Medical preparation for treating gestational hypertension

Abstract

The invention provides a medical preparation for treating gestational hypertension, and belongs to the technical field of gynaecology and obstetrics. The medical preparation comprises shRNA capable of targeted inhibition of expression of non-coding RNA AC072062.3 and a vector for delivery of RNA interference molecules. According to the medical preparation, by inhibiting the expression of non-coding RNA AC072062.3 in placenta trophoblast cells, the multiplication capacity and invasion capacity of the placenta trophoblast cells under the anoxic condition are promoted, and then placenta blood perfusion is improved, so that the pathological state caused by gestational hypertension is relieved. Therefore, the medical preparation provided by the invention not only provides a new thought for the treatment of the gestational hypertension, but also has a better clinical application prospect, and can effectively relieve the gestational hypertension caused by insufficient placenta blood perfusion and improve the health of mothers and infants.

Description

Technical Field

[0001] The invention belongs to the technical field of obstetrics and gynecology, and in particular relates to a medical preparation for treating hypertension during pregnancy. Background Art

[0002] Hypertensive Disorders of Pregnancy (HDP) is a comprehensive disease in which pregnancy and high blood pressure coexist. As one of the common complications of pregnancy, it seriously affects the health of pregnant women and fetuses, and may lead to adverse outcomes such as placental dysfunction, fetal growth restriction, premature birth, and even maternal death. At present, the exact cause of HDP has not been fully clarified, but studies have shown that abnormal trophoblast cell function is one of the key pathological mechanisms of its onset.

[0003] Studies have shown that the dysfunction of placental trophoblast cells, especially the lack of trophoblast cell migration and invasion, is one of the important pathological bases for the occurrence of gestational hypertension. During normal pregnancy, trophoblast cells invade the maternal endometrium and its spiral arterioles to achieve placental vascular remodeling, thereby establishing effective placental perfusion and providing sufficient oxygen and nutrients for fetal development. However, in patients with gestational hypertension, the proliferation and invasion ability of trophoblast cells is significantly reduced, resulting in incomplete maternal vascular remodeling, insufficient placental perfusion and placental hypoxia. Therefore, how to effectively solve the dysfunction of placental trophoblast cells is the key to the treatment of gestational hypertension. Summary of the invention

[0004] The purpose of the present invention is to restore the function of placental trophoblast cells by targeted inhibition of the expression of non-coding RNA AC072062.3, especially to improve their proliferation and invasion ability under hypoxic conditions, thereby improving placental blood perfusion and alleviating the adverse consequences caused by gestational hypertension.

[0005] To achieve the above object, the present invention provides the following technical solutions: The present invention provides a medical preparation for treating hypertension during pregnancy, wherein the medical preparation comprises an effective component capable of targeted inhibition of the expression of non-coding RNA AC072062.3, wherein the effective component is a mixture of one or more of short hairpin RNA (shRNA), small interfering RNA (siRNA) or antisense oligonucleotide (ASO); The transcript sequence of the non-coding RNA AC072062.3 is shown in SEQ ID NO.3.

[0006] Preferably, the active ingredient is short hairpin RNA (shRNA), the sense strand sequence of the short hairpin RNA (shRNA) is shown in SEQ ID NO. 13, and the antisense strand sequence of the short hairpin RNA (shRNA) is shown in SEQ ID NO. 14. shRNA can be delivered to placental trophoblast cells to target and degrade the mRNA of AC072062.3, thereby inhibiting its expression.

[0007] Preferably, the medical preparation inhibits the expression of non-coding RNA AC072062.3 in placental trophoblast cells, promotes the proliferation and invasion ability of placental trophoblast cells under hypoxic conditions, improves placental blood perfusion, and thus alleviates the pathological state caused by gestational hypertension.

[0008] Preferably, the medical preparation further comprises a carrier for delivering RNA interference molecules, and the carrier includes a liposome, a viral vector or a nanoparticle vector. These vectors can effectively deliver RNA interference molecules to target cells to ensure their expression and function in placental trophoblast cells.

[0009] Preferably, the carrier is a liposome.

