream of a coding segment and / or exon. Such a promoter may be referred to as “endogenous”. Similarly, an enhancer may be an enhancer naturally associated with a nucleic acid sequence, located downstream or upstream of the sequence. Alternatively, certain advantages may be obtained by placing the coding nucleic acid segment under the control of a recombinant or heterologous promoter, which refers to a promoter that is not normally associated with a nucleic acid sequence in its natural environment. A recombinant or heterologous enhancer also refers to an enhancer that is not normally associated with a nucleic acid sequence in its natural environment. Such promoters or enhancers may include promoters or enhancers of other genes, as well as promoters or enhancers isolated from any other virus, prokaryotic or eukaryotic cell, and promoters or enhancers that are not “naturally present”, i.e., different elements of different transcriptional regulatory regions, and / or mutations that alter expression. For example, the promoters most commonly used for recombinant DNA construction include β-lactamase (penicillinase), lactose, and tryptophan (trp-) promoter systems. In addition to synthetically generating promoter and enhancer nucleic acid sequences, recombinant cloning and / or nucleic acid amplification techniques (including PCR) can also be used in conjunction with the compositions disclosed herein. TM ) to generate the sequence. In addition, it is contemplated that control sequences that direct transcription and / or expression of the sequence in non-nuclear organelles (e.g., mitochondria, chloroplasts, etc.) may also be employed.

[0289] Naturally, it is important to use promoters and / or enhancers that effectively direct the expression of the DNA fragment in the organelle, cell type, tissue, organ or organism selected for expression. The use of promoters, enhancers and cell type combinations for protein expression is generally known to those skilled in the art of molecular biology (see, e.g., Sambrook et al., 1989, incorporated herein by reference). The promoter used can be constitutive, tissue-specific, inducible and / or can be used to direct high-level expression of the introduced DNA fragment under appropriate conditions, such as in large-scale production of recombinant proteins and / or peptides. The promoter can be heterologous or endogenous.

[0290] In addition, any promoter / enhancer combination (e.g., according to the Eukaryotic Promoter Database EPDB, accessed via the website epd.isb-sib.ch / ) can also be used to drive expression. The use of T3, T7 or SP6 cytoplasmic expression systems is another possible embodiment. Eukaryotic cells can support cytoplasmic transcription of certain bacterial promoters if the appropriate bacterial polymerase is provided (either as part of the delivery complex or as an additional gene expression construct).

[0291] Non-limiting examples of promoters include early or late viral promoters, such as SV40 early or late promoters, cytomegalovirus (CMV) immediate early promoter, Rous sarcoma virus (RSV) early promoter; eukaryotic promoters, such as β-actin promoter, GAPDH promoter, metallothionein promoter; and tandem response element promoters, such as cyclic AMP response element promoter (cre), serum response element promoter (sre), phorbol ester promoter (TPA) and response element promoter (tre) near the minimal TATA box. Human growth hormone promoter sequences (e.g., human growth hormone minimal promoter described in Genbank accession number X05244, nucleotides 283-341) or mouse mammary tumor promoter (available from ATCC accession number ATCC 45007) can also be used. In certain embodiments, the promoter is CMV IE, dectin-1, dectin-2, human CD11c, F4 / 80, SM22, RSV, SV40, Ad MLP, β-actin, MHC class I, or MHC class II promoter, but any other promoter that can be used to drive expression of a therapeutic gene is suitable for the practice of the present disclosure.

[0292] In certain aspects, the methods of the present disclosure also relate to enhancer sequences, i.e., nucleic acid sequences that increase the activity of a promoter and have the potential to act in cis, regardless of their orientation, even at relatively long distances (up to several kilobases from the target promoter). However, enhancer function is not necessarily limited to such long distances, as they can also act in close proximity to a given promoter.

[0293] 4. Initiation Signal and Linked Expression

[0294] Specific start signals can also be used in the expression constructs provided in the present disclosure to effectively translate the coding sequence. These signals include the ATG start codon or adjacent sequences. It may be necessary to provide exogenous translation control signals, including the ATG start codon. One of ordinary skill in the art will be able to easily determine this and provide the necessary signals. It is well known that the start codon must be "in frame" with the reading frame of the desired coding sequence to ensure translation of the entire insert. Exogenous translation control signals and start codons can be natural or synthetic. Expression efficiency can be improved by including appropriate transcription enhancer elements.

[0295] In certain embodiments, the use of internal ribosome entry site (IRES) elements is used to generate polygenic or polycistronic information. IRES elements can bypass the ribosome scanning model of 5' methylated Cap-dependent translation and start translation at the internal site. IRES elements from two members of the picornavirus family (poliomyelitis and encephalomyocarditis) have been described, as well as IRES from mammalian information. IRES elements can be linked to heterologous open reading frames. Multiple open reading frames can be transcribed together, each separated by IRES, thereby generating polycistronic information. With the help of IRES elements, ribosomes can approach each open reading frame for effective translation. Using a single promoter / enhancer to transcribe a single message can effectively express multiple genes.

[0296] In addition, certain 2A sequence elements can be used to generate linked expression or co-expression of genes in constructs provided by the present disclosure. For example, a cleavage sequence can be used to co-express genes by connecting open reading frames to form a single cistron. An exemplary cleavage sequence is F2A (foot-and-mouth disease virus 2A) or a "2A-like" sequence (e.g., Thosea asigna virus 2A; T2A).

[0297] 5. Copy starting point

[0298] In order to propagate the vector in the host cell, it may contain one or more replication origin sites (commonly referred to as "ori"), for example, a nucleic acid sequence corresponding to the oriP of EBV as described above or an oriP (a specific nucleic acid sequence at the origin of replication) genetically engineered to have similar or enhanced functions in programming. Alternatively, the replication origin or autonomous replication sequence (ARS) of other extrachromosomal replication viruses as described above may be used.

[0299] 6. Selective and screenable markers

[0300] In some embodiments, cells containing constructs of the present disclosure can be identified in vitro or in vivo by including a marker in the expression vector. Such a marker will confer recognizable changes to the cell, thereby allowing easy identification of cells containing the expression vector. Generally, a selective marker is a marker that confers a property that allows selection. A positive selection marker is a marker in which the presence of the marker allows its selection, while a negative selection marker is a marker in which its presence prevents its selection. An example of a positive selection marker is a drug resistance marker.

[0301] The inclusion of drug selection markers usually helps to clone and identify transformants, for example, genes that confer resistance to neomycin, puromycin, hygromycin, DHFR, GPT, zeocin and histidinol are useful selection markers. In addition to conferring markers that allow the phenotype of transformants to be distinguished based on conditional implementation, other types of markers are also contemplated, including screenable markers, such as GFP, whose basis is colorimetric analysis. Alternatively, screenable enzymes can be used as negative selection markers, such as herpes simplex virus thymidine kinase (tk) or chloramphenicol acetyltransferase (CAT). Those skilled in the art will also know how to use immunological markers, possibly in conjunction with FACS analysis. The marker used is believed to be unimportant, as long as it can be expressed simultaneously with the nucleic acid encoding the gene product. Other examples of selectivity and screenable markers are well known to those skilled in the art.

[0302] 7. Other methods of nucleic acid delivery

[0303] In addition to viral delivery of transgene-encoding nucleic acids described herein, the following are additional methods of delivering recombinant genes to a given host cell and are therefore contemplated in the present disclosure.

[0304] Any suitable method for nucleic acid delivery for transforming cells can be used to introduce nucleic acids (e.g., DNA or RNA) into immune cells of the present disclosure, as described herein or known to those of ordinary skill in the art. Such methods include, but are not limited to, direct delivery of DNA, such as by ex vivo transfection, by injection (including microinjection); by electroporation; by calcium phosphate precipitation; by using DEAE-dextran followed by polyethylene glycol; by direct sonic loading; by liposome-mediated transfection and receptor-mediated transfection; by microparticle bombardment; by stirring with silicon carbide fibers; by Agrobacterium-mediated transformation; by desiccation / inhibition-mediated DNA uptake, and any combination of such methods. By applying these techniques, organelles, cells, tissues, or organisms can be stably or temporarily transformed.

[0305] IV. Treatment Methods

[0306] In some embodiments, the present disclosure provides an immunotherapy method comprising administering an effective amount of inactivated and cryopreserved cells of the present disclosure after thawing and reactivation. In some embodiments, a medical disease or condition is treated by transferring a previously inactivated and cryopreserved cell population (e.g., a NK cell population that elicits an immune response).

[0307] In some embodiments, methods including the technology of the present disclosure include administering to a subject a therapeutically effective amount of optionally loaded, optionally preactivated, optionally engineered, and optionally expanded cells (e.g., NK cells) that have been inactivated, optionally cryopreserved, and reactivated (e.g., spontaneously reactivated after removal of an inactivating agent), thereby treating or preventing the subject's disease, including reducing the risk of the disease, reducing the severity of the disease, and / or delaying the onset of the disease. In certain embodiments of the present disclosure, cancer or infection is treated by transferring a composition comprising cells described herein. In at least some cases where the cells are NK cells, NK cells can reverse the anti-inflammatory tumor microenvironment and increase adaptive immune responses by promoting differentiation, activation, and / or recruitment of auxiliary immune cells to the site of malignant tumors because they release proinflammatory cytokines.

[0308] Cells can be thawed using thawing methods and conditions suitable for clinical products. Before cells are applied to an individual, the cells can be washed to remove substantially all cryopreservation media and / or inactivators after thawing or may not be washed. Thawed cells can be diluted and infused without washing. The cells can be substantially delivered to an individual immediately after thawing, or there may be a delay of 1-24 hours or 1 day or more days before delivery, for example, including the situation of washing cells before infusion. Delivery can be by any route and can depend on the medical condition being treated. Delivery can be local or systemic. About the infusion volume of the dosage of the delivered cells, the infusion volume may or may not depend on whether the subject has received a cell dosage. For example, the first cell dosage may be greater than a subsequent dose or may not be greater than a subsequent dose in volume. Multiple infusion volumes may be the same volume. In some embodiments, the infusion volume of the cells is 1, 5, 10, 15, 20, 30, 40, 50, 60, 70, 75, 80, 90, 100, 125, 150, 175, 200, 225, 250, 275 or 300 mL or more. The liquid in which the cells are suspended for infusion can be of any kind. In a specific embodiment, the liquid is PLASMA-LYTE A or a similar solution. For example, the liquid in which the cells are suspended for infusion may contain human serum albumin or may not contain human serum albumin. Albumin is a cryoprotectant and can also be used as a non-serum substitute, so it has a dual role. Before delivery to an individual in need, one or more characteristics of the thawed cells can be tested, such as the presence of microorganisms, for example, the presence of microorganisms caused by contamination; survival rate; cell count, etc. In a specific embodiment, the cells for infusion are contained in a solution that contains one or more other therapeutic agents other than the cells themselves.

[0309] In certain embodiments of the present disclosure, cancer or infection is treated by transferring inactivated and cryopreserved and then thawing and reactivated populations (NK cell populations that trigger immune responses). Provided herein is a method for treating individual cancer or delaying its progression, comprising administering an effective amount of antigen-specific cell therapy to the individual. The method of the present invention can be applied to treat immune disorders, solid cancers, hematological cancers, viral infections, and regenerative medicine.

