Mutant monoamine oxidase and application thereof in synthesis of chiral amine compound

Abstract

The invention provides mutant monoamine oxidase and application thereof in synthesis of chiral amine compounds. Specifically, the invention provides monoamine oxidase or a mutant thereof capable of efficiently catalyzing a desymmetric oxidation reaction of 3-azabicyclo [3.3. 0] octane. The monoamine oxidase or the mutant of the monoamine oxidase can be used for efficiently catalyzing 3-azabicyclo [3.3. 0] octane to be subjected to desymmetric oxidation to form (3S, 7R)-3-azabicyclo [3.3. 0] octyl-2-ene, so that the monoamine oxidase or the mutant of the monoamine oxidase can be used for producing chiral amines such as telaprevir intermediates or other chiral amine precursors.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and specifically relates to mutant monoamine oxidase and application thereof in synthesizing chiral amine compounds. Background Art

[0002] Chiral amines are an important class of pharmaceutical intermediates and are often used as resolving agents, catalysts, and synthetic precursors of active drugs in the chemical and pharmaceutical industries.

[0003] Due to the chiral amine structure and biological specificity, chiral amine building blocks are also widely present in various active natural products and synthetic drugs, such as Telaprevir, Nirmatrelvir and Boceprevir, etc. The structure is shown below:

[0004]

[0005] Among them, Telaprevir (trade name Incivek) is a first-generation NS3 / 4A serine protease inhibitor developed by Vertex Pharmaceuticals, Inc., and approved for marketing by the U.S. Food and Drug Administration on May 23, 2011. It is an anti-hepatitis C virus drug. This compound is a reversible protease inhibitor that can be used in combination with pegylated interferon α and ribavirin to treat chronic hepatitis C. It is suitable for patients who have not received interferon drug treatment or have not responded to previous drug treatment.

[0006] It can be seen from the structural formula that the precursor structure of the chiral amine module in the compound is derived from (3S,7R)-3-azabicyclo[3.3.0]octane-2-carboxylic acid methyl ester, and the structure is shown below:

[0007]

[0008] The chemical synthesis route of this intermediate is relatively complicated. It uses tetrahydrofuran as a substrate, undergoes Grignard reaction and iodination reaction, and then undergoes intramolecular cyclization under the catalysis of boron fluoride to form a bicyclic skeleton, and then undergoes a series of oxidation reactions to finally obtain 3-azabicyclo[3.3.0]octane-2-carboxylic acid hydrobromide. This reaction route is costly and has low safety.

[0009] Patent WO2008090819 discloses a simpler three-step synthesis method, but its starting material O-(N-benzylproline)amino(phenyl)methyleneiminoacetate-N,N,N-nickel(II) (Ni-BPB-Gly) is difficult to obtain and is not suitable for large-scale industrial production.

[0010] Compared with chemical synthesis, the use of bio-enzyme catalysis to synthesize chiral amine compounds is a more economical and environmentally friendly production strategy. Monoamine oxidase (MAO, EC 1.4.3.4) is a class of enzymes that can oxidize amine compounds to form corresponding imine substances, and has a high substrate breadth. This type of enzyme uses molecular oxygen as an oxidant to selectively oxidize a series of chiral amines, mediating the deracemization of simple chiral primary, secondary and tertiary amines. In the racemic amine substrate, monoamine oxidase only selectively oxidizes one of the enantiomers to form an imine, and forms a certain enantiomer under the reduction of a reducing agent. With the cycle of the reaction, the substrate can eventually be completely deracemized.

[0011] Therefore, there is an urgent need in this field to continue to explore highly active monoamine oxidases from other species and to find effective ways to obtain monoamine oxidases with better activity, wider substrate affinity and that meet the requirements of industrial production. Summary of the invention

[0012] The purpose of the present invention is to provide a monoamine oxidase mutant with better activity, higher substrate broadness and meeting the requirements of industrial production, as well as a construction method and application thereof.

[0013] In a first aspect of the present invention, a monoamine oxidase mutant is provided, wherein the monoamine oxidase mutant has the activity of catalyzing the desymmetric oxidation of 3-azabicyclo[3.3.0]octane to form (3S,7R)-3-azabicyclo[3.3.0]oct-2-ene, and has a mutation selected from the following group:

[0014] (a) based on the amino acid sequence shown in SEQ ID NO: 1, glutamine (Gln) at position 239 is replaced by leucine (Leu);

[0015] (b) The glycine (Gly) at position 375 in the amino acid sequence shown in SEQ ID NO: 2 is replaced with aspartic acid (Asp).

[0016] In another preferred embodiment, the monoamine oxidase mutant is selected from the following group:

[0017] (a1) a Q239L mutant of the wild-type monoamine oxidase shown in SEQ ID No: 1, or

[0018] (b1) G375D mutant based on the wild-type monoamine oxidase shown in SEQ ID No:2.

[0019] The second aspect of the present invention provides an isolated polynucleotide encoding the monoamine oxidase mutant described in the first aspect of the present invention.

[0020] The third aspect of the present invention provides a vector, wherein the vector contains the polynucleotide described in the second aspect of the present invention.

[0021] The fourth aspect of the present invention provides a genetically engineered host cell, wherein the host cell contains the vector described in the third aspect of the present invention, or the polynucleotide described in the second aspect of the present invention is integrated into its genome.

[0022] The fifth aspect of the present invention provides a use of the monoamine oxidase mutant described in the first invention of the present invention, which is used to catalyze the synthesis of chiral amine compounds, or to prepare a catalytic preparation for catalyzing the synthesis of chiral amine compounds.

[0023] In a sixth aspect of the present invention, there is provided a method for catalyzing the desymmetric oxidation of 3-azabicyclo[3.3.0]octane, comprising:

[0024] (a) 3-azabicyclo[3.3.0]octane is oxidized in the presence of monoamine oxidase to form (3S,7R)-3-azabicyclo[3.3.0]oct-2-ene:

[0025]

[0026] Wherein, the monoamine oxidase is selected from the following group:

[0027] (i) the monoamine oxidase mutant according to the first invention of the present invention;

[0028] (ii) a wild-type monoamine oxidase having an amino acid sequence as shown in any one of SEQ ID Nos: 1 to 3;

[0029] (iii) Any combination of (i) and (ii) above.