[0010] Secondly, the present invention provides a use of an inhibitor in the preparation of a medical preparation for treating gestational hypertension, wherein the inhibitor is an inhibitor that targets and inhibits the expression of non-coding RNA AC072062.3; the transcript sequence of the non-coding RNA AC072062.3 is shown in SEQ ID NO.3.

[0011] Preferably, the inhibitor is a mixture of one or more of short hairpin RNA (shRNA), small interfering RNA (siRNA) or antisense oligonucleotide (ASO).

[0012] Preferably, the inhibitor is a short hairpin RNA (shRNA), the sense strand sequence of the short hairpin RNA (shRNA) is shown as SEQ ID NO.13, and the antisense strand sequence of the short hairpin RNA (shRNA) is shown as SEQ ID NO.14.

[0013] Secondly, the present invention provides a use of an inhibitor in the preparation of a medical preparation for treating hypoxia-induced reduction in trophoblast proliferation and invasion ability, wherein the inhibitor is an inhibitor that targets and inhibits the expression of non-coding RNA AC072062.3; the transcript sequence of the non-coding RNA AC072062.3 is shown in SEQ ID NO.3; The hypoxia is caused by insufficient placental blood perfusion.

[0014] Preferably, the inhibitor is a mixture of one or more of short hairpin RNA (shRNA), small interfering RNA (siRNA) or antisense oligonucleotide (ASO).

[0015] Preferably, the inhibitor is a short hairpin RNA (shRNA), the sense strand sequence of the short hairpin RNA (shRNA) is shown as SEQ ID NO.13, and the antisense strand sequence of the short hairpin RNA (shRNA) is shown as SEQ ID NO.14.

[0016] The beneficial effects of the present invention are: The present invention finds that by targeted inhibition of the expression of non-coding RNA AC072062.3, the function of placental trophoblast cells in patients with pregnancy-induced hypertension can be effectively improved, especially their proliferation and invasion abilities under hypoxic conditions, thereby alleviating the pathological state associated with pregnancy-induced hypertension caused by insufficient placental perfusion.

[0017] The present invention avoids the broad-spectrum side effects of traditional treatment methods by precisely targeting non-coding RNA AC072062.3, can achieve more precise therapeutic effects, reduce interference with other physiological functions, and improve the safety and effectiveness of the drug.

[0018] In summary, the medical preparation provided by the present invention not only provides a new idea for the treatment of gestational hypertension, but also has a good clinical application prospect. It can effectively alleviate gestational hypertension caused by insufficient placental blood perfusion and improve the health of mothers and infants. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 To investigate the differential expression of target noncoding RNA in the serum of patients with hypertension during pregnancy (HDP) and normal pregnant women; Figure 2 Effects of hypoxia on the expression of non-coding RNA AC072062.3 (A) and the inhibitory effect of sh-AC072062.3 on the expression of non-coding RNA AC072062.3 (B); Figure 3 The effect of sh-AC072062.3 on the proliferation of trophoblast cells under hypoxic conditions; Figure 4 This is the effect of sh-AC072062.3 on the invasion ability of trophoblast cells under hypoxic conditions. DETAILED DESCRIPTION

[0020] In order to clearly illustrate the technical features of this solution, this solution is described below through specific embodiments. It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper limit and the lower limit of the range is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the range.

[0021] In recent years, the role of lncRNA in pregnancy-related diseases has gradually attracted widespread attention. However, the current research on lncRNA and pregnancy-induced hypertension (HDP) is still in its early stages, and its specific mechanism of action has not yet been fully elucidated. In-depth research on the function of lncRNA in pregnancy-induced hypertension is expected to provide a new perspective on the pathogenesis of HDP and provide an important basis for the development of early diagnostic markers and the exploration of targeted treatment strategies.

[0022] Example 1 The experimental goal of this example is to detect the expression level of the target non-coding RNA in the serum of patients with hypertension complicating pregnancy (HDP) and normal pregnant women, and to analyze the difference therebetween.

