Large-volume sample free nucleic acid extraction kit, nucleic acid extraction method and detection method

Abstract

The invention belongs to the technical field of nucleic acid extraction, and particularly relates to a large-volume sample free nucleic acid extraction kit, a nucleic acid extraction method and a detection method. The kit comprises a lysis solution, a protease K solution, a binding solution, a rinsing solution 1, a rinsing solution 2, an eluent and magnetic beads. The nucleic acid extraction method comprises the following steps: centrifuging a sample by adopting the kit, splitting and incubating; leaving the magnetic beads, and rinsing the magnetic beads with a rinsing liquid 1 and a rinsing liquid 2 for three times respectively; eluting with an eluent, and collecting to obtain a nucleic acid solution. The nucleic acid extraction method and the kit are applied to an automatic workstation, and reagents are added into different hole sites; and the program is operated after the reagent is added. The detection method comprises the following steps: determining the total amount of extracted DNA of the nucleic acid solution, the quality of extracted nucleic acid and the recovery efficiency of the nucleic acid solution. The invention provides a kit capable of being stored at normal temperature, a plurality of nucleic acid extraction methods and a detection method, can be used for free nucleic acid extraction, quality evaluation and large-scale nucleic acid extraction of a large-volume sample, and is low in detection cost and high in efficiency.

Description

Technical Field

[0001] The invention belongs to the technical field of nucleic acid extraction, and particularly relates to a large-volume sample free nucleic acid extraction kit, a nucleic acid extraction method, and a detection method. Background Art

[0002] Since Mandel and Metais first reported free nucleic acids in 1948, there has been a research history of more than 70 years. At that time, it was not determined whether nucleic acids were genetic materials, so it did not attract widespread attention. In 1970, European scholars first reported the presence of free nucleic acids in the plasma of tumor patients, and its content was about 10 times that of healthy people. It was a double-stranded nucleic acid molecule with a length of less than 500 bp, and most of it existed in the form of nucleosomes. A large number of studies have shown that free nucleic acids have the same genetic variations as tumor genome nucleic acids, such as gene mutations, gene promoter methylation, etc. Therefore, free nucleic acids can be used as a new marker to predict tumor occurrence.

[0003] The free nucleic acids from tumor cells in plasma or serum mainly come from: apoptosis and necrosis of tumor cells released into the blood, and metastasis and proliferation of tumor cells released into the blood. In recent years, the study of free nucleic acids has become a hot area in genomic molecular diagnostic research. It can be used as a new type of biomarker because it has the same genetic variation as the tumor cell genome and has significant specificity, which can be used to classify tumors and screen them at an early stage.

[0004] The existing traditional nucleic acid extraction technology contains precipitation and centrifugation operation extraction technical steps which are complicated, time-consuming, and have low recovery rates. It is difficult to achieve automated operation, and most methods also require operators to directly contact toxic chemical reagents. Therefore, with the rapid development of molecular biology and polymer materials science, the traditional method of separating and extracting nucleic acids from liquid systems has gradually been replaced by new methods based on solid-phase adsorbent carriers.

[0005] This type of emerging nucleic acid separation and extraction methods mainly include: rotating centrifugal column extraction method, glass powder adsorption method, silica matrix method, anion exchange method, nanomagnetic bead extraction method, etc. 1) At present, the centrifugal column method is widely used to extract nucleic acids. Most plasmid nucleic acid extraction kits on the market are developed based on the centrifugal column method. This method uses a special silicon matrix adsorption material, which is characterized by: it can specifically adsorb nucleic acids in the presence of high hydrochloric acid buffer and remove impurities that cannot be combined with RNA and proteins, but the extraction efficiency of small fragments of nucleic acids or RNA is not high. At the same time, the centrifugal column method requires repeated centrifugation to extract nucleic acids, which is not convenient for high-throughput and automated operations, especially in the fields of genetic diagnosis, monitoring and control of sudden epidemics. In addition, the centrifugal column method requires a large number of operators and instruments to meet the needs of nucleic acid extraction. 2) The magnetic bead method uses superparamagnetic nano-microspheres as carriers, which can specifically identify and efficiently bind to nucleic acid molecules at the microscopic interface, and can quickly separate and purify nucleic acids or RNA. The extraction process does not require centrifugation or filtration. It can be done manually or in the form of an automated work platform. It has high extraction throughput and good automation, which is suitable for the needs of large sample volume extraction. However, there are some problems with the current magnetic bead extraction method. The extraction efficiency of trace nucleic acids is not high, the extraction purity is low, and salt residue is prone to occur, which has an adverse effect on subsequent molecular detection. In addition, the commercial extraction kits based on the magnetic bead method on the market generally require a heating step for lysis incubation and nucleic acid elution during the extraction process, and heating will cause a certain degree of damage to the nucleic acid. This loss is even more unacceptable when the nucleic acid content in the test sample is trace, and it is easy to cause serious misjudgment of the results.