[0030] In another preferred embodiment, the method further comprises:

[0031] (b) reacting (3S,7R)-3-azabicyclo[3.3.0]oct-2-ene with NaHSO3 in an inert solvent to form sodium (3S,7R)-3-azabicyclo[3.3.0]octane-2-sulfonate:

[0032]

[0033] In another preferred embodiment, the method is used to prepare (3S, 7R)-3-azabicyclo[3.3.0]octane-2-sulfonate, wherein the reaction is as shown in reaction formula Q2:

[0034]

[0035] In another preferred embodiment, the monoamine oxidase is presented in the form of microbial cells expressing the monoamine oxidase.

[0036] In another preferred embodiment, the step (a) has one or more characteristics selected from the following group:

[0037] (Y1) The amount of monoamine oxidase used is 200-300 g / L of cell homogenate (based on wet cells);

[0038] (Y2) is carried out at a pH of about 7.0 to 8.0;

[0039] (Y3) carried out under shaking or stirring conditions;

[0040] (Y4) The reaction temperature is 10-35°C, preferably 20-30°C, and more preferably 26±2°C.

[0041] It should be understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features specifically described below (such as embodiments) can be combined with each other to form a new or preferred technical solution. Due to space limitations, they will not be described one by one here. BRIEF DESCRIPTION OF THE DRAWINGS

[0042] Figure 1 The monoamine oxidase phylogenetic tree analysis is shown, wherein the monoamine oxidase marked with "★" is the monoamine oxidase of the present invention.

[0043] Figure 2 A plasmid map for expressing the monoamine oxidase of the present invention is shown.

[0044] Figure 3 Gas chromatographic detection profiles of product and substrate standards are shown.

[0045] Figure 4 The detection diagram of the extracted products of Aw52 enzyme reaction solution is shown.

[0046] Figure 5 The sequence alignment of AlMAO, AwMAO and AbMAO is shown.

[0047] Figure 6 A sequence alignment of AlMAO and MAON401 is shown.

[0048] Figure 7 A sequence alignment of AwMAO and MAON401 is shown.

[0049] Figure 8 A sequence alignment of AbMAO and MAON401 is shown. DETAILED DESCRIPTION

[0050] After extensive and in-depth research, the inventor unexpectedly obtained three monoamine oxidases with high catalytic activity that can be used to produce specific chiral amine compounds through a large number of screenings. Specifically, the inventor obtained three wild-type monoamine oxidases with potential catalytic activity by screening wild-type and mutant enzymes from a variety of microbial sources, and then obtained mutants with higher enzyme activity by mining, random mutation and site-directed mutation of the monoamine oxidase gene. The monoamine oxidase or its mutant in the present invention can efficiently catalyze the desymmetric oxidation reaction of 3-azabicyclo[3.3.0]octane. The present invention was completed on this basis.

[0051] Specifically, the inventors have artificially synthesized the coding sequences of monoamine oxidases that may have catalytic activity from various species through studies on the sequence, structure and activity of monoamine oxidases, and verified their activity through heterologous expression. Among the many candidate monoamine oxidases, three wild-type monoamine oxidases AlMAO (derived from Aspergillus luchuensis), AwMAO (derived from Aspergillus welwitschiae) and AbMAO (derived from Aspergillus brasiliensis) showed excellent catalytic activity in forming chiral amine compounds. Furthermore, the inventors also used error-prone PCR to construct a random mutation library, randomly mutated the wild-type monoamine oxidase, screened the mutants and performed sequencing analysis, and obtained mutants Al33 and Aw52 with better catalytic activity.

[0052] Protein of the present invention and its coding sequence

[0053] As used herein, the terms "enzyme of the present invention", "polypeptide of the present invention" or "monoamine oxidase of the present invention" are used interchangeably and refer to monoamine oxidase of the present invention, including monoamine oxidase AlMAO (derived from A. luchuensis), AwMAO (derived from A. welwitschiae) and AbMAO (derived from A. brasiliensis) and active derivatives thereof. It should be understood that the term includes wild-type and mutant monoamine oxidases (e.g., derivative polypeptides derived from monoamine oxidase).

[0054] The wild-type monoamine oxidase and the gene encoding the wild-type monoamine oxidase provided by the present invention are derived from Aspergillus luchuensis, Aspergillus welwitschiae or Aspergillus brasiliensis. The wild-type monoamine oxidase has an amino acid sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3, which are respectively referred to as AlMAO, AwMAO and AbMAO in the present invention.

[0055] As used herein, the terms "mutant monoamine oxidase" and "monoamine oxidase mutant" are used interchangeably. The terms "mutant monoamine oxidase of the present invention" and "mutant of the present invention" are used interchangeably and refer to a monoamine oxidase mutant obtained by mutation based on the wild-type monoamine oxidase of the present invention.

[0056] The present invention also provides mutant monoamine oxidase and genes encoding the same. Preferably, the monoamine oxidase mutant is a mutant monoamine oxidase obtained by random mutation of SEQ ID NO: 1 or SEQ ID NO: 2. Preferably, the mutant of the present invention has one or more mutations selected from the following group:

[0057] (a) based on the amino acid sequence shown in SEQ ID NO: 1, glutamine (Gln) at position 239 is replaced by leucine (Leu);

[0058] (b) Based on the fact that the glycine (Gly) at position 375 in the amino acid sequence shown in SEQ ID NO: 2 is replaced by aspartic acid (Asp).

[0059] It should be understood that for different monoamine oxidases (e.g., the three monoamine oxidases of the present invention having the amino acid sequences shown in SEQ ID NO: 1, SEQ ID NO: 2, or SEQ ID NO: 3), the corresponding relationship between the amino acid positions can be determined by sequence alignment (blastP), for example, the 239th Gln in SEQ ID NO: 1 corresponds to the 239th Gln in SEQ ID NO: 2, which corresponds to the 239th Gln in SEQ ID NO: 3; and the 375th Gly in SEQ ID NO: 2 corresponds to the 377th Gly in SEQ ID NO: 1, which corresponds to the 377th Gly in SEQ ID NO: 3. Figure 5 ).