[0023] Samples in the disease group: met the diagnostic criteria for hypertensive disorders complicating pregnancy, with systolic blood pressure ≥140 mmHg and / or diastolic blood pressure >90 mmHg.

[0024] Control group samples: normotensive, systolic blood pressure <140 mmHg and / or diastolic blood pressure <90 mmHg.

[0025] The sample source of the present invention is Qilu Hospital of Shandong University. The present invention collected blood samples of 8 patients with hypertensive disorders complicating pregnancy (HDP) (disease group samples) and 8 healthy pregnant women without hypertension. After collecting venous blood, centrifugation was performed immediately to separate the supernatant, which was stored in a -80°C refrigerator for subsequent experimental use.

[0026] Experimental steps: Take 200 μL of serum and add it to 1 mL of TRIzol LS reagent, mix vigorously, let stand for 5 minutes, add 200 μL of chloroform, shake vigorously for 15 seconds, and let stand for 5 minutes. Centrifuge at 12,000×g for 15 minutes (4°C) to separate the aqueous phase. Collect the upper aqueous phase, add an equal volume of isopropanol, mix gently, and let stand for 10 minutes. Centrifuge at 12,000×g for 10 minutes (4°C) to precipitate RNA. Wash the precipitate twice with 75% ethanol, air-dry, and dissolve in 20-30 μL of RNase-free water. After determining the RNA purity and concentration, use a reverse transcription kit to synthesize cDNA.

[0027] Primer sequences were designed based on the target non-coding RNA AC003075.4 (transcript sequence SEQ ID NO.1), AF127577.11 (transcript sequence SEQ ID NO.2), AC072062.3 (transcript sequence SEQ ID NO.3), and AP001347.6 (transcript sequence SEQID NO.4): AC003075.4 Primer sequence: Upstream primer sequence: 5′- AGGAACCTGCTGGAGAAACG -3′ (SEQ ID NO. 5); Downstream primer sequence: 5'- AGAAGCTGCGAAGTTGCCTT -3', (SEQ ID NO. 6); Primer sequence AF127577.11: Upstream primer sequence: 5′- GCGCTTTGAAACTGACAGCT -3′, (SEQ ID NO. 7); Downstream primer sequence: 5′- CCAACCTGGGCAACATTTCG -3′, (SEQ ID NO. 8); AC072062.3 Primer sequence: Upstream primer sequence: 5′- GCCAAAGCTTCATGTAGAGCC -3′, (SEQ ID NO. 9); Downstream primer sequence: 5′- CAGTCACAGCTGGAAATGGC -3′, (SEQ ID NO. 10); AP001347.6 Primer sequence: Upstream primer sequence: 5′- TTCGGTGATTCTGCCACTCC -3′, (SEQ ID NO. 11); Downstream primer sequence: 5'-ACTAGATGTCTGCAGCGAGC -3', (SEQ ID NO. 12).

[0028] Reaction system (20 μL): cDNA: 2 μL, SYBR Green Mix: 10 μL, Forward primer (10 μM): 0.8 μL, Reverse primer (10 μM): 0.8 μL, ddH2O is added to 20 μL.

[0029] Reaction conditions: pre-denaturation: 95°C for 5 min; cycle: 95°C for 15 s, 60°C for 30 s, 72°C for 30 s, 40 cycles; melting curve analysis: gradual heating from 65°C to 95°C, 0.5°C per step, for 5 s.

[0030] The relative expression of target RNA was calculated using the 2^(-ΔΔCt) method, and data were analyzed using GraphPad Prism 9 software.

[0031] from Figure 1 The experimental results show that among the four non-coding RNAs detected by the present invention, there is no significant difference in the expression levels of AC003075.4, AF127577.11 and AP001347.6 in the control group and the disease group samples, which indicates that these non-coding RNAs may have little to do with the occurrence and development of hypertensive disorders complicating pregnancy (HDP). However, AC072062.3 showed significant upregulation in the disease group samples, which was statistically significant compared with the control group (P<0.05). This result suggests that AC072062.3 may play an important role in the pathological process of hypertension complicating pregnancy.