[0006] In addition, the concentration and purity of nucleic acid after extraction is generally measured by a Nanodrop-type micro-spectrophotometer. This method has a large error in measuring trace amounts of free nucleic acid in the sample.

[0007] Therefore, the current nucleic acid extraction methods, especially the extraction methods of free nucleic acids in large-volume samples, and the performance evaluation methods still need to be improved. Summary of the invention

[0008] In view of the deficiencies of the prior art, the present invention provides solutions: a large-volume sample free nucleic acid extraction kit, a nucleic acid extraction method, and a detection method.

[0009] 1. Providing a new kit A large-volume sample free nucleic acid extraction kit, the kit includes the following components: Lysis buffer, proteinase K solution, binding buffer, rinse buffer 1, rinse buffer 2, elution buffer, magnetic beads; The lysate includes: 1-100 mM Tris-HCl buffer, 1%-10% Tritonx-100, 1-5 M guanidine thiocyanate; The proteinase K solution comprises: 1-100 mM Tris-HCl buffer, 10-50 mg / mL proteinase K dry powder, 1-100 mM CaCl2 solution, and 30%-60% glycerol; The binding solution includes: 1-5 M guanidine thiocyanate, 1%-10% (w / v) polyethylene glycol 8000, 0.1%-1% (w / v) sodium lauroyl sarcosinate, 0.5%-5% sodium acetate solution, 5%-10% Tween 20, and 20%-50% isopropanol; The rinse solution 1 includes: 1-100 mM Tris-HCl buffer, 1%-10% Tritonx-100, 1-5 M guanidine isothiocyanate, wherein, before use, 20-50% anhydrous ethanol needs to be added to the rinse solution 1; The rinse 2 comprises: 1-100 mM Tris-HCl buffer and the balance of water, wherein 1-10 times of anhydrous ethanol needs to be added to the rinse solution 2 before use; The eluent includes: 1-100 mM Tris-HCl buffer; The magnetic beads include: magnetic beads made of silica and coated with carboxyl functional groups on the surface, with a content of 10-100 mg / mL.

[0010] (ii) Provide a nucleic acid extraction method applicable to the aforementioned kit, which is an artificial / manual nucleic acid extraction method A nucleic acid extraction method, using the large-volume sample free nucleic acid extraction kit, comprises the following steps: Sample preparation: Collect samples and centrifuge them for later use; Lysis: Take the sample to be used, the lysis solution, and the proteinase K solution, mix them evenly, and lyse them to obtain a lysed mixed solution; Magnetic bead binding: Add binding solution and magnetic beads to the lysed mixture, mix well, and incubate; Rinsing: After the incubation, the magnetic beads are left, and rinsing solution 1 containing anhydrous ethanol is added to the magnetic beads. After rinsing, the magnetic beads are left, and rinsing solution 2 containing anhydrous ethanol is added to the magnetic beads. After rinsing, the magnetic beads are left, and rinsing solution 2 containing anhydrous ethanol is added to the magnetic beads. Elution: After rinsing, the magnetic beads are left, and elution solution is added to the magnetic beads. After elution, the nucleic acid solution is collected.

[0011] Preferably, when preparing the sample, the sample collected in the preservation tube is taken, and the sample includes whole blood, plasma, urine, and pleural and abdominal fluid samples. After the sample is fully mixed, it is first centrifuged at 1500g-1600g to obtain the supernatant, and then centrifuged at 15000g-16000g to remove impurities in the sample and obtain the supernatant. The sample is collected and centrifuged for standby use.