[0060] In a preferred embodiment, the mutant monoamine oxidase of the present invention comprises (1) Al33, whose amino acid sequence is shown in SEQ ID NO: 4; and (2) Aw52, whose amino acid sequence is shown in SEQ ID NO: 5.

[0061] The polypeptide of the present invention can be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide, preferably a recombinant polypeptide. The polypeptide of the present invention can be a naturally purified product, or a chemically synthesized product, or produced using recombinant technology from a prokaryotic or eukaryotic host (e.g., bacteria, yeast, higher plants, insects and mammalian cells). Depending on the host used in the recombinant production scheme, the polypeptide of the present invention can be glycosylated, or can be non-glycosylated. The polypeptide of the present invention may also include or not include an initial methionine residue.

[0062] The present invention also includes fragments, derivatives and analogs of the monoamine oxidase of the present invention. As used herein, the terms "fragment", "derivative" and "analog" refer to polypeptides that substantially retain the same biological function or activity as the wild-type or mutant monoamine oxidase of the present invention, i.e., have the activity of catalyzing the desymmetric oxidation reaction of 3-azabicyclo[3.3.0]octane (reaction formula Q1). The polypeptide fragment, derivative or analog of the present invention may be (i) a polypeptide having one or more conservative or non-conservative amino acid residues (preferably conservative amino acid residues) substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide formed by fusion of a mature polypeptide with another compound (such as a compound that prolongs the half-life of the polypeptide, such as polyethylene glycol), or (iv) a polypeptide formed by fusion of an additional amino acid sequence to the polypeptide sequence (such as a leader sequence or secretory sequence or a sequence used to purify the polypeptide (such as 6His) or a proprotein sequence, or a fusion protein formed with an antigen IgG fragment). Based on the teachings herein, these fragments, derivatives and analogs are well within the scope known to those skilled in the art.

[0063] In the present invention, the term "monoamine oxidase of the present invention" refers to a polypeptide of any sequence in SEQ ID NO: 1-5 having the monoamine oxidase activity of the present invention. The term also includes variant forms of any sequence in SEQ ID NO: 1-5 having the same function as the monoamine oxidase of the present invention. These variant forms include (but are not limited to): deletion, insertion and / or substitution of one or more (usually 1-50, preferably 1-30, more preferably 1-20, and most preferably 1-10) amino acids, and addition of one or several (usually within 20, preferably within 10, and more preferably within 5) amino acids at the C-terminus and / or N-terminus. For example, in the art, when substitution is made with amino acids with similar or similar properties, the function of the protein is usually not changed. For another example, adding one or several amino acids at the C-terminus and / or N-terminus usually does not change the function of the protein. The term also includes active fragments and active derivatives of the monoamine oxidase of the present invention.

[0064] The present invention also provides analogs of the monoamine oxidase of the present invention. The difference between these analogs and the monoamine oxidase of the present invention may be a difference in the amino acid sequence, or a difference in the form of modification that does not affect the sequence, or both. These polypeptides include natural or induced genetic variants. Induced variants can be obtained by various techniques, such as random mutagenesis by radiation or exposure to mutagens, or by site-directed mutagenesis or other known molecular biological techniques. Analogs also include analogs with residues different from natural L-amino acids (such as D-amino acids), and analogs with non-naturally occurring or synthetic amino acids (such as β, γ-amino acids). It should be understood that the polypeptides of the present invention are not limited to the representative polypeptides listed above.

[0065] In the present invention, "the conservative variant polypeptide of monoamine oxidase of the present invention" refers to a polypeptide formed by replacing at most 10, preferably at most 8, more preferably at most 5, and most preferably at most 3 amino acids with amino acids of similar or similar properties compared to any of the amino acid sequences in SEQ ID NO: 1-5, and the conservative variant polypeptide has the same biological function or activity, i.e., has the activity of catalyzing the desymmetric oxidation reaction of 3-azabicyclo[3.3.0]octane (reaction formula Q1). These conservative variant polypeptides are preferably produced by amino acid substitution according to Table A.

[0066] Table A

[0067]

[0068]

[0069] The present invention also provides a polynucleotide encoding the monoamine oxidase of the present invention ("polynucleotide of the present invention"). The polynucleotide of the present invention can be in the form of DNA or RNA. The DNA form includes cDNA, genomic DNA or artificially synthesized DNA. The DNA can be single-stranded or double-stranded. The DNA can be a coding strand or a non-coding strand.

[0070] Taking AlMAO (derived from A. luchuensis) as an example, the coding region sequence encoding the mature polypeptide may be the same as the coding region sequence in A. luchuensis) or a degenerate variant. As used herein, "degenerate variant" refers to a nucleic acid sequence that encodes a protein having SEQ ID NO: 1 but differs from the coding region sequence in natural A. luchuensis.

[0071] The polynucleotide encoding the mature polypeptide of SEQ ID NO: 1 includes: a coding sequence encoding only the mature polypeptide; a coding sequence of the mature polypeptide and various additional coding sequences; a coding sequence of the mature polypeptide (and optional additional coding sequences) and non-coding sequences.

[0072] The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, or may include additional coding and / or non-coding sequences.

[0073] The full-length nucleotide sequence of the monoamine oxidase of the present invention or its fragments can usually be obtained by PCR amplification, recombination or artificial synthesis. For PCR amplification, primers can be designed based on the relevant nucleotide sequence, especially the open reading frame sequence, and the genome of the corresponding microorganism is used as a template to amplify the relevant sequence. When the sequence is long, it is often necessary to perform PCR amplification twice or more, and then splice the fragments amplified in each time together in the correct order.

[0074] Once the relevant sequence is obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, then transferring it into cells, and then isolating the relevant sequence from the propagated host cells by conventional methods.

[0075] At present, the DNA sequence encoding the protein of the present invention (or its fragment, or its derivative) can be obtained completely by chemical synthesis. The DNA sequence can then be introduced into various existing DNA molecules (or vectors) and cells known in the art. In addition, mutations can also be introduced into the protein sequence of the present invention by chemical synthesis.