[0310] The tumors to which the therapeutic methods of the present invention are applicable include any malignant cell type, such as those malignant cells found in solid tumors or hematologic tumors. Exemplary solid tumors may include, but are not limited to, tumors of organs selected from the group consisting of: pancreas, colon, cecum, stomach, brain, head, neck, ovary, kidney, larynx, sarcoma, lung, bladder, melanoma, prostate, and breast. Exemplary hematologic tumors include myeloid tumors, T cell or B cell malignancies, leukemia, lymphoma, blastoma, myeloma, etc. Other examples of cancers that can be treated using the methods provided herein include, but are not limited to, lung cancer (including small cell lung cancer, non-small cell lung cancer, lung adenocarcinoma, and lung squamous cell carcinoma), peritoneal cancer, gastric cancer or gastric cancer (including gastrointestinal cancer and gastrointestinal stromal cancer), pancreatic cancer, cervical cancer, ovarian cancer, liver cancer, bladder cancer, breast cancer, colon cancer, colorectal cancer, endometrial cancer or uterine cancer, salivary gland cancer, kidney cancer or kidney cancer, prostate cancer, vulvar cancer, thyroid cancer, various types of head and neck cancer, and melanoma.

[0311] The cancer may be specifically of the following histological types, although they are not limited thereto: neoplasm, malignant; carcinoma; carcinoma, undifferentiated; giant cell and spindle cell carcinoma; small cell carcinoma; papillary carcinoma; squamous cell carcinoma; lymphoepithelial carcinoma; basal cell carcinoma; pilomatricoma carcinoma; transitional cell carcinoma; papillary transitional cell carcinoma; adenocarcinoma; gastrinoma, malignant; cholangiocarcinoma; hepatocellular carcinoma; combined hepatocellular and cholangiocarcinoma; trabecular adenocarcinoma; adenoid cystic carcinoma; adenomatous polyposis adenocarcinoma; adenocarcinoma, familial polyposis coli; solid carcinoma; carcinoid tumor, malignant; bronchioloalveolar adenocarcinoma; papillary adenocarcinoma; chromophobe cell carcinoma; oncocytic carcinoma; oncocytic adenocarcinoma; basophilic carcinoma; clear cell adenocarcinoma; granulocytic carcinoma; follicular adenocarcinoma; papillary and follicular adenocarcinoma; sclerosing carcinoma without encapsulation; adrenocortical carcinoma; endometrioid carcinoma; epidermal carcinoma carcinoma of the ovary; apocrine gland carcinoma; sebaceous gland carcinoma; cervical gland carcinoma; mucoepidermoid carcinoma; cystadenocarcinoma; papillary cystadenocarcinoma; papillary serous cystadenocarcinoma; mucinous cystadenocarcinoma; mucinous adenocarcinoma; signet ring cell carcinoma; infiltrating ductal carcinoma; medullary carcinoma; lobular carcinoma; inflammatory carcinoma; Paget's disease, breast; acinar cell carcinoma; adenosquamous carcinoma; adenocarcinoma with squamous metaplasia; thymoma, malignant; ovarian stromal tumor, malignant; thecoma cell tumor, malignant; granulosa cell tumor, malignant; testicular blastoma, malignant; Sertoli cell carcinoma; Leydig cell tumor, malignant; lipid cell tumor, malignant; paraganglioma, malignant; extramammary paraganglioma, malignant; pheochromocytoma; glomus sarcoma; malignant melanoma; amelanotic melanoma; superficial spreading melanoma; lentiginous malignant melanoma; acral lentiginous melanoma lentiginous melanomas); nodular melanoma; malignant melanoma in giant nevus; epithelioid cell melanoma; blue nevus, malignant; sarcoma; fibrosarcoma; fibrohistiocytoma, malignant; myxosarcoma; liposarcoma; renal cell carcinoma; leiomyosarcoma; rhabdomyosarcoma; embryonal rhabdomyosarcoma; alveolar rhabdomyosarcoma; stromal sarcoma; mixed tumor, malignant; mixed tumor of Müllerian duct; Wilms' tumor; hepatoblastoma; carcinosarcoma; stromal tumor, malignant; Brenner's tumor, malignant; phyllodes tumor, malignant; synovial sarcoma; mesothelioma, malignant; dysgerminoma; embryonal carcinoma; teratoma, malignant; ovarian thyroid tumor, malignant of the bone; Choriocarcinoma; Mesonephroma, malignant; Angiosarcoma; Hemangioendothelioma, malignant; Kaposi's sarcoma; Hemangiopericytoma, malignant; Lymphangiosarcoma; Osteosarcoma; Pericortical osteosarcoma; Chondrosarcoma; Chondroblastoma, malignant; Mesenchymal chondrosarcoma; Giant cell tumor of bone; Ewing's sarcoma; Odontogenic tumor, malignant; Ameloblastic odontosarcoma; Ameloblastoma, malignant; Ameloblastic fibrosarcoma; Pinealoma, malignant; Chordoma; Glioma, malignant; Ependymoma; Astrocytoma; Protoplasmic astrocytoma; Fibrillary astrocytoma; Astroblastoma; Glioblastoma; Oligodendroglioma; Oligodendroglioma;primitive neuroectodermal; cerebellar sarcoma; ganglioneuroblastoma; neuroblastoma; retinoblastoma; olfactory neurogenic tumor; meningioma, malignant; neurofibrosarcoma; neurilemmary sheath tumor, malignant; granulocytoma, malignant; malignant lymphoma; Hodgkin's disease; Hodgkin; paragranuloma; malignant lymphoma, small lymphocytic; malignant lymphoma, large cell, diffuse; malignant lymphoma, follicular; mycosis fungoides; other specified non-Hodgkin's lymphoma; B-cell lymphoma; low-grade / follicular non-Hodgkin's lymphoma (NHL); small lymphocytic (SL) NHL; intermediate-grade / follicular NHL; intermediate-grade diffuse NHL; high-grade immunoblastic NHL; high-grade lymphoblastic NHL; high-grade Small non-dividing cell NHL; large mass disease NHL; mantle cell lymphoma; AIDS-related lymphoma; Waldenstrom macroglobulinemia; malignant histiocytosis; multiple myeloma; mast cell sarcoma; immunoproliferative enteropathy; leukemia; lymphoid leukemia; plasma cell leukemia; erythroleukemia; lymphosarcoma cell leukemia; myeloid leukemia; basophilic leukemia; eosinophilic leukemia; monocytic leukemia; mast cell leukemia; megakaryoblastic leukemia; myeloid leukemia; hairy cell leukemia; chronic lymphocytic leukemia (CLL); acute lymphoblastic leukemia (ALL); acute myeloid leukemia (AML); and chronic myeloblastic leukemia.

[0312] Particular embodiments relate to methods of treating leukemia. Leukemia is a cancer of the blood or bone marrow and is characterized by abnormal proliferation (multiplication of production) of blood cells, usually white blood cells (leukocytes), but may involve red blood cells (erythroleukemia). It is part of a broad group of diseases known as hematological tumors. Leukemia is a broad term that encompasses a range of diseases. Leukemia is clinically and pathologically divided into its acute and chronic forms.

[0313] Acute leukemia is characterized by the rapid proliferation of immature blood cells. This crowding makes it impossible for the bone marrow to produce healthy blood cells. Acute leukemia can occur in children and young adults. In fact, it is the more common cause of death in children in the United States than any other type of malignant disease. Acute leukemia requires immediate treatment because the malignant cells develop and accumulate rapidly, then spill into the bloodstream and spread to other organs in the body. Central nervous system (CNS) involvement is uncommon, although the disease occasionally causes cranial nerve palsies. Chronic leukemia is characterized by an excessive accumulation of relatively mature but still abnormal blood cells. These cells, which usually take months to years to develop, are produced at a much higher rate than normal cells, resulting in many abnormal white blood cells in the blood. Chronic leukemia occurs primarily in older people, but can theoretically occur in any age group. Acute leukemia must be treated immediately, while chronic leukemia sometimes requires monitoring for a period of time before treatment to ensure maximum effectiveness of the treatment.

[0314] In addition, the disease is classified as lymphocytic or lymphoblastic, which indicates that the cancer has occurred in a type of bone marrow cell that normally goes on to form lymphocytes, and myeloid or myeloid, which indicates that the cancer has occurred in a type of bone marrow cell that normally goes on to form red blood cells, certain types of white blood cells, and platelets (see Lymphoid vs. Myeloid Cells).

[0315] Acute lymphocytic leukemia (also called acute lymphoblastic leukemia or ALL) is the most common type of leukemia in young children. This disease can also affect adults, especially those 65 years and older. Chronic lymphocytic leukemia (CLL) most often affects adults over 55 years of age. It sometimes occurs in younger adults but almost never affects children. Acute myeloid leukemia (also called acute myeloid leukemia or AML) is more common in adults than in children. This type of leukemia was previously called "acute nonlymphocytic leukemia." Chronic myeloid leukemia (CML) occurs mainly in adults. Very rarely, children can also develop this disease.

[0316] Lymphoma is a type of cancer that originates in lymphocytes, a type of white blood cell in the vertebrate immune system. There are many types of lymphoma. According to the National Institutes of Health, lymphoma accounts for about 5% of all cancer cases in the United States, and Hodgkin lymphoma in particular accounts for less than 1% of all cancer cases in the United States. Because the lymphatic system is part of the body's immune system, patients with weakened immune systems (such as those caused by HIV infection or certain drugs or medications) also have a higher incidence of lymphoma.

[0317] In certain embodiments of the present disclosure, a composition comprising inactivated, cryopreserved, thawed and reactivated cells (e.g., NK cells) is delivered to an individual in need, such as an individual suffering from cancer or infection. In at least some cases, cells can enhance the immune system of an individual to attack corresponding cancer or pathogenic cells. In some cases, a composition comprising cells of the present disclosure of one or more dosages is provided to an individual. In the case of providing two or more dosages of cells of the present disclosure to an individual, the duration between administrations should be sufficient to allow the time for reproduction in the individual, and in a specific embodiment, the duration between dosages is 1, 2, 3, 4, 5, 6, 7 or more days.

[0318] In some embodiments, the source of the pre-activated (optional) expanded (optional), inactivated and cryopreserved, then thawed and reactivated NK cells can be of any type, but in certain embodiments, the cells are obtained from cord blood, peripheral blood, human embryonic stem cells, or induced pluripotent stem cell banks. For example, a suitable dose for therapeutic effect would be at least 10 5 or about 105 to about 10 12 Cells, for example, preferably in a series of administration cycles. An exemplary administration regimen includes four one-week ascending dose administration cycles, starting with at least about 10 cells on day 0. 5 Starting with 10 cells, for example, gradually increasing to about 10 within a few weeks after initiating the intrapatient dose escalation regimen 12 Suitable routes of administration include intravenous, subcutaneous, intracavitary (e.g., via a reservoir access device), intraperitoneal, and direct injection into the tumor mass.

[0319] In some embodiments, the composition comprising cells produced according to the present method has many potential uses, including experimental and therapeutic uses. In particular, it is envisioned that such a cell population can be used to suppress adverse or inappropriate immune responses. In this method, a small amount of cells (e.g., NK cells) are taken from the patient, then manipulated and amplified in vitro, then inactivated and stored for a period of time, and then thawed and reactivated and re-injected into the patient. Examples of diseases that can be treated in this way are autoimmune diseases and conditions that require suppression of immune activity, for example, in order to obtain allogeneic transplant tolerance. The treatment method may include obtaining NK cells from a mammal; amplifying NK cells in vitro according to the methods of the present invention described herein; inactivating and cryopreserving the cells by the methods described herein; thawing and reactivating the cells by the methods described herein, and administering a composition comprising NK cells to the mammal to be treated.