[0032] Example 2 Hypoxia caused by insufficient placental perfusion is one of the core pathophysiological mechanisms of pregnancy-induced hypertension (HDP). In response to insufficient placental perfusion, the mother compensates by peripheral vasoconstriction and increased blood volume, which directly leads to maternal hypertension. Therefore, in this embodiment, the present invention uses the decreased trophoblast capacity caused by hypoxia to explore the role of AC072062.3 in the treatment of HDP.

[0033] First, the present invention verifies the expression changes of AC072062.3 in trophoblast cells treated with hypoxia HTR-8 / Svneo cells (human chorionic trophoblast cells) were seeded into 6-well culture plates and placed in a cell culture incubator for 24 hours to allow the cells to fully adhere to the plate.

[0034] Cells were treated according to the following experimental groups: Normoxia control group: trophoblast cells were cultured under normoxic conditions (21% O2) for 48 h; Hypoxia model group: Trophoblast cells were cultured under hypoxia conditions (1% O2) for 48 h.

[0035] The RNA extraction and the detection method of non-coding RNA AC072062.3 are consistent with the steps in Example 1, so they will not be repeated in detail in this example. Three parallel experiments were set up for each treatment group.

[0036] from Figure 2 It can be seen from the results of A that, similar to the results of sample detection, hypoxia treatment can upregulate the expression of non-coding RNA AC072062.3 in HTR-8 / Svneo cells.

[0037] Then, the present invention designed and verified the shRNA of AC072062.3 The shRNA of AC072062.3 (sh-AC072062.3) was designed using BLOCK-iT™ RNAi Designer. The specific sequence is as follows: The justice chain is: 5'-CACCGGAGTGAAGCCTCTATATTACAACGGTAATATAGAGGCTTCACTCC -3', SEQ IDNO.13; The antisense strand is: 5'-AAAAGGAGTGAAGCCTCTATATTACCGTTGTAATATAGAGGCTTCACTCC -3', SEQ IDNO.14; The plasmid used was pENTR™ / U6 Vector; HTR-8 / Svneo cells (human chorionic trophoblast cells, using RPMI-1640 culture medium containing 10% fetal bovine serum) were inoculated into a 6-well culture plate and placed in a cell culture incubator for 24 hours to allow the cells to fully adhere to the wall.

[0038] Cells were treated according to the following experimental groups: Normoxia control group: Trophoblast cells were transfected with sh-NC (shRNA negative control) for 24 hours and then cultured under normoxic conditions (21% O2) for 48 hours; Hypoxia model group: Trophoblast cells were transfected with sh-NC (shRNA negative control) for 24 h and then cultured under hypoxia conditions (1% O2) for 48 h; Hypoxia treatment group: Trophoblast cells were transfected with sh-AC072062.3 for 24 h and then cultured under hypoxia (1% O2) for 48 h; Three parallel experiments were set up for each of the above treatments.

[0039] from Figure 2 The results of B show that compared with the hypoxia model group, the relative expression level of non-coding RNA AC072062.3 in the hypoxia treatment group transfected with sh-AC072062.3 was significantly reduced (P<0.05). This shows that the sh-AC072062.3 designed in the present invention can effectively inhibit the expression of AC072062.3 under the background of high expression induced by hypoxia, and has good specificity and interference efficiency.

[0040] Example 3 The above examples demonstrate that sh-AC072062.3 can effectively inhibit the expression of non-coding RNA AC072062.3 induced by hypoxia. On this basis, this example further explores the effect of inhibiting the expression of non-coding RNA AC072062.3 on the proliferation of human chorionic trophoblast cells under hypoxia.

[0041] HTR-8 / Svneo cells were seeded into 96-well plates and cultured in a cell culture incubator for 24 h to allow the cells to fully adhere to the plate.

[0042] Cells were treated according to the following experimental groups: Normoxia control group: Trophoblast cells were transfected with sh-NC (shRNA negative control) for 24 hours and then cultured under normoxic conditions (21% O2) for 48 hours; Hypoxia model group: Trophoblast cells were transfected with sh-NC (shRNA negative control) for 24 h and then cultured under hypoxia conditions (1% O2) for 48 h; Hypoxia treatment group: Trophoblast cells were transfected with sh-AC072062.3 for 24 h and then cultured under hypoxia (1% O2) for 48 h; Five parallel experiments were set up for each of the above treatments.