[0076] The vector, engineering bacteria and preparation method of the present invention

[0077] The present invention also provides a vector comprising the polynucleotide of the present invention, a host cell produced by genetic engineering using the vector of the present invention or the monoamine oxidase coding sequence, and a method for producing the polypeptide of the present invention by recombinant technology.

[0078] The polynucleotide sequence of the present invention can be used to express or produce the recombinant monoamine oxidase of the present invention by conventional recombinant DNA technology (Science, 1984; 224: 1431). Generally speaking, the following steps are involved:

[0079] (1) Transforming or transducing a suitable host cell with a polynucleotide (or variant) encoding the human monoamine oxidase of the present invention, or a recombinant expression vector containing the polynucleotide;

[0080] (2) Host cells cultured in a suitable culture medium;

[0081] (3) Isolate and purify proteins from culture medium or cells.

[0082] In the present invention, the monoamine oxidase polynucleotide sequence of the present invention can be inserted into a recombinant expression vector. The term "recombinant expression vector" refers to bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenovirus, retrovirus or other vectors well known in the art. Vectors suitable for use in the present invention include, but are not limited to: T7-based expression vectors expressed in bacteria; pMSXND expression vectors expressed in mammalian cells (Lee and Nathans, J BioChem. 263: 3521, 1988) and vectors derived from baculovirus expressed in insect cells. In short, as long as they can replicate and be stable in the host, any plasmid and vector can be used. An important feature of an expression vector is that it usually contains a replication origin, a promoter, a marker gene and a translation control element.

[0083] Methods well known to those skilled in the art can be used to construct expression vectors containing the monoamine oxidase encoding DNA sequence of the present invention and appropriate transcription / translation control signals. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. (Sambroook, et al. Molecular Cloning, a Laboratory Manual, cold Spring Harbor Laboratory. New York, 1989). The DNA sequence can be effectively linked to an appropriate promoter in the expression vector to direct mRNA synthesis. Representative examples of these promoters include: lac or trp promoters of Escherichia coli; lambda phage PL promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, retroviral LTRs and other known promoters that can control gene expression in prokaryotic or eukaryotic cells or their viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

[0084] In addition, the expression vector preferably contains one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and green fluorescent protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for Escherichia coli.

[0085] The vector containing the above-mentioned appropriate DNA sequence and an appropriate promoter or control sequence can be used to transform appropriate host cells to enable them to express proteins.

[0086] Host cells can be prokaryotic cells, such as bacterial cells; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples include: Escherichia coli, Streptomyces; bacterial cells of Salmonella typhimurium; fungal cells such as yeast; plant cells; insect cells of Drosophila S2 or Sf9; animal cells such as CHO, COS, 293 cells, or Bowes melanoma cells, etc.

[0087] When the polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting factors of DNA, usually about 10 to 300 base pairs, which act on the promoter to enhance gene transcription. Examples include the SV40 enhancer of 100 to 270 base pairs on the late side of the replication origin, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.

[0088] Those skilled in the art will appreciate how to select appropriate vectors, promoters, enhancers and host cells.

[0089] Transformation of host cells with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is a prokaryotic organism such as Escherichia coli, competent cells that can absorb DNA can be harvested after the exponential growth phase and treated with the CaCl2 method, the steps used are well known in the art. Another method is to use MgCl2. If necessary, transformation can also be carried out using electroporation. When the host is a eukaryotic organism, the following DNA transfection methods can be selected: calcium phosphate coprecipitation method, conventional mechanical methods such as microinjection, electroporation, liposome packaging, etc.

[0090] The obtained transformant can be cultured by conventional methods to express the polypeptide encoded by the gene of the present invention. Depending on the host cell used, the culture medium used in the culture can be selected from various conventional culture media. Culture is carried out under conditions suitable for the growth of the host cells. After the host cells grow to an appropriate cell density, the selected promoter is induced by a suitable method (such as temperature conversion or chemical induction), and the cells are cultured for a period of time.

[0091] The recombinant polypeptide in the above method can be expressed in the cell, on the cell membrane, or secreted outside the cell. If necessary, the recombinant protein can be separated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of these methods include but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting out method), centrifugation, osmotic sterilization, ultra-treatment, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high performance liquid chromatography (HPLC) and other various liquid chromatography techniques and combinations of these methods.

[0092] In a preferred example of the present invention, the vector is a recombinant expression vector, such as an expression vector constructed based on the pET17b plasmid, in which the polynucleotide of the present invention is inserted into the multiple cloning site.

[0093] In a preferred embodiment of the present invention, the present invention provides a genetically engineered bacterium expressing the monoamine oxidase of the present invention. The genetically engineered bacterium of the present invention can satisfy the stable replication of the recombinant expression vector and the effective expression of the monoamine oxidase gene. Preferably, the genetically engineered bacterium is Escherichia coli, more preferably a genetically engineered bacterium constructed based on Escherichia coli BL21 (DE3) pLysS.

[0094] In a preferred embodiment of the present invention, a method for preparing the monoamine oxidase of the present invention is also provided. In the method of the present invention, corresponding culture medium, culture conditions and induction conditions can be used according to different host cells.

[0095] In a preferred embodiment, the host cell of the present invention is Escherichia coli. For the fermentation production of Escherichia coli, conventional culture media and culture conditions in the art can be used.

[0096] For example, a suitable fermentation medium comprises: peptone 0-20 g / L, yeast powder 0-20 g / L, glycerol 0-20 g / L, ammonium chloride 0-5 g / L, ammonium sulfate 0-5 g / L, potassium dihydrogen phosphate 0-20 g / L, magnesium sulfate heptahydrate 0-5 g / L, trace element mixture 0-5 mL / L, ampicillin 50 mg / L, defoamer 1 mL / L. Feed medium: glycerol 400 g / L, peptone 0-20 g / L, yeast powder 0-30 g / L, ammonium chloride 0-30 g / L, magnesium sulfate heptahydrate 0-10 g / L, trace element mixture 0-5 mL / L.

[0097] A suitable culture condition is: culture temperature 30-37°C, dissolved oxygen maintained at 30%, and ammonia water controlling pH 7.0.