[0320] The pharmaceutical composition of the present disclosure comprising cells described herein can be used alone or in combination with other mature agents for the treatment of cancer. Whether delivered alone or in combination with other agents, the pharmaceutical composition of the present disclosure can be delivered to various parts in mammals (particularly humans) to achieve specific effects by various routes. Those skilled in the art will recognize that although multiple routes can be used for administration, a specific route can provide a more direct and more effective response than another route. For example, for the treatment of melanoma, intradermal administration may be more advantageous than inhalation administration. Local or systemic administration can be achieved by including the following administration: the preparation is applied or instilled into the body cavity, inhaled or blown into an aerosol or introduced by parenteral administration including intramuscular, intravenous, intraportal, intrahepatic, intraperitoneal, subcutaneous or intradermal administration.

[0321] Certain embodiments of the present disclosure provide methods for treating or preventing an immunomodulatory disorder. In one embodiment, the subject suffers from an autoimmune disease. Non-limiting examples of autoimmune diseases include: alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune diseases of the adrenal glands, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune oophoritis and orchitis, autoimmune thrombocytopenia, Behcet's disease, bullous pemphigoid, cardiomyopathy, celiac dermatitis, and eczema. spate-dermatitis), chronic fatigue immune dysfunction syndrome (CFIDS), chronic inflammatory demyelinating polyneuropathy, Churg-Strauss syndrome, cicatricial pemphigoid, CREST syndrome, cold agglutinin disease, Crohn's disease, discoid lupus, essential mixed cryoglobulinemia, fibromyalgia-fibromyositis, glomerulonephritis, Graves' disease, Guillain-Barré disease, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura (ITP), IgA neuropathy, juvenile arthritis, lichen planus, lupus erythematosus, Meniere's disease, mixed connective tissue disease, multiple sclerosis, type 1 or immune-mediated diabetes mellitus, Myasthenia gravis, nephrotic syndrome (e.g., minimal change disease, focal glomerulosclerosis, or membranous nephropathy), pemphigus vulgaris, pernicious anemia, polyarteritis nodosa, polychondritis, polyglandular syndromes, polymyalgia rheumatica, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, psoriatic arthritis, Raynaud phenomenon, Rett syndrome, rheumatoid arthritis, sarcoidosis, scleroderma, Sjögren's syndrome, stiff-person syndrome, systemic lupus erythematosus, lupus erythematosus, ulcerative colitis, uveitis, vasculitis (e.g., polyarteritis nodosa, Takayasu's arteritis, temporal arteritis / giant cell arteritis, or dermatitis herpetiformis vasculitis), vitiligo, and Wegener's granulomatosis. Thus, some examples of autoimmune diseases that can be treated using the methods disclosed herein include, but are not limited to: multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, type I diabetes, Crohn's disease; ulcerative colitis, myasthenia gravis, glomerulonephritis, ankylosing spondylitis, vasculitis, or psoriasis. The subject may also suffer from an allergic disease, such as asthma.

[0322] In another embodiment, the subject is a recipient of a transplanted organ or stem cell, and the immune cells are used to prevent and / or treat rejection. In a specific embodiment, the subject suffers from graft-versus-host disease or is at risk of developing the disease. GVHD is a possible complication of any transplant using or containing stem cells from related or unrelated donors. There are two types of GVHD: acute and chronic. Acute GVHD appears within the first three months after transplantation. Signs of acute GVHD include a reddish rash that initially involves a small area of ​​the body (chest, back, arms, legs) and may spread and become more severe (involving>80% of the body), with peeling or blistering of the skin. Acute GVHD may also affect the gastrointestinal (GI) tract, in which case nausea and vomiting (upper GI GVHD) and / or abdominal cramps and diarrhea (lower GI GVHD) may occur. Yellowing of the skin and eyes (jaundice) indicates that acute GVHD has affected the liver. Chronic GVHD is graded according to its severity: stage 1 / grade is mild; stage 4 / grade is severe. Chronic GVHD develops three months or more after transplantation. The symptoms of chronic GVHD are similar to those of acute GVHD, but in addition, chronic GVHD may also affect the mucous glands in the eyes, the salivary glands in the mouth, and the glands that lubricate the gastric mucosa and the intestines. Any population of immune cells disclosed herein can be utilized. Examples of transplanted organs include solid organ transplants, such as kidneys, livers, skin, pancreas, lungs, and / or hearts, or cell transplants, such as islets, hepatocytes, myoblasts, bone marrow, or hematopoietic or other stem cells. The transplant can be a composite transplant, such as facial tissue. The immune cells can be administered before, at the same time as, or after the transplant. In some embodiments, the immune cells are administered before the transplant, such as at least 1 hour, at least 12 hours, at least 1 day, at least 2 days, at least 3 days, at least 4 days, at least 5 days, at least 6 days, at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, or at least 1 month before the transplant. In a specific non-limiting example, the administration of a therapeutically effective amount of immune cells is performed 3-5 days before the transplant.

[0323] In some embodiments, cells administered to patients receiving transplants (e.g., cells described herein) can be sensitized with antigens specific to the transplant material prior to administration. According to this embodiment, the immune / inflammatory response of the transplant recipient to the transplant material will be reduced, and therefore, the possibility of rejection of the transplanted tissue is minimized. Similarly, with regard to the treatment of graft-versus-host disease, cells (e.g., NK cells) can be sensitized with antigens specific to the host. According to this embodiment, the recipient has a reduced immune / inflammatory response to self-antigens.

[0324] Administration of the compositions comprising the cells described herein can be used whenever immunosuppression or suppression of inflammation is needed, such as at the first signs or symptoms of disease or inflammation. These may be general, such as pain, edema, elevated temperature, or may be specific signs or symptoms associated with dysfunction of the affected organ. For example, in renal transplant rejection, serum creatinine levels may be elevated, while in GVHD, a rash may occur, and in asthma, shortness of breath and wheezing may occur.

[0325] In another embodiment, administering a therapeutically effective amount of a composition comprising cells described herein to a subject can treat or inhibit inflammation in the subject. Therefore, the method includes administering a therapeutically effective amount of a composition comprising cells described herein (e.g., NK cells) to a subject to inhibit the inflammatory process. Examples of inflammatory diseases include, but are not limited to, asthma, encephalitis, inflammatory bowel disease, chronic obstructive pulmonary disease (COPD), allergic diseases, septic shock, pulmonary fibrosis, undifferentiated spondyloarthropathy, undifferentiated arthropathy, arthritis, inflammatory osteolysis, and chronic inflammation caused by chronic viral or bacterial infections. The methods disclosed herein can also be used to treat allergic diseases.

[0326] In some embodiments, nonmyeloablative lymphodepleting chemotherapy can be administered to a subject prior to an immune cell therapy comprising cells described herein. Nonmyeloablative lymphodepleting chemotherapy can be any suitable such therapy, which can be administered by any suitable route. Nonmyeloablative lymphodepleting chemotherapy can include, for example, administration of cyclophosphamide and fludarabine, particularly if the cancer is melanoma (which can be metastatic). An exemplary route for administering cyclophosphamide and fludarabine is intravenous administration. Similarly, any suitable dose of cyclophosphamide and fludarabine can be administered, and as the most common regimen for lymphodepleting chemotherapy prior to administering CAR-T cells or CAR-NK cells. In a particular aspect, about 60 mg / kg of cyclophosphamide is administered for two days, followed by administration of about 25 mg / m 2 of fludarabine for five days.

[0327] In certain embodiments, the growth factor promoting the growth and activation of immune cells is administered to the subject simultaneously with the immune cells or after the immune cells. Immune cell growth factor can be any suitable growth factor promoting the growth and activation of immune cells. The example of suitable immune cell growth factor includes interleukin (IL) -2, IL-7, IL-15 and IL-12, which can be used alone or in a variety of combinations (such as IL-2 and IL-7, IL-2 and IL-15, IL-7 and IL-15, IL-2, IL-7 and IL-15, IL-12 and IL-7, IL-12 and IL-15 or IL-12 and IL2).

[0328] A therapeutically effective amount of immune cells can be administered by a variety of routes, including parenteral administration, such as intravenous, intraperitoneal, intramuscular, intrasternal, or intraarticular injection or infusion.

[0329] The therapeutically effective amount of the immune cells used for adoptive cell therapy is the amount that achieves the desired effect in the treated subject. For example, this can be the amount of immune cells that are necessary for inhibiting the progression or causing the regression of autoimmune diseases or alloimmune diseases or can alleviate the symptoms (such as pain and inflammation) caused by autoimmune diseases. It may be the amount necessary to alleviate the symptoms (such as pain, edema and fever) associated with inflammation. It can also be the amount necessary to reduce or prevent the rejection of a transplanted organ.

[0330] The immune cell population can be administered in a treatment regimen consistent with the disease, such as a single or several doses over a day to several days to improve the disease state or regular doses over an extended period of time to inhibit disease progression and prevent disease recurrence. The precise dose used in the formulation also depends on the route of administration and the severity of the disease or condition, and should be determined according to the judgment of the practitioner and the circumstances of each patient. The therapeutically effective amount of immune cells will depend on the subject being treated, the severity and type of the affliction, and the mode of administration. In some embodiments, the dosage range that can be used to treat human subjects is at least 3.8×10 4 , at least 3.8×10 5 , at least 3.8×10 6 , at least 3.8×10 7 , at least 3.8×10 8 , at least 3.8×10 9 , or at least 3.8×10 10 Immune cells / m 2 In one embodiment, the dosage range for treating human subjects is about 3.8×10 9 About 3.8×10 10 Immune cells / m 2In other embodiments, the therapeutically effective amount of immune cells may be from about 5×10 6 cells / kg body weight to about 7.5×10 8 cells / kg body weight change, for example, about 2×10 7 cells / kg body weight to about 5×10 8 cells / kg body weight, or about 5×10 7 Cells / kg body weight is about 2×10 8 In some embodiments, the dosage range that can be used to treat human subjects is at least about or about 4×10 cells / kg body weight per patient per dose. 6 ,8×10 6 ,4×10 7 ,8×10 7 ,4×10 8 ,8×10 8 ,4×10 9 ,8×10 9 ,4×10 10 , or 8×10 10 In some embodiments, the dosage for treating human subjects is at least about 4×10 cells per patient. 6 cells or about 4 × 10 6 In some embodiments, the dosage for treating human subjects is at least about 8×10 cells per patient. 6 cells or about 8×10 6 cells. In some embodiments, the patient can be treated with multiple doses. In some embodiments, the patient can be treated with different doses at different times. In some embodiments, the patient can be treated with the same dose at different times. In some embodiments, the patient can be treated with different doses at certain times and the same dose at other times. The exact number of immune cells can be easily determined by those skilled in the art based on the age, weight, sex, and physiological condition of the subject. The effective dose can be inferred from a dose-response curve from an in vitro or animal model test system.

[0331] Immune cells can be administered in combination with one or more other therapeutic agents to treat immune-mediated disorders. Combination therapy may include, but is not limited to, one or more antimicrobial agents (e.g., antibiotics, antivirals, and antifungals), antitumor agents (e.g., fluorouracil, methotrexate, paclitaxel, fludarabine, etoposide, doxorubicin, or vincristine), immunodepleting agents (e.g., fludarabine, etoposide, doxorubicin, or vincristine), immunosuppressants (e.g., azathioprine or glucocorticoids, such as dexamethasone or prednisone), anti-inflammatory agents (e.g., glucocorticoids, such as hydrocortisone, dexamethasone, or prednisone, or nonsteroidal anti-inflammatory agents, such as acetylsalicylic acid, ibuprofen, or naproxen sodium), cytokines (e.g., interleukin 10 or transforming growth factor-β), hormones (e.g., estrogen), or vaccines. In addition, immunosuppressants or tolerogenic agents may be administered, including but not limited to calcineurin inhibitors (e.g., cyclosporine and tacrolimus); mTOR inhibitors (e.g., rapamycin); mycophenolate mofetil, antibodies (e.g., recognizing CD3, CD4, CD40, CD154, CD45, IVIG or B cells); chemotherapeutic agents (e.g., methotrexate, thiosulfate, busulfan); irradiation; or chemokines, interleukins or their inhibitors (e.g., BAFF, IL-2, anti-IL-2R, IL-4, JAK kinase inhibitors). Depending on the desired effect, such additional agents may be administered before, during, or after the administration of immune cells. Such administration of cells and agents may be by the same route or by different routes, and may be administered at the same site or at different sites.