[0012] Preferably, during lysis, 1-4 mL of the sample to be used, lysis solution, and proteinase K solution are taken, mixed, and lysed for 12-18 min to obtain a lysed mixed solution; during magnetic bead binding, binding solution and magnetic beads are added to the lysed mixed solution, mixed, and incubated for 12-18 min; wherein the volume ratio of magnetic beads, proteinase K solution, sample to be used, lysis solution, and binding solution is 1.5:10:100:80:120.

[0013] Preferably, during rinsing, after the incubation is completed, the magnetic beads are left behind, and 750 μL-800 μL of rinsing solution 1 containing anhydrous ethanol is added to the magnetic beads to fully suspend the magnetic beads. After rinsing, the magnetic beads are left behind, and 750 μL-800 μL of rinsing solution 2 containing anhydrous ethanol is added to the magnetic beads to fully suspend the magnetic beads. After rinsing, the magnetic beads are left behind, and 750 μL-800 μL of rinsing solution 2 containing anhydrous ethanol is added to the magnetic beads.

[0014] Preferably, during elution, the magnetic beads are left after rinsing and dried at room temperature for 5-10 min, 30-80 μL of elution solution is added to the magnetic beads to resuspend the magnetic beads, and incubated at 15-25°C with low-speed shaking for 5-10 min, or gently shaken every 2 min during the period to fully elute the nucleic acid, and then allowed to stand, and the nucleic acid solution is collected after elution.

[0015] (III) Provide a nucleic acid extraction method applicable to the aforementioned kit, which is a nucleic acid extraction method adapted for an automated workstation A nucleic acid extraction method, using the large-volume sample free nucleic acid extraction kit, comprises the following steps: Select a suitable fully automatic nucleic acid extractor, which includes a reagent strip and a magnetic rod sleeve, and the reagent strip includes well position 1, well position 2, well position 3, well position 4, and well position 5; Add 1-4 mL of sample, lysis buffer, and proteinase K solution to well 1, mix well, and lyse for 12-18 min. After lysis, add binding buffer and magnetic beads to well 1. Add 750 μL-800 μL of rinse solution 1 containing anhydrous ethanol to well 2; Add 750 μL-800 μL of rinse solution 2 containing anhydrous ethanol to well 3; Add 750 μL-800 μL of rinse solution 2 containing anhydrous ethanol to well 4; Add 55 μL-60 μL of elution buffer to well 5; After all reagents have been added, place the reagent strips in the experimental tray; Put the magnetic rod cover in place and run the program to obtain the nucleic acid solution.

[0016] Preferably, the volume ratio of magnetic beads, proteinase K solution, sample, lysate, and binding solution is 1.5:10:100:80:120.

[0017] It should be noted that the above technical solution proposes a nucleic acid extraction method that can be stably operated on an automated extractor or workstation to replace manual work. It is fast and simple, and a batch extraction can be completed without centrifugation. The operation can also be completed using an automated pipetting workstation or nucleic acid extraction solution. It is fully applicable to current detection technology and has important significance in scientific research and clinical testing.

[0018] (IV) Providing verification / evaluation / detection methods for the aforementioned nucleic acid extraction methods The detection method detects the nucleic acid solution obtained by the nucleic acid extraction method, comprising the following steps: using a fluorescence quantifier to determine the total amount of extracted DNA in the nucleic acid solution; using a real-time fluorescence quantitative PCR method in combination with an internal reference gene to detect the quality of the nucleic acid after nucleic acid extraction; and using a real-time fluorescence quantitative PCR method in combination with exogenous nucleic acid to detect the recovery efficiency of the nucleic acid solution.

[0019] Preferably, when detecting the quality of nucleic acid after nucleic acid extraction, it is necessary to detect by TaqMan probe method, select human internal reference gene ACTB as the detection object, and design the forward primer ACTB-F, reverse primer ACTB-R and probe ACTB-P of the internal reference gene ACTB according to the sequence of the extracted DNA, wherein the sequence of the extracted DNA refers to SEQ ID NO.1, the forward primer ACTB-F refers to SEQ ID NO.2, the reverse primer ACTB-R refers to SEQ ID NO.3, and the probe ACTB-P refers to SEQ ID NO.4; When detecting the recovery efficiency of the nucleic acid solution, it is necessary to add exogenous nucleic acid to the sample. The exogenous nucleic acid is Lambda DNA, and the recovery of Lambda DNA is detected by the TaqMan probe method. According to the sequence of Lambda DNA, the forward primer Lambda-F, reverse primer Lambda-R and probe Lambda-P of Lambda DNA are designed, wherein the sequence of Lambda DNA refers to SEQ ID NO.5, the forward primer Lambda-F refers to SEQ ID NO.6, the reverse primer Lambda-R refers to SEQ ID NO.7, and the probe Lambda -P refers to SEQ ID NO.8.