[0098] In addition, when the engineered bacteria are induced by IPTG for expression, representative induction conditions include (but are not limited to): 600 When the temperature reaches about 20°C, the temperature is lowered to about 32°C, and IPTG is added to induce protein expression at a final concentration of about 0.1 mM. During the process, the feed rate is appropriately adjusted to meet the growth of the bacteria. Generally, when using Escherichia coli, the typical fermentation cycle is about 12-36 hours (such as 24 hours).

[0099] application

[0100] The present invention also provides the use of the monoamine oxidase of the present invention in catalyzing the formation of chiral amine compounds. Experiments show that the monoamine oxidase or its mutant provided by the present invention has excellent chiral catalytic activity and can be used for the synthesis of chiral amines or chiral amine precursors such as telaprevir intermediates.

[0101] Preferably, the present invention provides a method for biocatalyzing the desymmetric oxidation of 3-azabicyclo[3.3.0]octane using the monoamine oxidase of the present invention, wherein the reaction formula Q1 is as follows:

[0102]

[0103] In Q1, 3-azabicyclo[3.3.0]octane is used as a substrate and oxygen is used as an oxidant to form (3S,7R)-3-azabicyclo[3.3.0]octane-2-ene under the catalysis of monoamine oxidase.

[0104] The present invention also provides a method for biocatalytic synthesis of sodium (3S, 7R)-3-azabicyclo[3.3.0]octane-2-sulfonate. The reaction formula is as follows:

[0105]

[0106] In reaction formula Q1 or the first reaction of reaction formula Q2, the monoamine oxidase is the monoamine oxidase of the present invention, including purified or unpurified enzyme, immobilized enzyme, fermentation broth containing the enzyme of the present invention or microorganism encoding the enzyme of the present invention.

[0107] In a preferred embodiment, the monoamine oxidase (including wild-type or mutant monoamine oxidase) is presented in the form of microbial cells expressing the monoamine oxidase.

[0108] In the second reaction (i.e., the catalytic oxidation reaction) of reaction formula Q2, catalase can be added, and the amount of catalase used is generally 16,000 to 30,000 U / mL, preferably 24,000 U / mL; the aqueous solution is a buffer solution with a pH of about 7.0 to 8.0, preferably a pH of about 7.2-7.8, such as about 7.4; the oxidation reaction can be carried out under shaking or stirring conditions; and / or the reaction temperature of the oxidation reaction is 10 to 35°C, preferably 20 to 30°C, preferably 26±2°C.

[0109] The main advantages of the present invention include:

[0110] (1) The monoamine oxidase mutant of the present invention has a higher catalytic activity for the desymmetric oxidation reaction of 3-azabicyclo[3.3.0]octane than the corresponding wild type, and has a high substrate loading capacity during the reaction.

[0111] (2) The monoamine oxidase mutant of the present invention catalyzes the desymmetric oxidation reaction of 3-azabicyclo[3.3.0]octane with high substrate loading, high product yield and high product purity, with an optical purity of more than 99%.

[0112] (3) The desymmetric oxidation reaction of 3-azabicyclo[3.3.0]octane catalyzed by the monoamine oxidase mutant of the present invention still has high substrate conversion rate and high product yield in a large-capacity reactor on a liter scale, and has the prospect of industrial large-scale production.

[0113] The present invention will be further described below in conjunction with specific examples. It should be understood that these examples are intended to illustrate the present invention only and are not intended to limit the scope of the present invention. The experimental methods in the following examples where specific conditions are not specified are usually performed under conventional conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. Unless otherwise indicated, percentages and fractions are weight percentages and weight fractions.

[0114] Example 1: Gene synthesis of wild-type monoamine oxidase

[0115] Based on the previous research of the inventors (including bioinformatics analysis, structural analysis, etc.), 9 monoamine oxidases from different species were selected. The selected monoamine oxidases, based on the inventors' speculation, may have the function of oxidizing 3-azabicyclo[3.3.0]octane, of which 1 was selected from Trichoderma, 6 were selected from Aspergillus, 1 was selected from Penicillium, and 1 was selected from Aspergillus ( Figure 1 ).

[0116] The gene sequences of different candidate monoamine oxidases (based on the NCBI database) were synthesized, and their activities were verified by heterologous expression. Through activity screening experiments, three monoamine oxidases from Aspergillus luchuensis, Aspergillus welwitschiae and Aspergillus brasiliensis with certain catalytic activity were finally selected and labeled as AlMAO, AwMAO and AbMAO, respectively. The corresponding amino acid sequences are shown in SEQ ID No: 1, SEQ ID NO: 2 and SEQ ID NO: 3, respectively.

[0117] Taking Aspergillus yukyuensis monoamine oxidase AlMAO as an example, its amino acid sequence is shown in SEQ ID NO: 1. The amino acid sequence was submitted to Suzhou Jinweizhi Biotechnology Co., Ltd., and appropriately optimized based on the preferred codons of Escherichia coli, synthesized the corresponding coding sequence, and genetically recombined into the multiple cloning site of the commercially available vector pET17b, thereby obtaining the expression vector pET17b-AlMAO ( Figure 2 ).

[0118] In the same way, the coding sequences of Aspergillus monoamine oxidase AwMAO and Aspergillus brasiliensis monoamine oxidase AbMAO were synthesized to construct expression vectors pET17b-AwMAO and pET17b-AbMAO ( Figure 2 ).

[0119] Example 2: Construction of genetically engineered bacteria producing monoamine oxidase and determination of enzyme activity

[0120] 2.1 Construction of genetically engineered bacteria producing monoamine oxidase

[0121] The pET17b-AlMAO plasmid constructed in Example 1 was transformed into conventional Escherichia coli BL21 (DE3) pLysS competent cells, cultured overnight at 37°C on a plate containing 100 mg / L ampicillin resistance, and positive clones were screened to obtain the monoamine oxidase Escherichia coli expression strain BL21 (DE3) pLysS / pET17b-AlMAO.

[0122] The same method was used to obtain recombinant expression Escherichia coli strains BL21(DE3)pLysS / pET17b-AwMAO and BL21(DE3)pLysS / pET17b-AbMAO of monoamine oxidase AwMAO and AbMAO from Aspergillus niger and Aspergillus brasiliensis, respectively.