[0332] In certain embodiments, the composition comprising the cells described herein is administered in combination with a second therapeutic agent. For example, the second therapeutic agent may include T cells, immunomodulators, monoclonal antibodies, chemotherapeutic agents, hormones, any type of drug, surgery, radiation, etc. In a non-limiting example, the immunomodulator is lenalidomide, the monoclonal antibody is rituximab, ofatumumab or lumiruximab, and the chemotherapeutic agent is fludarabine or cyclophosphamide.

[0333] The compositions of the present disclosure can be provided in unit dosage form, wherein each dosage unit (e.g., injection) contains a predetermined amount of the composition, alone or in appropriate combination with other active agents. The term unit dosage form as used herein refers to physically discrete units suitable as unit doses for human and animal subjects, each unit containing a predetermined amount of the composition of the present disclosure, alone or in combination with other active agents, associated with a pharmaceutically acceptable diluent, carrier or vehicle (as the case may be), calculated in an amount sufficient to produce the desired effect. The specifications of the unit dosage form of the present disclosure depend on the specific pharmacodynamics associated with the pharmaceutical composition in a specific subject.

[0334] Ideally, an effective amount or sufficient number of cells of the present disclosure are present in the composition and introduced into the subject to establish a long-term, specific anti-tumor response to reduce the size of the tumor or eliminate tumor growth or regrowth, which would otherwise occur in the absence of such treatment. Ideally, the amount of cells of the present disclosure (e.g., inactivated, cryopreserved, thawed and reactivated NK cells) reintroduced into the subject results in a 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 98% or 100% reduction in tumor size compared to otherwise identical conditions in which there are no NK cells inactivated prior to cryopreservation as described herein.

[0335] V. Pharmaceutical Compositions

[0336] Also provided herein are pharmaceutical compositions and formulations comprising inactivated and cryopreserved cells (eg, NK cells) and a pharmaceutically acceptable carrier.

[0337] As used herein, "pharmaceutically acceptable carriers" include any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drugs, drug stabilizers, gels, binders, excipients, disintegrants, lubricants, sweeteners, flavoring agents, dyes, such materials and combinations thereof known to those skilled in the art (see, e.g., Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289-1329, incorporated herein by reference). Unless any conventional carrier is incompatible with the active ingredient, it is contemplated for use in the pharmaceutical composition.

[0338] The pharmaceutical composition may include different types of carriers, depending on whether it is used in solid, liquid or aerosol form, and whether sterility is required for routes of administration such as injection. The currently disclosed compositions may be administered intravenously, intradermally, transdermally, intrathecally, intraarterially, intraperitoneally, intranasally, intravaginally, intrarectally, externally, intramuscularly, subcutaneously, mucosally, orally, locally, inhaled (e.g., aerosol inhalation), injected, infused, continuously infused, directly localized perfusion bathing target cells, by catheter, by lavage, with cream, in lipid composition (e.g., liposome) form, or by other methods known to those of ordinary skill in the art or any combination of the foregoing methods (see, e.g., Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, incorporated herein by reference).

[0339] Compositions comprising cells of the present disclosure can be formulated into compositions in free base, neutral or salt form. Pharmaceutically acceptable salts include acid addition salts, such as salts formed with free amino groups of protein compositions, or salts formed with inorganic acids (such as hydrochloric acid or phosphoric acid) or organic acids (such as acetic acid, oxalic acid, tartaric acid or glycolic acid) where appropriate. Salts formed with free carboxyl groups can also come from inorganic bases (such as hydroxides of sodium, potassium, ammonium, calcium or iron); or organic bases (such as isopropylamine, trimethylamine, histidine or procaine). After preparation, the solution will be administered in a manner compatible with the dosage formulation, and administered in a therapeutically effective amount. The preparation is easy to administer in various dosage forms, such as formulated for parenteral administration (such as injection solutions) or for delivery to the lungs in aerosols, or formulated for digestive tract administration (such as drug release capsules, etc.).

[0340] In addition, according to the present disclosure, the composition of the present disclosure that is suitable for use is provided with a pharmaceutically acceptable carrier, which contains or does not contain an inert diluent. The carrier should be absorbable, including liquid, semisolid, i.e., a paste or a solid carrier. Unless any conventional medium, medicament, diluent or carrier is harmful to the therapeutic effect of the recipient or the composition contained therein, it is appropriate to use it for the composition to be used for practicing the method of the present invention. The example of a carrier or diluent includes fat, oil, water, saline solution, lipid, liposome, resin, adhesive, filler, etc., or a combination thereof. The composition can also include various antioxidants to delay the oxidation of one or more components. In addition, the effect of microorganisms can be prevented by preservatives, such as various antibacterial agents and antifungal agents, including but not limited to parabens (such as methyl paraben, propyl paraben), chlorobutanol, phenol, sorbic acid, thimerosal or a combination thereof.

[0341] According to the present invention, the composition is combined with the carrier in any convenient and practical manner, ie by solution, suspension, emulsification, mixing, encapsulation, absorption, etc. Such procedures are routine to those skilled in the art.

[0342] In a particular embodiment of the present disclosure, the composition is combined or fully mixed with a semisolid or solid carrier. Mixing can be carried out in any convenient manner, such as grinding. Stabilizers can also be added during the mixing process to protect the composition from losing therapeutic activity, i.e., denaturation in the stomach. Examples of stabilizers for the composition include buffers, amino acids such as glycine and lysine, carbohydrates such as glucose, mannose, galactose, fructose, lactose, sucrose, maltose, sorbitol, mannitol, etc.

[0343] In further embodiments, the present disclosure may involve the use of a pharmaceutical lipid carrier composition, which includes a composition comprising a cell of the present disclosure and an optional aqueous solvent. As used herein, the term "lipid" will be defined as including any of a wide range of substances that are characteristically insoluble in water and can be extracted with an organic solvent. Such compounds are well known to those skilled in the art, and when the term "lipid" is used herein, it is not limited to any particular structure. Examples include compounds containing long-chain aliphatic hydrocarbons and derivatives thereof. Lipids can be naturally occurring or synthetic (i.e., designed or produced by humans). However, lipids are generally biological substances. Biological lipids are well known in the art, including, for example, neutral fats, phospholipids, phosphoglycerides, steroids, terpenes, lysolipids, sphingolipids, glycolipids, sulfolipids, lipids and polymerizable lipids with ether and ester-connected fatty acids and combinations thereof. Of course, compounds other than the compounds specifically described herein that are understood by those skilled in the art to be lipids are also included in the compositions and methods of the present invention.

[0344] Those of ordinary skill in the art will be familiar with a range of techniques that can be used to disperse compositions in nanoparticles or lipid carriers. For example, compositions comprising NK cells and antibodies can be dispersed in a solution containing lipids, dissolved with lipids, emulsified with lipids, mixed with lipids, combined with lipids, covalently bound to lipids, contained in lipids as a suspension, contained or complexed with micelles or liposomes, or associated with lipids or lipid structures in any manner known to those skilled in the art. Dispersion may or may not result in the formation of liposomes.

[0345] The actual dosage of the present disclosure composition administered to an animal patient can be determined by physical and physiological factors, such as body weight, severity of the condition, type of disease being treated, previous or concurrent therapeutic interventions, endogenous diseases of the patient, and route of administration. Depending on the dosage and route of administration, the preferred dosage and / or number of administrations of the effective amount can vary according to the subject's response. In any case, the physician responsible for administration will determine the concentration of the active ingredient in the composition and the dosage suitable for the individual subject.

[0346] In certain embodiments, the pharmaceutical composition may include, for example, at least about 0.1% of the active compound. In other embodiments, the active compound may account for between about 2% and about 75% of the unit weight, or between about 25% and about 60%, for example, and any range that can be derived therein. Of course, the amount of the active compound in each therapeutically useful composition can be prepared so that a suitable dose is obtained in any given unit dose of the compound. Technicians in the field of preparing such pharmaceutical formulations will consider factors such as solubility, bioavailability, biological half-life, route of administration, product shelf life, and other pharmacological considerations, and therefore, various dosages and treatment regimens may be required.

[0347] In other non-limiting examples, dosages can also include about 1 μg / kg / body weight, about 5 μg / kg / body weight, about 10 μg / kg / body weight, about 50 μg / kg / body weight, about 100 μg / kg / body weight, about 200 μg / kg / body weight, about 350 μg / kg / body weight, about 500 μg / kg / body weight, about 1 mg / kg / body weight, about 5 mg / kg / body weight, about 10 mg / kg / body weight, about 50 mg / kg / body weight, about 100 mg / kg / body weight, about 200 mg / kg / body weight, about 350 mg / kg / body weight, about 500 mg / kg / body weight to about 1000 mg / kg / body weight or more per administration, and any range derivable therein. In non-limiting examples of ranges derivable from the numbers listed herein, based on the above numbers, a range of about 5 mg / kg / body weight to about 100 mg / kg / body weight, about 5 micrograms / kg / body weight to about 500 mg / kg / body weight, etc. can be administered.

[0348] Therapeutic compositions comprising cells of the present disclosure may be administered intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intraorbitally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally. In some embodiments, antibiotics are administered intravenously, intramuscularly, subcutaneously, topically, orally, transdermally, intraperitoneally, intraorbitally, by implantation, by inhalation, intrathecally, intraventricularly, or intranasally. Appropriate dosage may be determined based on the type of disease to be treated, the severity and course of the disease, the individual's clinical condition, the individual's clinical history and response to treatment, and the judgment of the attending physician.

[0349] Treatment may include various "unit doses". A unit dose is defined as a therapeutic composition containing a predetermined amount. The amount to be administered, as well as the specific route and formulation, is determined within the skill of a person skilled in the clinical art. A unit dose need not be administered as a single injection, but may include continuous infusion over a set period of time. In some aspects, a unit dose includes a single administrable dose.

[0350] The amount to be administered according to the number of treatments and the unit dose depends on the desired therapeutic effect. An effective dose is understood to mean the amount required to achieve a specific effect. In the practice of certain embodiments, it is expected that a dose within the range of 10 mg / kg to 200 mg / kg may affect the protective ability of these agents. Thus, contemplated dosages include dosages of about 0.1, 0.5, 1, 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 100, 105, 110, 115, 120, 125, 130, 135, 140, 145, 150, 155, 160, 165, 170, 175, 180, 185, 190, 195, and 200, 300, 400, 500, 1000 μg / kg, mg / kg, μg / day, or mg / day, or any range derivable therein. In addition, such dosages may be administered multiple times a day, and / or may be administered over multiple days, weeks, or months.

