Acinetobacter pichi LGC1-1 and application thereof in prevention and treatment of pepper vein mottle virus

Abstract

The invention discloses acinetobacter piceli LGC1-1 and an application of the acinetobacter piceli LGC1-1 in prevention and treatment of a pepper vein mottle virus. The acinetobacter piceli LGC1-1 (Acinetobacter sp.LGC1-1) is preserved in the China Center for Type Culture Collection on November 13, 2024, and the preservation number of the acinetobacter piceli LGC1-1 is CCTCC (China Center for Type Culture Collection) NO: M 20242552. The inhibition rate of the acinetobacter picei LGC1-1 on the chilli vein mottle virus ChiVMV reaches up to 85.9%, the inhibition rate of a conventional agent ningnanmycin on the chilli vein mottle virus ChiVMV is only 48.6%, it is indicated that the passivation effect of the acinetobacter picei LGC1-1 on the chilli vein mottle virus ChiVMV is outstanding, the control effect of the acinetobacter picei LGC1-1 is far higher than that of the conventional agent ningnanmycin, and the acinetobacter picei LGC1-1 has a good application prospect. Moreover, the acinetobacter pichi LGC1-1 is a screened natural virus inoculated bacterium, has no pollution to the environment, and does not destroy the biological diversity.

Description

Technical Field

[0001] The invention relates to the technical field of biological control, and in particular to Acinetobacter pilosella LGC1-1 and application thereof in preventing and controlling pepper vein mottle virus. Background Art

[0002] Chilli veinal mottle virus (ChiVMV) belongs to the Potyvirus genus of the Potyviridae family and is one of the main virus species of Solanaceae crops, which seriously harms the production of Solanaceae crops. ChiVMV mainly harms peppers, and it was first reported in China in 2011 that it also harms tobacco production. Tobacco plants infected with ChiVMV show punctate necrosis of leaves, perforation of tobacco leaves before harvest, and local necrosis, which seriously affects the quality of tobacco leaves after curing. In more serious cases, the leaves are deformed and the leaf stems are systematically necrotic, eventually leading to the death of the plant.

[0003] Viruses are obligate intracellular parasites. Once a tobacco plant is infected, there is no effective drug to completely control it in production. Therefore, screening natural microbial antagonists to prevent and control crop virus diseases meets the national green prevention and control development needs and reduces the pollution of chemical pesticides to the soil and environment. Summary of the invention

[0004] The invention provides an Acinetobacter pilosula LGC1-1 and an application thereof in preventing and controlling pepper vein mottle virus in order to screen natural microbial antagonists for preventing and controlling pepper vein mottle virus and reduce the pollution of chemical pesticides to soil and environment.

[0005] The present invention achieves the above-mentioned purpose through the following technical solutions:

[0006] The present invention provides an Acinetobacter pekinensis LGC1-1, Acinetobacter sp.LGC1-1. The living pure culture of the Acinetobacter pekinensis LGC1-1 (Acinetobacter sp, named as Acinetobacter pekinensis LGC1-1 / Acinetobacter sp.LGC1-1) has been registered and preserved in the China Center for Type Culture Collection, the preservation time is November 13, 2024, the preservation address is No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, Wuhan University, and the preservation number is CCTCC NO: M20242552.

[0007] The Acinetobacter pilosella LGC1-1 has a milky white round colony with neat edges, a smooth surface, and opaque protrusions. Gram staining proves that the bacterium belongs to Gram-negative bacteria. During purification culture, a spread plate method is used on NA medium (beef extract 3.0 g / L, sucrose 10.0 g / L, peptone 5.0 g / L, yeast extract 1.0 g / L, agar 15.0 g / L, pH=7.1) and cultured at 28°C for 24 hours.

[0008] The 16S rDNA sequence of the Acinetobacter pekinensis LGC1-1 is shown in SEQ ID NO.1.

[0009] The amplification primers for the 16S rDNA sequence of the Acinetobacter pekinensis LGC1-1 are:

[0010] SEQ ID NO.2: F-P0: GAGAGTTTGATCCTGGCTCAG;

[0011] SEQ ID NO. 3: R-P6: CTACGGCTACCTTGTTACGA.