[0123] Pick the positive clones and inoculate them into 20 mL of liquid LB medium containing 100 mg / L ampicillin. Culture at 37°C. 600 When the cell viability was about 0.6, IPTG was added to a final concentration of 0.1 mM and induced overnight at 30°C. The cells were collected by centrifugation, frozen at -80°C for 4 h, and purified water was added to prepare a cell suspension of 200 g / L (based on wet cells) for enzyme activity detection.

[0124] 2.2 Preliminary determination of monoamine oxidase activity

[0125] 1mL enzyme reaction system: add 464μL pure water, 500μL of the above cell suspension, 20μL catalase, 12.5μL sodium bisulfite solution (200g / L), 3.5μL 3-azabicyclo[3.3.0]octane hydrochloride dissociation solution into a 10mL centrifuge tube, react at 26℃, 220rpm for 20-24h, and perform qualitative analysis of substrate residue on a TLC plate after the reaction. The developing solvent used is dichloromethane:methanol=6:1, and the color developing agent is iodine. The Rf value of the substrate is about 0.5, and the Rf value of the product is about 0.9. Observe whether there are obvious residual spots on the substrate.

[0126] The results showed that in this 1 mL enzyme reaction system, the three wild-type enzymes selected in the present invention had less substrate residues, and performed comparable to the control MAON401 mutant enzyme.

[0127] 2.3 Quantitative determination of monoamine oxidase activity

[0128] The three selected wild-type enzymes were quantitatively assayed and compared (the specific fermentation method and enzyme activity assay method are detailed in Examples 4 and 5), and the enzyme activity was characterized according to the final substrate dosage.

[0129] The results are shown in Table 1.

[0130] Table 1 Sequence alignment results of wild-type monoamine oxidase and MAON401 and experimental results of catalyzing the desymmetric oxidation of 3-azabicyclo[3.3.0]octane

[0131]

[0132] Note: The sequence alignment results of three wild-type monoamine oxidases and MAON401 are as follows Figure 6-8 shown.

[0133] As shown in Table 1, the substrate dosages of AlMAO derived from Aspergillus ryukyuensis and AwMAO derived from Aspergillus miltiorrhiza were 134.24 g and 134.78 g, respectively, which were slightly higher than AbMAO and MAON401 mutant enzymes derived from Aspergillus brasiliensis, and were therefore selected as the objects for random mutation in subsequent examples.

[0134] In addition, the enzymatic activity of AbMAO from A. brasiliensis was comparable to that of the positive control MAON401 mutant enzyme, suggesting that AbMAO also has excellent activity in catalyzing chiral amines.

[0135] Example 3: Construction of a random mutation library of monoamine oxidase

[0136] Using the pET17b-AlMAO plasmid synthesized in Example 1 as a template, primers T7-17b-F / R (Table 2) were used to generate the PCR product using the Bio-Tec QuickMutation TM The gene random mutagenesis kit was used for error-prone PCR to construct a random mutation library.

[0137] The error-prone PCR reaction system (50 μL) is: 5 μL 10×RandomMut buffer, 5 μL 10×Mutationenhancer, 5 μL 2.5 mM dNTP, 1 μL each of upstream and downstream primers, 0.5 ng of pET17b-AlMAO plasmid, and add sterile water to make up to 50 μL.

[0138] The PCR reaction program was as follows: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, 30 cycles; and final extension at 72°C for 10 min, with the product stored at 4°C.

[0139] The PCR product was purified and recovered by gel excision. At the same time, the linear pET17b vector fragment was amplified using primers 17b-OP-F / R with the pET17b blank plasmid as a template, and the recovered amplified product was digested with DpnI enzyme at 37°C for 1h. The two final fragments were seamlessly recombined using the Novozymes Rapid Cloning Kit C115, reacted at 50°C for 30min, transformed into Escherichia coli BL21 (DE3) pLysS competent cells, and cultured overnight at 37°C on a plate containing 100 mg / L ampicillin resistance.

[0140] Table 2 Primers and sequences

[0141] Primer name Primer sequence (5′→3′) SEQ ID No: T7-17b-F TAATACGACTCACTATAGGG 6 T7-17b-R GCTAGTTATTGCTCAGCGG 7 17b-OP-F ATGTATATCTCCTTCTTAAAGTTAAAC 8 17b-OP-R AAGCTTGGTACCGAGCTCGGATC 9

[0142] Pick out the grown clones and inoculate them into 20 mL of liquid LB medium containing 100 mg / L ampicillin. Culture at 37°C. 600 When the cell viability was about 0.6, IPTG was added to a final concentration of 0.1 mM and induced overnight at 30°C. The cells were collected by centrifugation, frozen at -80°C for 4 h, and purified water was added to prepare a cell suspension of 200 g / L (based on wet cells) for enzyme activity detection.

[0143] The positive clones with catalytic activity were sequenced and analyzed.

[0144] The same method was used to construct a random mutation library of AwMAO, and the positive clones were sequenced and analyzed.

[0145] The positive clones obtained include but are not limited to the following:

[0146] A133: replacing glutamine at position 239 of the amino acid sequence shown in SEQ ID NO: 1 with leucine;

[0147] Aw14: the leucine at position 310 of the amino acid sequence shown in SEQ ID NO: 2 is replaced by glutamine;

[0148] Aw52: The glycine at position 375 of the amino acid sequence shown in SEQ ID NO: 2 is replaced by aspartic acid.

[0149] Example 4: Fermentation expression of genetically engineered bacteria producing monoamine oxidase

[0150] The genetically engineered bacteria obtained in Examples 2 and 3 were inoculated into LB medium containing 100 mg / L ampicillin, respectively, and cultured on a shaker at 37° C. for 12 h, and then cultured in seed bottles at an inoculation rate of 1% (v / v).

[0151] The culture medium components include: yeast powder 0-20g / L, sodium chloride 0-10g / L, ammonium sulfate 0-5g / L, potassium dihydrogen phosphate 0-5g / L, potassium dihydrogen phosphate 0-5g / L, glycerol 0-50g / L, sterilized at 121°C for 30min.