[0351] In certain embodiments, the effective dose of the pharmaceutical composition is a dose that can provide a blood level of about 1 μM to 150 μM. In another embodiment, the effective dose provides a blood level of about 4 μM to 100 μM; or about 1 μM to 100 μM; or about 1 μM to 50 μM; or about 1 μM to 40 μM; or about 1 μM to 30 μM; or about 1 μM to 20 μM; or about 1 μM to 10 μM; or about 10 μM to 150 μM; or about 10 μM to 100 μM; or about 10 μM to 50 μM; or about 25 μM to 150 μM; or about 25 μM to 100 μM; or about 25 μM to 50 μM; or about 50 μM to 150 μM; or about 50 μM to 100 μM (or any range derivable therein). In other embodiments, the dose can provide a blood level of the therapeutic agent administered to a subject of about, at least about, or at most about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 μM or any range derivable therein. In certain embodiments, the therapeutic agent administered to the subject is metabolized in vivo to a metabolized therapeutic agent, in which case the blood level may refer to the amount of the agent. Alternatively, to the extent that the therapeutic agent is not metabolized by the subject, the blood levels discussed herein may refer to the unmetabolized therapeutic agent.

[0352] A. Digestive Compositions and Preparations

[0353] In a particular embodiment of the present disclosure, the composition comprising the cells of the present disclosure is formulated to be administered via a digestive route. The digestive route includes all possible routes of administration in which the composition is in direct contact with the digestive tract. Specifically, the pharmaceutical compositions disclosed herein can be administered orally, buccally, rectally, or sublingually. Therefore, these compositions can be formulated with an inert diluent or an absorbable edible carrier, or they can be encapsulated in a hard or soft shell gelatin capsule, or they can be compressed into tablets, or they can be directly mixed with food in the diet.

[0354] In certain embodiments, the active compound can be mixed with an excipient and used in the form of an ingestible tablet, buccal tablet, troche, capsule, elixir, suspension, syrup, wafer, etc. (Mathiowitz et al., 1997; Hwang et al., 1998; U.S. Pat. Nos. 5,641,515, 5,580,579, and 5,792,451, each of which is incorporated herein by reference in its entirety). Tablets, troches, pills, capsules, etc. may also contain the following substances: a binder such as gum tragacanth, gum arabic, corn starch, gelatin, or a combination thereof; an excipient such as dicalcium phosphate, mannitol, lactose, starch, magnesium stearate, sodium saccharin, cellulose, magnesium carbonate, or a combination thereof; a disintegrant such as corn starch, potato starch, alginic acid, or a combination thereof; a lubricant such as magnesium stearate; a sweetener such as sucrose, lactose, saccharin, or a combination thereof; a flavoring such as peppermint, oil of wintergreen, cherry flavoring, orange flavoring, etc. When the dosage unit form is a capsule, it may include a liquid carrier in addition to the above-mentioned types of materials. Various other materials may exist as a coating or otherwise change the physical form of the dosage unit. For example, tablets, pills or capsules may be coated with shellac, sugar or both. When the dosage form is a capsule, it may include a carrier, such as a liquid carrier, in addition to the above-mentioned types of materials. Gelatin capsules, tablets or pills may be enteric coated. Enteric coatings prevent the composition from denaturing in the stomach or upper intestine because the pH in the stomach or upper intestine is acidic. See, for example, U.S. Patent No. 5,629,001. After reaching the small intestine, the alkaline pH therein dissolves the coating and allows the composition to be released and absorbed by special cells, such as epithelial enterocytes and Peyer's lymph node M cells. Elixir syrups may include active compounds sucrose as a sweetener, methyl and propylparaben as preservatives, dyes and flavorings, such as cherry or orange flavors. Of course, any material used to prepare any dosage unit should be pharmaceutically pure and substantially nontoxic at the amount used. In addition, the active compounds may be incorporated into sustained-release preparations and formulations.

[0355] For oral administration, the compositions of the present disclosure may alternatively be incorporated with one or more excipients in the form of a mouthwash, toothpaste, buccal tablet, oral spray, or sublingual oral formulation. For example, a mouthwash may be prepared by incorporating the desired amount of active ingredient into an appropriate solvent, such as a sodium borate solution (Dobell's solution). Alternatively, the active ingredient may be incorporated into an oral solution, such as one containing sodium borate, glycerol, and potassium bicarbonate, or dispersed in a toothpaste, or added to a composition that may include water, a binder, an abrasive, a flavoring agent, a foaming agent, and a humectant in a therapeutically effective amount. Alternatively, the composition may be prepared in tablet or solution form, which may be placed under the tongue or otherwise dissolved in the mouth.

[0356] Additional formulations suitable for other digestive tract administration methods include suppositories. Suppositories are solid dosage forms of various weights and shapes, usually containing drugs, for insertion into the rectum. After insertion, the suppository softens, melts or dissolves in the cavity liquid. In general, for suppositories, traditional carriers may include, for example, polyalkylene glycols, triglycerides or combinations thereof. In certain embodiments, suppositories may be formed from a mixture containing, for example, an active ingredient in the range of about 0.5% to about 10%, and preferably about 1% to about 2%.

[0357] B. Parenteral Compositions and Formulations

[0358] In a further embodiment, the composition can be administered by a parenteral route. As used herein, the term "parenteral" includes routes that bypass the digestive tract. Specifically, the pharmaceutical compositions disclosed herein can be administered, for example but not limited to, intravenously, intradermally, intramuscularly, intraarterially, intravenously, intrathecally, intraventricularly, intratumorally, subcutaneously, or intraperitoneally, U.S. Patent Nos. 6,613,308; 5,466,468; 5,543,158; 5,641,515; and 5,399,363 (each of which is expressly incorporated herein by reference in its entirety).

[0359] In some embodiments, the solution containing the cells and active compounds of the present disclosure can provide the active compounds as free alkali or pharmacologically acceptable salts, which can be prepared by proper mixing with a surfactant (e.g., hydroxypropylcellulose) in water. Dispersions can also be prepared in glycerol, liquid polyethylene glycol, and mixtures thereof, and oils. Under normal storage and use conditions, these preparations contain preservatives to prevent the growth of microorganisms. Suitable drug forms for injection include sterile aqueous solutions or dispersions and sterile powders for temporary preparation of sterile injection solutions or dispersions (U.S. Patent No. 5,466,468, which is incorporated herein by reference in its entirety). In all cases, the form must be sterile and must be fluid for ease of injection. It must be stable under manufacturing and storage conditions, and must prevent the contamination of microorganisms (e.g., bacteria and fungi). The carrier can be a solvent or a dispersion medium, such as containing water, ethanol, a polyol (i.e., glycerol, propylene glycol, and liquid polyethylene glycol, etc.), a suitable mixture thereof, and / or a vegetable oil. Appropriate fluidity can be maintained by using a coating (e.g., lecithin), maintaining the desired particle size in the case of a dispersion, and by using a surfactant. The prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be desirable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be achieved by the use in the compositions of agents delaying absorption, for example, aluminum monostearate and gelatin.

[0360] For parenteral administration in aqueous solution, for example, if necessary, the solution should be properly buffered, and the liquid diluent should first be made isotonic with enough saline or glucose. These specific aqueous solutions are particularly suitable for intravenous, intramuscular, subcutaneous and intraperitoneal administration. In this regard, those skilled in the art will understand the usable sterile aqueous medium according to the present disclosure. For example, a dose can be dissolved in an isotonic NaCl solution, then a subcutaneous perfusion solution is added or injected into a predetermined infusion site (for example, referring to "Remington's Pharmaceutical Sciences" 15th Edition, pages 1035-1038and 1570-1580). According to the condition of the subject being treated, some changes will inevitably occur in the dosage. The person responsible for administration will determine the dosage suitable for individual subjects in any case. In addition, for human administration, the preparation should meet the sterility, pyrogenicity, general safety and purity standards of the FDA Office of Biological Products standards.

[0361] By adding the cells of the present disclosure and any optional active compound in the desired amount together with the various other ingredients listed above (as required) in an appropriate solvent, then adopting appropriate filtering methods and / or sterilization methods (e.g., filtration sterilization) to prepare sterile injection solutions. Typically, dispersions are prepared by adding various sterilized active ingredients to a sterile carrier, which contains a basic dispersion medium and other ingredients required from those listed above. For sterile powders for the preparation of sterile injection solutions, preferred preparation methods are vacuum drying and freeze drying techniques, which produce powders of active ingredients plus any additional required ingredients from previously sterile filtered solutions. The powdered composition is combined with a liquid carrier (e.g., water or saline solution), with or without the addition of a stabilizer.

[0362] C. Various pharmaceutical compositions and preparations

[0363] In other specific embodiments of the present disclosure, active compound compositions comprising cells of the present disclosure can be formulated for administration by a variety of routes, such as topical (ie, transdermal) administration, mucosal administration (intranasal, vaginal, etc.), and / or inhalation.

[0364] Pharmaceutical compositions for topical application may include active compounds formulated for pharmaceutical applications, such as ointments, pastes, creams or powders. Ointments include all oily, absorbent, emulsions and water-soluble compositions for topical application, while creams and lotions are compositions that only include emulsion bases. Topical drugs may contain penetration enhancers to promote the absorption of active ingredients through the skin. Suitable penetration enhancers include glycerol, alcohol, alkyl methyl sulfoxides, pyrrolidones and lauryl azone. Possible bases for topical application compositions include polyethylene glycol, lanolin, cold cream and vaseline and any other suitable absorption, emulsification or water-soluble ointment bases. Topical preparations may also include emulsifiers, gelling agents and antimicrobial preservatives as needed to preserve active ingredients and provide a uniform mixture. Transdermal application of the present invention may also include the use of "patches". For example, patches may supply one or more active substances at a predetermined rate and in a continuous manner over a fixed period of time.

[0365] In certain embodiments, the pharmaceutical composition can be delivered by eye drops, intranasal sprays, inhalation and / or other aerosol delivery vehicles. The method of delivering the composition directly to the lungs by nasal aerosol sprays has been described in U.S. Patents No. 5,756,353 and 5,804,212 (each incorporated herein by reference in its entirety). Similarly, the use of intranasal microparticle resins (Takenaga et al., 1998) and lysophosphatidylglycerol compounds (U.S. Patent No. 5,725,871, hereby incorporated by reference in its entirety) to deliver drugs is also well known in the pharmaceutical field. Similarly, U.S. Patent No. 5,780,045 (herein incorporated by reference in its entirety) describes transmucosal drug delivery in the form of a polytetrafluoroethylene support matrix.

[0366] The term aerosol refers to a colloidal system of finely dispersed solid or liquid particles dispersed in a liquefied or pressurized gas propellant. Typical aerosols of the present invention for inhalation will consist of a suspension of active ingredients in a liquid propellant or a mixture of a liquid propellant and a suitable solvent. Suitable propellants include hydrocarbons and hydrocarbon ethers. Suitable containers will vary depending on the pressure requirements of the propellant. The use of aerosols will vary depending on the age, weight, and severity and response of the symptoms of the experimenter.

[0367] VI. Combination therapy

[0368] In certain embodiments, the compositions and methods of the present embodiments relate to a combination of cells of the present disclosure (e.g., previously inactivated and cryopreserved, subsequently thawed and reactivated NK cells) with at least one additional therapy. Additional therapy may be radiotherapy, surgery (e.g., lumpectomy and mastectomy), chemotherapy, gene therapy, DNA therapy, virotherapy, RNA therapy, immunotherapy, bone marrow transplantation, nanotherapy, monoclonal antibody therapy, or a combination of the foregoing. Additional therapy may be in the form of adjuvant therapy or neoadjuvant therapy.