[0043] After treatment, 10 μL of CCK-8 reagent was added to each well, and the 96-well plate was placed in a 37°C incubator and incubated for 2 h.

[0044] The absorbance (OD value) was read using a microplate reader at a wavelength of 450 nm, and the OD values ​​of each group were compared to evaluate the cell proliferation level.

[0045] Table 1 Differences in absorbance between different treatment groups

[0046] Combining Table 1 and Figure 3 From the absorbance difference, it can be seen that the cell proliferation level was significantly reduced under hypoxic conditions (OD value decreased from 0.893 to 0.512), indicating that hypoxia has a significant inhibitory effect on cell proliferation.

[0047] The OD value of the hypoxia treatment group (0.766) was significantly higher than that of the hypoxia control group (0.512), indicating that transfection of sh-AC072062.3 could partially alleviate the inhibition of cell proliferation caused by hypoxia.

[0048] At the same time, further observation of the data revealed that although sh-AC072062.3 significantly promoted cell proliferation under hypoxic conditions, its proliferation level was still lower than that of the normoxic control group (0.893), indicating that the effect of sh-AC072062.3 was partial recovery, rather than complete reversal of the effects of hypoxia. Therefore, it can be explored in the future to combine it with other drugs to achieve a better therapeutic effect on gestational hypertension.

[0049] Example 4 The reduced trophoblast cell invasion ability caused by hypoxia is also an important cause of insufficient placental blood flow, which in turn causes maternal hypertension. Therefore, this example further explores the effect of inhibiting the expression of non-coding RNA AC072062.3 on the invasion of human chorionic trophoblast cells under hypoxia.

[0050] HTR-8 / Svneo cells were seeded into 6-well plates and placed in a cell culture incubator for 24 h to allow the cells to fully adhere to the plate.

[0051] HTR-8 / Svneo cells were transfected with sh-NC and sh-AC072062.3, respectively. 24 hours after inoculation, the cells were digested and prepared into a cell suspension, and the cell concentration was adjusted to 2 × 10^5 cells / mL.

[0052] The Transwell chambers were placed in different 24-well plates, and Matrigel was diluted with serum-free medium at a ratio of 1:8 and coated on the filter membrane of the Transwell chambers. The mixture was incubated at 37°C for 1 hour until solidified.

[0053] Cells were treated according to the following experimental groups: In the normoxic control group, 200 μL of cell suspension transfected with sh-NC was added to the upper chamber of the Transwell chamber, and complete medium (600 μL) containing 10% fetal bovine serum was added to the lower chamber as a chemoattractant, and the cells were cultured under normoxic conditions (21% O2) for 48 h; In the hypoxia control group, 200 μL of cell suspension transfected with sh-NC was added to the upper chamber of the Transwell chamber, and complete culture medium (600 μL) containing 10% fetal bovine serum was added to the lower chamber as a chemoattractant, and the cells were cultured under hypoxic conditions (1% O2) for 48 h; In the hypoxia treatment group, 200 μL of cell suspension transfected with sh-AC072062.3 was added to the upper chamber of the Transwell chamber, and complete culture medium (600 μL) containing 10% fetal bovine serum as a chemoattractant was added to the lower chamber, and the cells were cultured under hypoxic conditions (1% O2) for 48 h.

[0054] After treatment, the chamber contents were removed and the uninvaded cells on the upper membrane were gently wiped with a cotton swab.

[0055] The chamber was fixed in 4% paraformaldehyde for 15 min and washed three times with PBS.

[0056] The sections were stained with 0.1% crystal violet for 15 min and washed three times with PBS.

[0057] Five fields of view were randomly selected under a microscope, and the number of cells passing through the filter membrane was counted and photographed for record.