[0152] Before inoculation, add ampicillin at a final concentration of 100 mg / L in a clean bench, with an inoculation volume of 0.1%, and culture at 220 rpm at 37°C overnight.

[0153] 10L fermentation culture of enzyme-producing strains: peptone 0-20g / L, yeast powder 0-20g / L, glycerol 0-20g / L, ammonium chloride 0-5g / L, ammonium sulfate 0-5g / L, potassium dihydrogen phosphate 0-20g / L, magnesium sulfate heptahydrate 0-5g / L, trace element mixture 0-5mL / L, ampicillin 50mg / L, defoamer 1mL / L.

[0154] Feed medium: glycerol 400 g / L, peptone 10 g / L, yeast powder 25 g / L, ammonium chloride 30 g / L, magnesium sulfate heptahydrate 7.5 g / L, trace element mixture 1 mL / L, sterilize at 121°C for 30 min.

[0155] Before inoculation, filtered ampicillin was added, the final antibiotic concentration was 50 mg / L, the inoculation amount was 5%, the dissolved oxygen was controlled at 30% during the process, and the pH was controlled at 7.0 with ammonia water.

[0156] Net OD 600 When the temperature reaches 20°C, the temperature is lowered to 32°C, and IPTG with a final concentration of 0.1 mM is added to induce protein expression. During the process, the feed rate is appropriately adjusted to meet the growth of the bacteria.

[0157] Example 5: Catalytic 3-azabicyclo[3.3.0]octane in a liter scale reactor

[0158] Preparation of enzyme solution: The enzyme fermentation broth (Example 4) was centrifuged at 4-10°C and 7000rpm for 15-20min, the supernatant was discarded to collect the wet cells, and pure water was added to prepare a 300g / L (based on wet cells) cell suspension, which was homogenized three times under a pressure of 60Mpa (low temperature) to obtain a cell homogenate; 3kg of the above homogenate, 90ml of catalase and 6g of bubo were mixed evenly and the pH was adjusted to about 7.4.

[0159] Preparation of substrate solution: Weigh 200 g of 3-azabicyclo[3.3.0]octane hydrochloride, collect the organic phase after dissociation; add 1200 mL of pure water and the above organic phase under ice-water bath conditions, slowly add 200 g of sodium bisulfite when the temperature drops to 18°C, stir until completely dissolved and then adjust the volume to 2 kg, that is, a 100 g / kg substrate solution.

[0160] Reaction process: Add the prepared enzyme solution to the conversion tank, rotate at 600rpm, temperature at 26℃, pH around 7.4, oxygen, tank pressure at 0.07-0.08Mpa, maintain for 40min, then start adding the substrate solution, the initial flow rate is 0.45mL / min, and then sample every two hours for TLC detection, adjust the substrate flow rate according to the substrate residue, so that there is almost no substrate residue in the reaction process. After the reaction is completed, the product (3S,7R)-3-azabicyclo[3.3.0]octane-2-sulfonate sodium is obtained. of conversion fluid.

[0161] Substrate control method: Take the reaction solution under stirring, add methanol to dilute 1 times and mix evenly, and perform TLC detection; if TLC detection shows no obvious substrate point, increase the substrate flow acceleration rate by 0.2mL / min; if TLC detection shows no obvious substrate point, maintain the substrate flow acceleration rate; if TLC detection shows obvious substrate point, reduce the substrate flow acceleration rate by 0.2mL / min; if TLC detection has particularly obvious substrate point, or two consecutive detections have obvious substrate point, the substrate feeding can be suspended, and the feeding can be restarted after the TLC detection has no obvious substrate point. The substrate feeding time is 28h, and the tank is released after 30h. After stopping the feeding, calculate the substrate usage ((initial substrate weight-remaining substrate weight)*substrate concentration).

[0162] The substrate usage of the mutant enzymes is shown in Table 3. The substrate usage of mutants Al33 and Aw52 are 152.73 g and 157.86 g, respectively, both higher than the corresponding wild-type enzymes.

[0163] Table 3 Experimental results of mutant monoamine oxidase catalyzing the desymmetric oxidation of 3-azabicyclo[3.3.0]octane

[0164] Enzymes Mutation site Substrate dosage (g) Al33 Q239L 152.73 Aw14 L310Q 40.75 Aw52 G375D 157.86

[0165] Example 6: Isolation, purification and identification of the product (3S,7R)-3-azabicyclo[3.3.0]octane-2-ene

[0166] In this embodiment, different monoamine oxidases (MAON401, AlMAO, AwMAO, Al33, Aw52) are used to carry out the catalytic reaction shown in reaction formula Q2. The method is the same as in Example 5. The amount of each enzyme fermentation broth is the same, which is 3 kg of 300 g / L (based on wet bacteria) cell suspension, i.e. 900 g of wet bacteria.

[0167]

[0168] In the above reaction, the purpose of adding sodium bisulfite is to convert the product (3S, 7R)-3-azabicyclo[3.3.0]octane-2-ene into a sulfonate form, thereby relieving the substrate inhibition of the product on monoamine oxidase. In order to finally separate and purify the direct product (3S, 7R)-3-azabicyclo[3.3.0]octane-2-ene, it is necessary to further oxidize the sulfonate product in reaction formula Q2 using hydrogen peroxide under alkaline conditions. Therefore, 359.8 g of 40% NaOH was added to the enzyme conversion solution, the pH was adjusted to 12.8, 30 mL of 30 wt% hydrogen peroxide was added, 1.1 kg of sodium chloride was added to the aqueous solution, and after stirring evenly, tertiary methyl ether was added for extraction, and a total of four extractions were performed, 1.5 kg each time, for a total of 6.0 kg. The obtained extract was concentrated and evaporated to dryness, and then 0.5 L of recovered dichloromethane, 30.0 g of diatomaceous earth and 40.0 g of anhydrous sodium sulfate were added, and the mixture was stirred for 30 min and filtered. The filtrate was concentrated and evaporated to dryness under reduced pressure, and 60.0 mL of tert-methyl ether was added, and the mixture was stirred for crystallization. The mixture was refrigerated at 4°C overnight, and the wet product was filtered out. The dry product was obtained after drying at 30°C for 17 h and weighed.