[0369] In some embodiments, additional therapy is the administration of small molecule enzyme inhibitors or anti-metastatic agents. In some embodiments, additional therapy is the administration of side effect limiters (e.g., agents intended to reduce the occurrence and / or severity of the side effects of treatment, such as anti-nausea agents, etc.). In some embodiments, additional therapy is chemotherapy. In some embodiments, additional therapy is radiotherapy. In some embodiments, additional therapy is surgery. In some embodiments, additional therapy is a combination of radiotherapy and surgery. In some embodiments, additional therapy is gamma irradiation. In some embodiments, additional therapy is targeted PBK / AKT / mTOR pathway therapy, HSP90 inhibitors, tubulin inhibitors, apoptosis inhibitors and / or chemopreventive agents. Additional therapy can be one or more chemotherapeutic agents known in the art.

[0370] In some embodiments, patients can be treated with the compositions and methods of the present disclosure (e.g., NK cells that were previously expanded, inactivated, cryopreserved, and subsequently thawed) and then undergo chemotherapy. In some embodiments, patients can be treated with the compositions and methods of the present disclosure simultaneously with chemotherapy. In some embodiments, patients can be treated with chemotherapy and then treated with the compositions and methods of the present disclosure. In some embodiments, patients can be treated with cyclophosphamide and / or fludarabine and then treated with the compositions and methods of the present disclosure. In some embodiments, patients can be treated with a dosage level of about 300 mg / m 2 Cyclophosphamide and dose levels of approximately 30 mg / m 2 In some embodiments, the patient may first be treated with fludarabine at a dose level of about 300 mg / m 2 Cyclophosphamide and dose levels of approximately 30 mg / m 2 The patient is treated with the compositions and methods of the present disclosure 48 hours after the last cyclophosphamide and fludarabine administration for three days. In some embodiments, the patient treated according to aspects of the present disclosure is treated for renal cell carcinoma, glioblastoma, mesothelioma, and / or osteosarcoma.

[0371] Can be relative to other cancer therapy (such as immune checkpoint therapy) before, during, after or in various combinations of immune cell therapy (for example, including the cell of the present disclosure and / or in addition to the cell of the present disclosure).Application interval can be from simultaneously to several minutes to several days to several weeks.In the embodiment in which immune cell therapy is provided to the patient separately with other therapeutic agents, it is generally ensured that there is no significant time period between the time of each delivery, so that the two compounds will still be able to play a combined effect that is beneficial to the patient.In such a case, it is expected that antibody therapy and anticancer therapy can be provided to patients within about 12 to 24 or 72 hours each other, more specifically within about 6-12 hours each other.In some cases, it may be expected that the treatment time will be significantly extended, wherein a few days (2,3,4,5,6 or 7) to several weeks (1,2,3,4,5,6,7 or 8) pass between each administration.

[0372] Various combinations can be used. For the following example, immune cell therapy is "A", and anti-cancer therapy is "B":

[0373] A / B / AB / A / BB / B / AA / A / BA / B / BB / A / AA / B / B / BB / A / B / B

[0374] B / B / B / AB / B / A / BA / A / B / BA / B / A / BA / B / B / AB / B / A / A

[0375] B / A / B / AB / A / A / BA / A / A / BB / A / A / AA / B / A / AA / A / B / A

[0376] Administration of any compound or therapy of the present embodiments to a patient will follow general protocols for administration of such compounds, taking into account the toxicity, if any, of the agent. Thus, in some embodiments, there is a step of monitoring toxicity due to the combination therapy.

[0377] A. Chemotherapy

[0378] According to an embodiment of the present invention, a variety of chemotherapeutic agents can be used. The term "chemotherapy" refers to the use of drugs to treat cancer. "Chemotherapeutic agent" is used to represent a compound or composition used in the treatment of cancer. These agents or drugs are classified according to their intracellular activity mode (e.g., whether they affect the cell cycle and at what stage the cell cycle is affected). Alternatively, agents can be characterized based on their ability to directly cross-link DNA, insert DNA, or induce chromosome and mitotic aberrations by affecting nucleic acid synthesis.

[0379] Examples of chemotherapeutic agents include alkylating agents, such as thiotepa and cyclophosphamide; alkyl sulfonates, such as busulfan, improsulfan, and piposulfan; aziridines, such as benzodopa, carboquone, meturedopa, and uredopa; ethyleneimines and methylamelamines, including altretamine, triethylenemelamine, and melamine. , trietylenephosphoramide, triethiylenethiophosphoramide and trimethylolomelamine; acetogenins (particularly bullatacin and bullatacinone); camptothecins (including the synthetic analog topotecan); bryostatin; callystatin; CC-1065 (including its adolesin derivatives); zelesin, carzelesin and bizelesin synthetic analogs); cryptophycin (particularly cryptophycin 1 and cryptophycin 8); dolastatin; duocarmycin (including synthetic analogs KW-2189 and CB1-TM1); eleutherobin; pancratistatin; sarcodictyin; spongistatin; nitrogen mustards, such as chlorambucil, naphthalene mustard, and chloramphenicol. aphazine, cholophosphamide, estramustine, ifosfamide, mechlorethamine, mechlorethamine oxide hydrochloride, melphalan, novembichin, phenesterine, prednimustine, trofosfamide, and uracil mustard;Nitrosoureas, such as carmustine, chlorozotocin, fotemustine, lomustine, nimustine and ranimnustine; antibiotics, such as enediyne antibiotics (e.g., calicheamicins, particularly calicheamicin gamma II and calicheamicin omega II); dynemicins, including dynemicin A; bisphosphonates, such as clodronate; esperamicin; and neocarcinogen chromophores and related chromoprotein enediyne antibiotics. Chromophores, aclacinomysin, actinomycin, authrarnycin, azaserine, bleomycins, cactinomycin, carabicin, carminomycin, carzinophilin, chromomycinis, dactinomycin, daunorubicin, detorubicin, 6-diazo-5-oxo-L-norleucine, doxorubicin doxorubicin (including morpholino-doxorubicin, cyanomorpholino-doxorubicin, 2-pyrrolino-doxorubicin, and deoxydoxorubicin), epirubicin, esorubicin, idarubicin, marcellomycin, mitomycins such as mitomycin C, mycophenolic acid, nogalarnycin, olivomycins, peplomycin, potfiromycin, puromycin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, quercetin, lamycin, rodorubicin, streptonigrin, streptozocin, tubercidin, ubenimex, zinostatin, and zorubicin; antimetabolites such as methotrexate and 5-fluorouracil (5-FU); folate analogs such as leucovorin, pteropterin, and trimetrexate; purine analogs such as fludarabine, 6-mercaptopurine, thiopurine, and thioguanine;Pyrimidine analogs such as cyclocytidine, azacitidine, 6-azauridine, carmofur, cytarabine, dideoxyuridine, doxifluridine, enocitabine, and floxuridine; androgens such as calusterone, dromostanolone propionate, epitiostanol, mepitiostane, and testolactone; adrenal antistagnation drugs such as mitotane and trilostane; folic acid supplements such as folinic acid; aceglatone; aldophosphamide glycosides; androgens such as oxadiazine, dapoxetine, dapoxetine, and dapoxetine. glycoside; aminolevulinic acid; eniluracil; amsacrine; bestrabucil; bisantrene; edatraxate; defofamine; demecolcine; diaziquone; elfornithine; elliptinium acetate; epothilone; etoglucid; gallium nitrate; hydroxyurea; lentinan; lonidainine; maytansinoids, such as maytansine and ansamitocins; mitoguazone; mitoxantrone; mopidanmol; nitraerine; pentostatin; phenamet; pirarubicin; losoxantrone; podophyllinic acid acid; 2-ethylhydrazines; methylbenzylhydrazine; PSK polysaccharide complex; razoxane; rhizoxin; sizofiran; spirogermanium; tenuazonic acid; triazinon; 2,2',2"-trichlorotriethylamine; trichothecenes (especially T-2 toxin, mucin A, baculosporin A, and anguidine); urethan; vindesine; dacarbazine; mannomustine; dibromomannitol; dibromodulanol; pipobroman;gacytosine; cytarabine ("Ara-C"); cyclophosphamide; taxanes such as paclitaxel and docetaxel gemcitabine; 6-thioguanine; mercaptopurine; platinum coordination complexes such as cisplatin, oxaliplatin, and carboplatin; vinblastine; platinum; etoposide (VP-16); ifosfamide; mitoxantrone; vincristine; vinorelbine; novantrone; teniposide; edatrexate; daunorubicin; aminopterin; xeloda; ibandronic acid salts; irinotecan (e.g. CPT-11); topoisomerase inhibitor RFS2000; difluoromethylornithine (DMFO); retinoids, such as retinoic acid; capecitabine; carboplatin, procarbazine, plicomycin, gemcitabine, navelbine, farnesyl protein transferase inhibitors, transplatinum and pharmaceutically acceptable salts, acids or derivatives of any of the above. ;

[0380] B. Radiation therapy

[0381] Other factors that cause DNA damage and have been widely used include the directional delivery of commonly known gamma rays, X-rays and / or radioisotopes to tumor cells. Other forms of DNA damaging factors may also be considered, such as microwaves, proton beam irradiation (USPs 5,760,395 and 4,870,287) and UV irradiation. Most likely, all of these factors affect extensive damage to DNA, DNA precursors, DNA replication and repair, and chromosome assembly and maintenance. The dosage range of X-rays ranges from daily doses of 50 to 200 roentgens for a long time (3-4 weeks) to single doses of 2000 to 6000 roentgens. The dosage range of radioisotopes varies widely and depends on the half-life of the isotope, the intensity and type of the irradiation emitted, and the absorption of tumor cells.

[0382] C. Immunotherapy

[0383] Those skilled in the art will appreciate that other immunotherapies may be combined or used in conjunction with the methods of the embodiments. In the context of cancer treatment, immunotherapy generally relies on the use of immune effector cells and molecules to target and destroy cancer cells. Rituximab is such an example. Immune effectors can be, for example, antibodies that are specific to certain markers on the surface of tumor cells. A single antibody can serve as an effector of therapy, or it can recruit other cells to actually affect cell killing. Antibodies can also be conjugated to drugs or toxins (chemotherapeutic agents, radionuclides, ricin A chain, cholera toxin, pertussis toxin, etc.) and used as targeting agents. Alternatively, effectors can be lymphocytes that carry surface molecules that interact directly or indirectly with tumor cell targets. Various effector cells include cytotoxic T cells and NK cells.

[0384] Antibody-drug conjugates have emerged as a breakthrough approach to developing cancer therapeutics. Cancer is one of the leading causes of death worldwide. Antibody-drug conjugates (ADCs) comprise a monoclonal antibody (MAb) covalently linked to a cytocidal drug. This approach combines the high specificity of a MAb for its antigenic target with a highly potent cytotoxic drug, resulting in an “armed” MAb that delivers its payload (drug) to tumor cells that have abundant levels of antigen. Targeted delivery of the drug also minimizes its exposure to normal tissues, thereby reducing toxicity and improving the therapeutic index. Two ADC drugs approved by the FDA (in 2011) (brentuximab vedotin) and the 2013 (Trastuzumab Emtansine or T-DM1) validated this approach. Currently, there are more than 30 ADC drug candidates in various stages of clinical trials for cancer treatment (Leal et al., 2014). As antibody engineering and linker-payload optimization become more mature, the discovery and development of new ADCs increasingly rely on the identification and validation of new targets suitable for this approach and the generation of targeted MAbs. Two criteria for ADC targets are upregulated / high levels of expression in tumor cells and robust internalization.