[0020] (V) Application The aforementioned detection methods can be used to evaluate the total amount of extracted DNA, recovery rate and amplification inhibition.

[0021] The main reason for the inhibition of extraction and amplification is that the sample DNA extraction and purification is not clean. After extraction and purification, it still contains impurities such as proteins, sugars, and organic solvents, which will inhibit PCR amplification.

[0022] Different from the prior art, the advantages and beneficial effects of the present invention are as follows: (1) The present invention provides a large-volume sample free nucleic acid extraction kit and a corresponding nucleic acid extraction method. The sample volume can be adjusted within a range of 1-4 mL. The average amount of free nucleic acid extracted manually from the sample using the kit of the present invention and the average amount of free nucleic acid extracted automatically from the sample can reach more than 5 ng / mL. The extraction process of the kit of the present invention does not require centrifugation, and the lysis and elution operations are achieved at room temperature, avoiding thermal damage to the nucleic acid caused by heating, and improving the integrity and activity of the nucleic acid extraction, thereby having a positive impact on subsequent molecular detection.

[0023] (2) The present invention provides a detection method that can evaluate / verify the kit and nucleic acid extraction method of the present invention, evaluate the total amount of extracted DNA, recovery rate and amplification inhibition. Through the detection, it can be known that 1) the nucleic acid extraction method of the present invention is suitable for extracting free nucleic acids from large-volume samples such as plasma, urine, and pleural and abdominal effusions, and the usable volume can be from 1mL to 4mL; 2) the verification method for free nucleic acid extraction of the present invention can effectively prove that the free nucleic acid extraction efficiency of the present invention can reach more than 90%; 3) the performance of the kit of the present invention can still be more than 90% effective after being placed for 1 year; 4) the nucleic acid extraction method of the present invention can effectively remove various PCR inhibitors in the sample, and has high purification efficiency, good reproducibility and high yield; 5) the nucleic acid extraction method of the present invention is suitable for most large-volume sample extraction instruments on the market.

[0024] In summary, the kit of the present invention can achieve high nucleic acid purity, recovery rate and stability during the extraction process, while minimizing the presence of impurities and degradation products. The kit of the present invention exhibits specificity and pertinence for the extraction of free nucleic acids from large-volume samples in application, and has high flexibility. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the accompanying drawings required for describing the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other accompanying drawings can be obtained based on these accompanying drawings without paying creative work.

[0026] Figure 1 According to one embodiment of the present invention, a plasma sample free nucleic acid extraction and performance evaluation experimental process and schematic diagram; Figure 21 is a schematic diagram of the extraction results and comparisons of the present invention, T Company and Q Company according to an embodiment of the present invention; wherein S1 is a marker and is marked in yellow; S2 is a kit of T Company and is marked in green; S3 is a kit of Q Company and is marked in blue; S4 is a kit of the present invention and is marked in red; Figure 2 b in the figure is a schematic diagram of the extraction results. Figure 2 a in the figure is a comparative schematic diagram; Figure 3 A schematic diagram showing the total amount of DNA extracted by different extraction methods and a comparison according to an embodiment of the present invention; Figure 4 Schematic diagram of internal reference CT results and comparison of different extraction methods according to one embodiment of the present invention; Figure 5 The figure is a comparative diagram of the recovery rate of exogenous DNA using different extraction methods according to one embodiment of the present invention.

[0027] Figure 3-Figure 5 In the present invention, the sample for extracting nucleic acid using the manual nucleic acid extraction method of Example 2 is recorded as ZK reagent portable, and correspondingly, the kit of the same product of T company is recorded as T reagent portable.