[0058] from Figure 4 The results show that compared with the normoxic control group, the number of cell invasions in the hypoxic model group was significantly reduced, indicating that the hypoxic environment has a significant inhibitory effect on the invasive ability of human chorionic trophoblast cells. This result verifies that hypoxic conditions significantly inhibit the invasive behavior of trophoblast cells.

[0059] Further comparison of the data of the hypoxia model group and the hypoxia treatment group showed that after inhibiting the expression of non-coding RNA AC072062.3, the invasive ability of trophoblast cells was significantly enhanced, and the number of transmembrane cells increased significantly. This shows that non-coding RNA AC072062.3 in hypoxic environment is one of the key factors affecting the invasive ability of trophoblast cells. By targeting and inhibiting the expression of AC072062.3, the invasive ability of trophoblast cells under hypoxic conditions can be effectively restored.

[0060] In summary, the results of this study indicate that hypoxic environment inhibits the proliferation and invasion of human chorionic trophoblast cells, while inhibition of non-coding RNA AC072062.3 can reverse this inhibitory effect to a large extent, thus providing a new therapeutic strategy for improving placental blood perfusion and alleviating gestational hypertension.

Claims

1. A medical preparation for treating hypertension complicating pregnancy, characterized in that: The medical preparation comprises an effective ingredient capable of targeted inhibition of the expression of non-coding RNA AC072062.3, wherein the effective ingredient is a mixture of one or more of short hairpin RNA (shRNA), small interfering RNA (siRNA) or antisense oligonucleotide (ASO); The transcript sequence of the non-coding RNA AC072062.3 is shown in SEQ ID NO.

3.

2. The medical preparation according to claim 1, characterized in that The active ingredient is short hairpin RNA (shRNA), the sense strand sequence of the short hairpin RNA (shRNA) is shown in SEQ ID NO.13, and the antisense strand sequence of the short hairpin RNA (shRNA) is shown in SEQ ID NO.

14.

3. The medical preparation according to claim 2, characterized in that The medical preparation inhibits the expression of non-coding RNA AC072062.3 in placental trophoblast cells, promotes the proliferation and invasion ability of placental trophoblast cells under hypoxic conditions, improves placental blood perfusion, and thus alleviates the pathological state caused by gestational hypertension.

4. The medical preparation according to claim 3, characterized in that The medical preparation further comprises a carrier for delivering the RNA interference molecule, wherein the carrier comprises a liposome, a viral vector or a nanoparticle vector.

5. Use of an inhibitor in the preparation of a medical preparation for treating hypertension complicating pregnancy, characterized in that: The inhibitor is an inhibitor that targets and inhibits the expression of non-coding RNA AC072062.3; the transcript sequence of the non-coding RNA AC072062.3 is shown in SEQ ID NO.

3.

6. The use according to claim 5, characterized in that The inhibitor is a mixture of one or more of short hairpin RNA (shRNA), small interfering RNA (siRNA) or antisense oligonucleotide (ASO).

7. The use according to claim 6, characterized in that The inhibitor is a short hairpin RNA (shRNA), the sense strand sequence of the short hairpin RNA (shRNA) is shown in SEQ ID NO.13, and the antisense strand sequence of the short hairpin RNA (shRNA) is shown in SEQ ID NO.

14.

8. Use of an inhibitor in the preparation of a medical preparation for treating hypoxia-induced reduction in trophoblast proliferation and invasion ability, characterized in that: The inhibitor is an inhibitor that targets and inhibits the expression of non-coding RNA AC072062.3; the transcript sequence of the non-coding RNA AC072062.3 is shown in SEQ ID NO.3; The hypoxia is caused by insufficient placental blood perfusion.

9. The use according to claim 8, characterized in that The inhibitor is a mixture of one or more of short hairpin RNA (shRNA), small interfering RNA (siRNA) or antisense oligonucleotide (ASO).

10. The use according to claim 9, characterized in that The inhibitor is a short hairpin RNA (shRNA), the sense strand sequence of the short hairpin RNA (shRNA) is shown in SEQ ID NO.13, and the antisense strand sequence of the short hairpin RNA (shRNA) is shown in SEQ ID NO.14.

Images