[0385] In one aspect of immunotherapy, tumor cells must carry some markers that are easy to target, i.e., they are not present on most other cells. There are many tumor markers, and in the context of embodiments of the present invention, any of these tumor markers may be suitable for targeting. Common tumor markers include CD19, CD20, CA-125, carcinoembryonic antigen, tyrosinase (p97), gp68, TAG-72, HMFG, sialylated Lewis antigens, MucA, MucB, PLAP, laminin receptor, erbB and p155. An optional aspect of immunotherapy is to combine anticancer effects with immunostimulatory effects. There are also immunostimulatory molecules, including: cytokines, such as IL-2, IL-4, IL-12, GM-CSF, γ-IFN, chemokines, such as MIP-1, MCP-1, IL-8 and growth factors, such as FLT3 ligand.

[0386] Examples of immunotherapies currently under investigation or in use are immune adjuvants, such as Mycobacterium bovis, Plasmodium falciparum, dinitrochlorobenzene, and aromatic compounds (U.S. Pat. Nos. 5,801,005 and 5,739,169; Hui and Hashimoto, 1998; Christodoulides et al., 1998); cytokine therapy, such as interferon α, β, and γ, IL-1, GM-CSF, and TNF (Bukowski et al., 1998; Davidson et al., 1998; Hellstrand et al., 1998); gene therapy, such as TNF, IL-1, IL-2, and p53 (Qin et al., 1998; Austin-Ward and 5,830,880 and 5,846,945); and monoclonal antibodies, such as anti-CD20, anti-ganglioside GM2, and anti-p185 (Hollander, 2012; Hanibuchi et al., 1998; U.S. Pat. No. 5,824,311). It is contemplated that one or more anti-cancer therapies may be used with the antibody therapies described herein.

[0387] In some embodiments, the immunotherapy may be an immune checkpoint inhibitor. Immune checkpoints turn up signals (e.g., co-stimulatory molecules) or turn down signals. Inhibitory immune checkpoints that may be targeted by immune checkpoint blockade include adenosine A2A receptor (A2AR), B7-H3 (also known as CD276), B and T lymphocyte attenuator (BTLA), cytotoxic T lymphocyte-associated protein 4 (CTLA-4, also known as CD152), indoleamine 2,3-dioxygenase (IDO), killer cell immunoglobulin (KIR), lymphocyte activation gene 3 (LAG3), programmed death 1 (PD-1), T cell immunoglobulin domain and mucin domain 3 (TIM-3), and V-domain Ig inhibitor of T cell activation (VISTA). In particular, immune checkpoint inhibitors target the PD-1 axis and / or CTLA-4.

[0388] Immune checkpoint inhibitors can be drugs, such as small molecules, recombinant forms of ligands or receptors, or in particular antibodies, such as human antibodies (e.g., International Patent Publication WO2015016718; Pardoll, Nat Rev Cancer, 12(4):252-64, 2012; both are incorporated herein by reference). Known inhibitors of immune checkpoint proteins or their analogs can be used, and in particular chimeric, humanized or human forms of antibodies can be used. As will be known to the skilled person, alternative and / or equivalent names can be used for certain antibodies mentioned in the present disclosure. In the context of the present disclosure, such alternative and / or equivalent names are interchangeable. For example, lambrolizumab is also known as alternative and equivalent names MK-3475 and pembrolizumab.

[0389] In some embodiments, a PD-1 binding antagonist is a molecule that inhibits the binding of PD-1 to its ligand binding partner. In a specific aspect, the PD-1 ligand binding partner is PDL1 and / or PDL2. In another embodiment, a PDL1 binding antagonist is a molecule that inhibits the binding of PDL1 to its binding partner. In a specific aspect, the PDL1 binding partner is PD-1 and / or B7-1. In another embodiment, a PDL2 binding antagonist is a molecule that inhibits the binding of PDL2 to its binding partner. In a specific aspect, the PDL2 binding partner is PD-1. The antagonist can be an antibody, an antigen binding fragment thereof, an immunoadhesin, a fusion protein or an oligopeptide. Exemplary antibodies are described in U.S. Patent Nos. US8735553, US8354509 and US8008449, all of which are incorporated herein by reference. Other PD-1 axis antagonists for use in the methods provided herein are known in the art, for example, as described in U.S. Patent Application Nos. US20140294898, US2014022021, and US20110008369, all of which are incorporated herein by reference.

[0390] In some embodiments, the PD-1 binding antagonist is an anti-PD-1 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody). In some embodiments, the anti-PD-1 antibody is selected from nivolumab, pembrolizumab, and CT-011. In some embodiments, the PD-1 binding antagonist is an immunoadhesin (e.g., an immunoadhesin comprising an extracellular or PD-1 binding portion of PDL1 or PDL2 fused to a constant region (e.g., an Fc region of an immunoglobulin sequence). In some embodiments, the PD-1 binding antagonist is AMP-224. Nivolumab (also known as MDX-1106-04, MDX-1106, ONO-4538, BMS-936558 and ) is an anti-PD-1 antibody described in WO2006 / 121168, pembrolizumab (also known as MK-3475, Merck3475, lambrolizumab, and SCH-900475) is an anti-PD-1 antibody described in WO2009 / 114335. CT-011 (also known as hBAT or hBAT-1) is an anti-PD-1 antibody described in WO2009 / 101611. AMP-224 (also known as B7-DCIg) is a PDL2-Fc fusion soluble receptor described in WO2010 / 027827 and WO2011 / 066342.

[0391] Another immune checkpoint that can be targeted in the methods provided herein is cytotoxic T lymphocyte-associated protein 4 (CTLA-4), also referred to as CD152. The Genbank accession number of the complete cDNA sequence of human CTLA-4 is L15006. CTLA-4 is found on the surface of T cells and acts as a "close" switch when combined with CD80 or CD86 on the surface of antigen presenting cells. CTLA4 is a member of the immunoglobulin superfamily, which is expressed on the surface of helper T cells and transmits inhibitory signals to T cells. CTLA4 is similar to T cell co-stimulatory protein CD28, and both molecules are combined with CD80 and CD86 (also referred to as B7-1 and B7-2, respectively) on antigen presenting cells. CTLA4 transmits inhibitory signals to T cells, while CD28 transmits stimulatory signals. Intracellular CTLA4 is also present in regulatory T cells and may be important for their function. T cell activation by T cell receptors and CD28 leads to increased expression of CTLA-4 (inhibitory receptor for B7 molecules).

[0392] In some embodiments, the immune checkpoint inhibitor is an anti-CTLA-4 antibody (e.g., a human antibody, a humanized antibody, or a chimeric antibody), an antigen-binding fragment thereof, an immunoadhesin, a fusion protein, or an oligopeptide.

[0393] Anti-human-CTLA-4 antibodies (or VH and / or VL domains derived therefrom) suitable for use in the methods of the present invention can be produced using methods well known in the art. Alternatively, art-recognized anti-CTLA-4 antibodies can be used. For example, anti-CTLA-4 antibodies disclosed in US8,119,129, WO01 / 14424, WO98 / 42752; WO00 / 37504 (CP675,206, also known as tremelimumab; formerly known as tesimumab), U.S. Pat. No. 6,207,156; Hurwitz et al. (1998) Proc Natl Acad Sci USA 95(17):10067-10071; Camacho et al. (2004) J Clin Oncology 22(145):Abstract No.2505 (antibody CP-675206); and Mokyr et al. (1998) Cancer Res 58:5301-5304 can be used in the methods disclosed herein. The teachings of each of the above publications are incorporated herein by reference. Antibodies that compete with any of these art-recognized antibodies for binding to CTLA-4 can also be used. For example, humanized CTLA-4 antibodies are described in International Patent Application Nos. WO2001014424, WO2000037504, and U.S. Patent No. 8,017,114; all of which are incorporated herein by reference.

[0394] An exemplary anti-CTLA-4 antibody is ipilimumab (also known as 10D1, MDX-010, MDX-101 and ) or antigen-binding fragments and variants thereof (see, e.g., WO 01 / 14424). In other embodiments, the antibody comprises the heavy and light chain CDRs or VRs of ipilimumab. Thus, in one embodiment, the antibody comprises the CDR1, CDR2, and CDR3 domains of the VH region of ipilimumab, and the CDR1, CDR2, and CDR3 domains of the VL region of ipilimumab. In another embodiment, the antibody competes for binding to the same epitope on CTLA-4 as the above-mentioned antibodies and / or binds to the same epitope on CTLA-4 as the above-mentioned antibodies. In another embodiment, the antibody has at least about 90% variable region amino acid sequence identity with the above-mentioned antibodies (e.g., at least about 90%, 95%, or 99% variable region identity with ipilimumab).

[0395] Other molecules for modulating CTLA-4 include CTLA-4 ligands and receptors, such as described in U.S. Pat. Nos. US5844905, UA5885796, and International Patent Application Nos. WO1995001994 and WO1998042752; all incorporated herein by reference, and immunoadhesins, such as described in U.S. Pat. No. 8329867, incorporated herein by reference.

[0396] D. Surgery

[0397] Approximately 60% of cancer patients will undergo some type of surgery, including preventive, diagnostic or staging, curative, and palliative surgery. Curative surgery includes resection (in which all or part of the cancerous tissue is physically removed, excised, and / or destroyed) and may be used in conjunction with other therapies (e.g., treatment of the present embodiment, chemotherapy, radiation therapy, hormone therapy, gene therapy, immunotherapy, and / or alternative therapy). Tumor resection refers to the removal of at least a portion of a tumor. In addition to tumor resection, surgical treatments also include laser surgery, cryosurgery, electrosurgery, and microscopically controlled surgery (Mohs surgery).

[0398] After removing part or all of the cancer cells, tissues or tumors, a cavity may be formed in the body. Treatment may be accomplished by perfusing, directly injecting or topically applying other anti-cancer therapies to the area. For example, this treatment may be repeated every 1, 2, 3, 4, 5, 6 or 7 days, or every 1, 2, 3, 4 and 5 weeks, or every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 months. These treatments may also have different dosages.

[0399] E. Other medicines

[0400] It is expected that other agents can be used in combination with certain aspects of this embodiment to improve the efficacy of treatment. These additional agents include agents that affect the upregulation of cell surface receptors and GAP connections, cell growth inhibitors and differentiation agents, cell adhesion inhibitors, agents that increase the sensitivity of overproliferation cells to apoptosis inducing agents or other biological agents. Increasing intercellular signal transduction by increasing the number of GAP connections will increase the anti-overproliferation effect on neighboring overproliferation cell groups. In other embodiments, cell growth inhibitors or differentiation agents can be used in combination with certain aspects of this embodiment to improve the anti-overproliferation efficacy of treatment. It is expected that inhibitors of cell adhesion can improve the efficacy of embodiments of the present invention. Examples of cell adhesion inhibitors are focal adhesion kinase (FAK) inhibitors and lovastatin. It is further considered that other agents (such as antibody c225) that increase the sensitivity of overproliferation cells to apoptosis can be used in combination with certain aspects of the present embodiment of the invention to improve the therapeutic efficacy.

[0401] VII. Preparation or Kit

[0402] A product or kit is provided, which includes a cryopreservation medium or its components and optionally immune cells. The product or kit may also include a package insert containing instructions for using cryopreservation and / or immune cells to treat or delay individual cancer progression or enhance the immune function of individuals suffering from cancer. Any cryopreservation medium components described herein and optionally antigen-specific immune cells may be included in the product or kit. Suitable containers include, for example, bottles, vials, bags, and syringes. The container may be formed of a variety of materials, such as glass, plastics (such as polyvinyl chloride or polyolefins) or metal alloys (such as stainless steel or Hastelloy). In some embodiments, the container retains the preparation and the label on the container or associated with the container may indicate instructions for use. The product or kit may also include other materials needed from a commercial and user perspective, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use. In some embodiments, the product also includes one or more other agents (for example, chemotherapeutic agents and anti-tumor agents). Suitable containers for one or more agents include, for example, bottles, vials, bags, and syringes.