[0012] The present invention also provides an application of Acinetobacter sp. LGC1-1 in preventing and treating pepper vein mottle virus. The Acinetobacter sp. LGC1-1 is used as an antagonistic strain to inhibit the infection of pepper vein mottle virus ChiVMV.

[0013] The beneficial effect of the present invention is that the inhibition rate of the Acinetobacter pekinensis LGC1-1 on pepper vein mottle virus ChiVMV is as high as 85.9%, and the inhibition rate of the conventional agent Ningnanmycin on pepper vein mottle virus ChiVMV is only 48.6%, indicating that the passivation effect of Acinetobacter pekinensis LGC1-1 on pepper vein mottle virus ChiVMV is outstanding, which is much higher than the prevention effect of the conventional agent Ningnanmycin, and Acinetobacter pekinensis LGC1-1 is a natural virus-linked antibacterial screened out, which has no pollution to the environment and will not destroy biodiversity. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is a colony morphology diagram of Acinetobacter pilosicarius LGC1-1 of the present invention;

[0015] Figure 2 This is a comparison chart (tobacco leaves) of the inactivation effects of the Acinetobacter pilosella LGC1-1 of the present invention and the conventional antiviral agent Ningnanmycin on pepper vein mottle virus (ChiVMV). DETAILED DESCRIPTION

[0016] The present application is further described in detail below in conjunction with the accompanying drawings. It is necessary to point out here that the following specific implementation methods are only used to further illustrate the present application and cannot be understood as limiting the scope of protection of the present application. Technical personnel in this field can make some non-essential improvements and adjustments to the present application based on the above application content.

[0017] 1. Materials

[0018] 1. Acinetobacter sp. LGC1-1 (Acinetobacter sp., named as Acinetobacter sp. LGC1-1 / Acinetoba cter sp. LGC1-1). The live pure culture of Acinetobacter sp. LGC1-1 has been registered and preserved in the China Center for Type Culture Collection. The preservation time is November 13, 2024. The preservation address is Wuhan University, No. 299, Bayi Road, Wuchang District, Wuhan City, Hubei Province, and the preservation number is CCTCC NO: M 20242552.

[0019] The methods used in this example are conventional methods known to those skilled in the art unless otherwise specified, and the reagents and other materials used are commercially available products unless otherwise specified.

[0020] 2. Methods

[0021] 2.1 Preparation of Acinetobacter pilosicola LGC1-1:

[0022] 1. Sampling: In the tobacco field where mosaic disease has occurred, select healthy tobacco plants and select the rhizosphere soil of the tobacco plants at a depth of 20 cm from the roots of the tobacco plants for later use;

[0023] 2. Grinding: Place 10g of the reserved soil in a sterilized Erlenmeyer flask, add 20ml of sterile water, shake until the liquid becomes turbid, let stand at room temperature for 10 minutes, and set aside;

[0024] 3. Purification: 200 μL of the liquid supernatant after standing was sucked with a sterile pipette tip, and the plate method was used on NA medium (beef extract 3.0 g / L, sucrose 10.0 g / L, peptone 5.0 g / L, yeast extract 1.0 g / L, agar 15.0 g / L, pH = 7.1), and cultured at 28°C for 24 hours. After the colonies grew on the separation plate, the isolated single colonies were picked out one by one with an inoculation loop according to the morphology, size, surface structure, edge structure, texture, gloss, transparency, color and soluble pigments produced by the microbial colonies. The single colonies with different morphologies were picked out and streaked on the corresponding blank NA medium plates for purification, and inverted incubator at 28°C for 24 hours to obtain the purified strains for standby use;

[0025] like Figure 1As shown, the milky white round colonies of Acinetobacter pilosicola LGC1-1 have neat edges, smooth surfaces, and opaque protrusions. Gram staining proves that the bacteria belong to Gram-negative bacteria. The pathogen DNA was extracted using Wizard genomic DNA purification kit (Promega, Madison, WI).

[0026] The primers for amplification of 16S rDNA sequences are:

[0027] SEQ ID NO.2: F-P0: GAGAGTTTGATCCTGGCTCAG;

[0028] SEQ ID NO. 3: R-P6: CTACGGCTACCTTGTTACGA.