[0169] The dry product was identified as (3S,7R)-3-azabicyclo[3.3.0]octane-2-ene

[0170] The product results are shown in Table 4.

[0171] Table 4 Product 3-azabicyclo[3.3.0]octane-2-ene extraction results

[0172] Enzymes Relative product content (%) Product purity (%) MAON401 100 99.84 AlMAO 100.17 99.86 AHr 95.28 99.9 Al33 98.67 99.77 Aw52 100.62 99.86

[0173] Note: The product content of enzyme MAON401 is taken as 100% to calculate the relative product content of other enzymes.

[0174] Product gas chromatography detection: Weigh 10 mg of substrate and product reference respectively, dissolve them in 1 mL of chromatographic pure methanol, perform gas chromatography analysis, and record the chromatogram. The retention times are 23.074 min and 23.793 min, respectively, indicating that the product and substrate can be effectively separated ( Figure 3 ).

[0175] Taking the enzyme reaction of Aw52 as an example, about 0.1 g of sample was taken, dissolved in a 10 mL volumetric flask with chromatographic methanol, filtered with a 0.45 μm membrane, and analyzed under the above chromatographic conditions.

[0176] Figure 4 This is a detection diagram of the product extracted from the Aw52 enzyme reaction solution. Among them, the peak at a retention time of 23.780 min corresponds to the standard ((3S, 7R)-3-azabicyclo[3.3.0]octane-2-ene), and the relative area of ​​the peak is 99.859%.

[0177] discuss

[0178] Kate E. Atkin et al. performed point mutations on monoamine oxidase (MAON) from Aspergillus niger to obtain the MAO-N-D5 mutant, which can catalyze substrates that the wild-type MAON cannot recognize.

[0179] Patent WO2010008828A2 obtains a series of monoamine oxidase mutants by fusing and point-mutating Aspergillus niger monoamine oxidase MAON and Aspergillus oryzae monoamine oxidase MAO-3. Through high-throughput qualitative screening, a series of mutants were obtained that have the activity of catalyzing 3-azabicyclo[3.3.0]octane to form (3S,7R)-3-azabicyclo[3.3.0]oct-2-ene. The latter forms an addition product with NaHSO3 in the system, and then the carboxylic acid methyl ester hydrochloride product can be obtained through three steps of mild chemical reaction. Although compared with the wild-type Aspergillus niger monoamine oxidase MAON, the above mutants have the ability to convert the corresponding substrates, but the specific conversion rate and quantitative data are not presented in the patent. Subsequently, the team selected mutant No. 12 with excellent thermal stability and enzyme activity, and renamed it MAON401, so the present invention selects MAON401 as the screening control.

[0180]

[0181] Experiments of the present invention show that the three monoamine oxidases of the present invention, AlMAO (derived from Aspergillus luchuensis), AwMAO (derived from Aspergillus welwitschiae) and AbMAO (derived from Aspergillus brasiliensis) and their mutants, not only have catalytic activity equivalent to or higher than that of the MAON401 enzyme, but also have higher conversion rate and chiral catalytic performance under high substrate concentration.

[0182] All documents mentioned in the present invention are cited as references in this application, just as each document is cited as reference individually. In addition, it should be understood that after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications to the present invention, and these equivalent forms also fall within the scope defined by the claims attached to this application.

Claims

1. A monoamine oxidase mutant, characterized in that: The monoamine oxidase mutant has the activity of catalyzing the desymmetric oxidation of 3-azabicyclo[3.3.0]octane to form (3S,7R)-3-azabicyclo[3.3.0]oct-2-ene, and has a mutation selected from the following group: (a) based on the amino acid sequence shown in SEQ ID NO: 1, glutamine (Gln) at position 239 is replaced by leucine (Leu); (b) Glycine (Gly) at position 375 in the amino acid sequence shown in SEQ ID NO: 2 is replaced with aspartic acid (Asp).

2. An isolated polynucleotide, characterized in that The polynucleotide encodes the monoamine oxidase mutant according to claim 1.

3. A carrier, characterized in that The vector contains the polynucleotide according to claim 2.

4. A genetically engineered host cell, characterized in that The host cell contains the vector according to claim 3, or the polynucleotide according to claim 2 is integrated into its genome.

5. Use of the monoamine oxidase mutant according to claim 1, characterized in that: It is used for catalytic synthesis of chiral amine compounds, or for preparing catalytic preparations for catalytic synthesis of chiral amine compounds.

6. A method for catalyzing the desymmetric oxidation of 3-azabicyclo[3.3.0]octane, characterized in that: Said include: (a) 3-azabicyclo[3.3.0]octane is oxidized in the presence of monoamine oxidase to form (3S,7R)-3-azabicyclo[3.3.0]oct-2-ene: Wherein, the monoamine oxidase is selected from the following group: (i) the monoamine oxidase mutant according to claim 1; (ii) a wild-type monoamine oxidase having an amino acid sequence as shown in any one of SEQ ID Nos: 1 to 3; (iii) Any combination of (i) and (ii) above.

7. The method according to claim 6, characterized in that The method further comprises: (b) reacting (3S,7R)-3-azabicyclo[3.3.0]oct-2-ene with NaHSO3 in an inert solvent to form sodium (3S,7R)-3-azabicyclo[3.3.0]octane-2-sulfonate:

8. The method according to claim 6, characterized in that The method is used to prepare (3S, 7R)-3-azabicyclo[3.3.0]octane-2-sulfonate, wherein the reaction is shown in reaction formula Q2:

9. The method according to claim 6, characterized in that The monoamine oxidase is presented in the form of its expressing microbial bacterial cells.

10. The method according to claim 6, characterized in that The step (a) has one or more characteristics selected from the following group: (Y1) The amount of monoamine oxidase used is 200-300 g / L of cell homogenate (based on wet cells); (Y2) is carried out at a pH of about 7.0 to 8.0; (Y3) carried out under shaking or stirring conditions; (Y4) The reaction temperature is 10-35°C, preferably 20-30°C, and more preferably 26±2°C.

Images