[0403] In some embodiments, a kit is provided, which may include, for example, cells (e.g., NK cells) of the present disclosure, optionally one or more culture media and components for producing the cells, one or more inactivating agents, etc. In some embodiments, the preparation may include a mixture of multiple factors, including a form suitable for combination with NK cells. The reagent system or any kit component may be packaged in an aqueous medium or lyophilized form, as appropriate. The container device of the kit generally includes at least one vial, test tube, flask, bottle, syringe or other container device, in which the components may be placed, and preferably appropriately packaged. If there are multiple components in the kit, the kit generally also includes a second, third or other additional container, in which the additional components may be placed separately. However, a combination of various components may be included in the vial. The components of the kit may be provided in dry powder form. When the reagent and / or component are provided in dry powder form, the powder may be reconstituted by adding a suitable solvent. It is conceivable that the solvent may also be provided in another container device. The kit generally also includes a device for sealing the kit components for commercial sale. Such containers may include injection molded or blow molded plastic containers, in which the required vials are retained. The kit may also include instructions for use, for example in printed or electronic format, such as digital format.

[0404] In certain embodiments, the kit may include one or more cytokines, including at least IL-12, IL-15, IL-18 and / or IL-2, particularly including concentrations described elsewhere herein. The kit may include any type of culture medium, any cryopreservation medium component, as described elsewhere herein. The kit may include cord blood (including pooled cord blood), any type of antigen presenting cells, beads for depleting specific NK cells (as described herein), vectors encoding one or more proteins described herein, NK cells, inactivators, antibodies or reagents for producing antibodies, etc.

[0405] Individual components may also be provided in concentrated amounts in the kit; in some embodiments, the concentration of a component provided alo...

Claims

1. A method for inactivating natural killer (NK) cells, comprising: The NK cells are treated with an effective amount of one or more inactivating agents under conditions that produce inactivated NK cells.

2. The method of claim 1, wherein the inactivating agent is a kinase inhibitor.

3. The method of claim 1 or 2, wherein the inactivating agent is a mechanistic target of rapamycin (mTOR) inhibitor.

4. The method of claim 2 or 3, wherein the mTOR inhibitor is rapamycin, everolimus and / or temsirolimus.

5. The method of any one of claims 2-4, wherein the mTOR inhibitor is rapamycin.

6. The method of claim 1 or 2, wherein the inactivating agent is a tyrosine kinase (TK) inhibitor.

7. The method of claim 6, wherein the TK inhibitor is dasatinib, nilotinib, lorlatinib, brigatinib, ceritinib, alectinib, crizotinib, bosutinib, ponatinib, saracatinib, imatinib, zanubrutinib, acalabrutinib, ibrutinib, capmatinib, pesidatinib, dacomitinib, osimertinib, erlotinib, gefitinib, lapatinib, afatinib, pemigatinib, erdatinib, nilotinib, Danib, gilteritinib, midostaurin, tucatinib, neratinib, baricitinib, ruxolitinib, fedratinib, tofacitinib, ripretinib, selumetinib, binitinib, cobimetinib, trametinib, upadacitinib, afatinib, seratinib, cabozantinib, fostamatinib, larotrectinib, entrectinib, axitinib, regorafenib, pazopanib, sorafenib, lenvatinib, vandetanib, and / or sunitinib.

8. The method of claim 6 or 7, wherein the TK inhibitor is a BCR-Abl inhibitor.

9. The method of any one of claims 6-8, wherein the TK inhibitor is dasatinib, nilotinib, bosutinib, ponatinib and / or imatinib.

10. The method of any one of claims 6-9, wherein the TK inhibitor is dasatinib and / or nilotinib.

11. The method of any one of claims 6-10, wherein the TK inhibitor is nilotinib.

12. The method of any one of claims 6-10, wherein the TK inhibitor is dasatinib.

13. The method of any one of claims 1-12, wherein the treatment is at any time point during the culturing of the NK cells.

14. The method of any one of claims 1-13, wherein the treatment lasts from about 24 to about 96 hours, from about 36 to about 84 hours, or from about 48 to about 72 hours.

15. The method of any one of claims 1-14, wherein the treatment lasts for about 24 hours, about 48 hours, or about 72 hours.

16. The method of any one of claims 1-15, wherein the treatment lasts for about 24 hours.

17. The method of any one of claims 1-16, wherein the NK cells are treated with the inactivating agent at a concentration of about 1 to about 2000 nM.

18. The method of any one of claims 1-17, wherein the NK cells are treated with the inactivating agent at a concentration of about 5 to about 100 nM.

19. The method of any one of claims 1-18, wherein the NK cells are treated with the inactivating agent at a concentration of about 20 to about 500 nM.

20. The method of any one of claims 1-19, wherein the NK cells are treated with the inactivating agent at a concentration of about 30 to about 200 nM.

21. The method of any one of claims 1-16, wherein the NK cells are treated with the inactivating agent at a final concentration of about 0.01 μM to about 10 μM.

22. The method of any one of claims 1-16 or 21, wherein the NK cells are treated with the inactivating agent at a final concentration of about 0.02 μM to about 5 μM.

23. The method of any one of claims 1-16 or 21-22, wherein the NK cells are treated with the inactivating agent at a final concentration of about 0.05 μM to about 3 μM.

24. The method of any one of claims 1-16 or 21-23, wherein the NK cells are treated with the inactivating agent at a final concentration of about 1 μM.

25. The method of any one of claims 1-24, wherein the cells are washed after inactivation.

26. The method of any one of claims 1-25, wherein relative to activated NK cells, the inactivated NK cells have increased expression of one or more of C-kit, CCR-5, CD62L and / or CXCR4, and / or decreased expression of one or more of NKG2D, DNAM, OX-40, TRAIL, HLA-DR, CD2, CD25, ICOS and / or CD95.

27. The method of any one of claims 1-26, wherein the NK cells are derived from human peripheral blood mononuclear cells (PBMC), unstimulated leukocyte separation products (PBSC), human embryonic stem cells (hESC), hematopoietic stem cells, induced pluripotent stem cells (iPSC), bone marrow, NK cell lines and / or umbilical cord blood.

28. The method of any one of claims 1-27, wherein the NK cells are isolated from blood.

29. The method of claim 28, wherein the NK cells are isolated from one or more umbilical cord blood units.

30. The method of claim 27, wherein the NK cells are induced NK cells generated from precursor cells.

31. The method of claim 30, wherein the precursor cell is a hESC, a hematopoietic stem cell, an iPSC and / or an induced hematopoietic stem cell.

32. The method of any one of claims 1-31, wherein the NK cells comprise a transgene.

33. The method of claim 32, wherein the transgene encodes a chimeric antigen receptor (CAR), a T cell receptor (TCR), a non-naturally occurring or naturally occurring variant of FcγRIII (CD16), an interleukin (e.g., interleukin 15 (IL-15), interleukin 15 receptor (IL-15R) or a variant thereof, interleukin 12 (IL-12), interleukin 21 (IL-21), interleukin 18 (IL-18), interleukin-12 receptor (IL-12R) or a variant thereof), a human leukocyte antigen (e.g., human leukocyte antigen G (HLA-G), human leukocyte antigen E (HLA-E)), a leukocyte surface antigen differentiation cluster CD47 (CD47), or any combination of two or more thereof.

34. The method of claim 33, wherein the NK cells comprise a transgenic CAR.

35. The method of claim 34, wherein the NK cells comprise more than one transgenic CAR.

36. The method of claim 34, wherein the transgenic CAR is a CD70-targeted CAR.

37. The method of claim 34, wherein the transgenic CAR is a TROP2-targeted CAR.

38. The method of claim 33, wherein the NK cells comprise a transgenic TCR.

39. The method of claim 38, wherein the transgenic TCR is a NY-ESO targeting TCR.

40. The method of any one of claims 1-39, wherein the NK cells comprise a mutation in an endogenous gene.

41. The method of claim 40, wherein the endogenous gene is an immunomodulatory gene.

42. The method of claim 40 or 41, wherein the endogenous gene is NKG2A, SIGLEC-7, LAG3, TIM3, CISH, FOXO1, TGFBR2, TIGIT, CD96, ADORA2, NR3C1, PD1, PDL-1, PDL-2, CD47, SIRPA, SHIP1, ADAM17, RPS6, 4EBP1, CD25, CD40, IL21R, ICAM1, CD95, CD80, CD86, IL10R, TDAG8, CD5, CD7, SLAMF7, CD38, LAG3, TCR, β2-microglobulin, HLA, CD73, GCR, CREM, ICER, CREB1 and / or CD39.

43. The method of any one of claims 1-42, wherein the NK cells are activated and / or expanded prior to inactivation.

44. The method of claim 43, wherein the NK cells are activated and / or expanded by culturing with a cell culture solution comprising universal antigen presenting cells (uAPC), IL-2, IL-12, IL-15 and / or IL-18.

45. The method of claim 43 or 44, wherein the NK cells are activated and / or expanded for about 5 to about 20 days, about 8 to about 17 days, about 10 to about 15 days, about 12 days, about 13 days, or about 14 days prior to inactivation.

46. ​​The method of any one of claims 1-45, wherein the inactivated NK cells are frozen and cryopreserved for any period of time.

47. The method of claim 46, wherein the inactivating agent is contained in a cryopreservation medium.

48. The method of claim 46, wherein the inactivating agent is washed away from the inactivated NK cells prior to cryopreservation.

49. The method of claim 48, wherein the inactivating agent is washed out using 0.5% HSA Plasma-Lyte A buffer.

50. A cryopreserved inactivated NK cell produced by the method of any one of claims 46-49.

51. A thawed inactivated cell produced by thawing the cryopreserved inactivated NK cell of claim 50.

52. The thawed inactivated NK cells of claim 51, wherein the thawed inactivated NK cells are washed to remove the inactivating agent.

53. The thawed inactivated NK cells of claim 51 or 52, wherein the thawed inactivated NK cells are reactivated in the absence of an inactivating agent, thereby producing reactivated NK cells.

54. The reactivated NK cells of claim 53, wherein the reactivated NK cells have an improved survival rate relative to non-inactivated thawed cryopreserved NK cells.

55. The reactivated NK cells of claim 53 or 54, wherein if the reactivated NK cells comprise a transgene, the transgene expression level is not significantly reduced relative to non-inactivated thawed cryopreserved NK cells.

56. The reactivated NK cells of claim 55, wherein the transgene expression level is increased relative to non-inactivated thawed cryopreserved NK cells.

57. The reactivated NK cells of any one of claims 53-56, wherein the reactivated NK cells have an increased tumor cell killing rate after cryopreservation relative to non-inactivated thawed cryopreserved NK cells.

58. A method of treating a subject in need thereof, comprising the step of administering to the subject a therapeutically effective amount of the reactivated NK cells of any one of claims 53-57.

59. The method of claim 58, wherein the subject has cancer.

60. The method of claim 59, wherein the cancer is a hematological cancer.

61. The method of claim 60, wherein the hematological cancer is myeloma.

62. The method of claim 59, wherein the cancer comprises a solid tumor.

63. The method of claim 62, wherein the cancer comprises ovarian cancer, pancreatic cancer, and / or brain cancer.

64. The method of claim 59, wherein the cancer is of hematopoietic origin.

65. The method of any one of claims 58-64, wherein the reactivated NK cells are allogeneic or autologous to the subject.

66. The method of any one of claims 58-65, wherein the reactivated NK cells are allogeneic to the subject.

67. The method of any one of claims 58-66, wherein the subject has an improved probability of survival relative to a subject not treated with an effective dose of reactivated NK cells.

Images