[0029] PCR amplification was performed using the above primers, and the PCR amplification reaction system was 50 μL (10×PCR buffer 5 μL, dNTP 1 μL, P0 2 μL, P6 2 μL, Tag enzyme 1 μL, template DNA 2 μL, dd H2O 37 μL).

[0030] The PCR amplification conditions were: 94℃5min; 94℃30s, 55℃1min, 72℃90s, 30 cycles; 72℃1min; 10℃20min. The 16SrDNA gene sequencing results of the strain were compared with BLAST software on the NCBI website, and the biocontrol bacteria were preliminarily identified as Acinetobacter sp.

[0031] 4. Screening: Select a single bacterial colony and place it in a sterilized 100 ml conical flask containing 20 ml of culture medium. Culture it with shaking (28°C, 200 r / min) for 24 hours to ensure that the bacterial liquid content is large enough to serve as a fermentation strain.

[0032] 2.2 Infection inhibition test of pepper vein mottle virus ChiVMV:

[0033] Nicotiana tabacum var.samsun NN has an allergic necrosis reaction to the pepper vein mottle virus ChiVMV. In this experiment, the half-leaf method was used to determine the inhibition rate of ChiVMV infection by Acinetobacter pilosula LGC1-1. Specifically, the young leaves of the ChiVMV virus source that are fully diseased are ground and filtered with distilled water at a ratio of 1:10 (mass to volume) and used as virus test samples. The virus test sample is mixed with an equal volume of liquid NA culture medium, and after 30 minutes, the left half leaf of Nicotiana tabacum var.samsun is rubbed (from the front of the leaf, the same below) as a control. The LGC1-1 to be tested is mixed with an equal volume of the virus sample, and after 30 minutes, it is rubbed and inoculated on the right half leaf of Nicotiana tabacum as a treatment. In the same way, the treatment and control of Ningnanmycin (purchased from Chengdu Jiaye Biotechnology Co., Ltd.) are set.

[0034] After the necrosis spots appeared, the number of necrosis spots on the left and right half leaves was recorded. The experiment was repeated three times, and three leaves were inoculated on each tobacco plant. The number of necrosis spots on the left and right half leaves and the inhibition rate are shown in the following table:

[0035]

[0036] The inhibition rate was calculated by the following formula: inhibition rate (%) = [(number of control necrosis spots - number of treated necrosis spots) / number of control necrosis spots] × 100%, and the evaluation was performed based on the average inhibition rate.

[0037] From the data in the table, it can be seen that the antagonistic effect of Acinetobacter pilosula LGC1-1 on ChiVMV is significantly better. The results of three repeated tests showed that the inhibition rate of LGC1-1 fermentation liquid on ChiVMV was as high as 85.9%, while the inhibition rate of conventional Ningnanmycin on pepper vein mottle virus ChiVMV was only 48.6%. The specific control effect is shown in Figure 2 .

[0038] The above-mentioned embodiments only express several implementation methods of the present invention, and the description thereof is relatively specific and detailed, but it cannot be understood as limiting the scope of the present invention. It should be pointed out that, for ordinary technicians in this field, several variations and improvements can be made without departing from the concept of the present invention, which all belong to the protection scope of the present invention.

Claims

1. A Acinetobacter sp. LGC1-1, characterized in that: The Acinetobacter pilosula LGC1-1 was deposited in the China Center for Type Culture Collection on November 13, 2024, with the deposit number CCTCC NO: M20242552.

2. The Acinetobacter pilosula LGC1-1 according to claim 1, characterized in that The 16S rDNA sequence of the Acinetobacter pekinensis LGC1-1 is shown in SEQ ID NO.

1.

3. The Acinetobacter pilosicola LGC1-1 according to claim 2, characterized in that: The amplification primers for the 16S rDNA sequence of the Acinetobacter pekinensis LGC1-1 are: SEQ ID NO.2: F-P0: GAGAGTTTGATCCTGGCTCAG; SEQ ID NO. 3: R-P6: CTACGGCTACCTTGTTACGA.

4. A use of Acinetobacter pilosella LGC1-1 as claimed in any one of claims 1 to 3 in preventing and treating pepper vein mottle virus, characterized in that: The Acinetobacter pekinensis LGC1-1 is used as an antagonistic strain to inhibit the infection of pepper vein mottle virus ChiVMV.

Images