[0028] Figure 3-Figure 5 In the present invention, the samples of nucleic acid extracted by the automated extraction method of Example 7 are recorded as ZK Reagent Automation 1 (first parallel repeated experiment) and ZK Reagent Automation 2 (second parallel repeated experiment); correspondingly, the kits of similar products of T Company are recorded as T Reagent Automation 1 (first parallel repeated experiment) and T Reagent Automation 2 (second parallel repeated experiment). DETAILED DESCRIPTION

[0029] In order to make the technical solutions and advantages in the embodiments of the present application more clearly understood, the exemplary embodiments of the present application are further described in detail below in conjunction with the accompanying drawings. Obviously, the described embodiments are only part of the embodiments of the present application, rather than an exhaustive list of all the embodiments. It should be noted that the embodiments in the present application and the features in the embodiments can be combined with each other without conflict.

[0030] Many specific details are disclosed herein to provide a comprehensive and enabling description of embodiments of the present technology. However, those skilled in the art will appreciate that the technology may have additional embodiments and may practice the technology without several details of the embodiments described below. The equipment and materials used in the embodiments are readily available from commercial companies unless otherwise specified.

[0031] 1. Optimizing the kit The present application prepares a new kit which is different from the prior art, and the kit is a kit for extracting free nucleic acid from large-volume samples.

[0032] The range values ​​of this solution have been given in the aforementioned invention content, and specific values ​​are given below through Example 1. The specific values ​​are provided to enable those skilled in the art to better implement the technical solution, but other reasonable specific values ​​are not excluded.

[0033] Example 1 The kit consists of: lysis solution, proteinase K solution, binding solution, rinse solution 1, rinse solution 2, elution solution, and magnetic beads. The specific preparation is as follows: The contents of the components in the lysate were: 10 mM Tris-HCl buffer, 1% Tritonx-100, 4 M guanidine isothiocyanate; The components of the proteinase K solution are as follows: 10 mM Tris-HCl buffer, 20 mg / mL proteinase K powder, 5 mM CaCl2 solution, 50% glycerol; The contents of the ingredients in the binding solution are: 3 M guanidine thiocyanate; 5% (w / v) polyethylene glycol 8000; 0.5% (w / v) sodium lauroyl sarcosinate; 1.2% sodium acetate solution; 7% Tween 20; 33% isopropanol; The components of the rinse solution 1 are: 10 mM Tris-HCl buffer, 1% Tritonx-100, 4 M guanidine isothiocyanate, and the balance of water, wherein, before use, anhydrous ethanol accounting for 40% of the total mass of the rinse solution 1 needs to be added to the rinse solution 1; The content of the components in the rinse solution 2 is: 2 mM Tris-HCl buffer, wherein, before use, anhydrous ethanol 4 times the total mass of the rinse solution 2 needs to be added to the rinse solution 2; The contents of the components in the eluate were: 1 mM Tris-HCl buffer; The magnetic beads are made of silica and coated with carboxyl functional groups on the surface. The particle size is 500 nm and the content is 50 mg / mL. The magnetic beads can be purchased from Thermo Fisher Scientific.

[0034] In addition, it should be noted that if the time needs to be adjusted during actual use, the excess can be made up with water.

[0035] Example 2 The kit of Example 1 is applied to detection, and a first specific nucleic acid extraction method is provided in this example: The following is prepared manually / artificially by the inventor, and the specific steps are as follows: (1) Sample preparation: Take samples collected using free nucleic acid storage tubes or EDTA storage tubes, including plasma, urine, and pleural and abdominal fluid samples. After the samples are fully mixed, centrifuge at 1600 g to obtain the supernatant, then centrifuge at 16,000 g to remove impurities in the samples and obtain the supernatant. After the samples are collected and centrifuged, 1-4 mL of the samples are taken for extraction; Then, take a 15 mL centrifuge tube and add 1-4 mL of the sample in step (1) above. The volume ratio of the magnetic beads, proteinase K solution, sample, lysis solution, and binding solution added subsequently is 1.5:10:100:80:120. The following takes 2 mL of sample as an example to give specific values. The specific values ​​are provided to enable those skilled in the art to better implement the technical solution, but other reasonable specific values ​​are not excluded: (2) Take a 15 mL centrifuge tube and add 2 mL of the sample in step (1), 1.6 mL of lysis buffer, and 200 μL of proteinase K solution. Vortex and lyse at room temperature for 15 min. During this time, the tube can be placed on a mixer and mixed by inversion or inverted every 3-5 min for 10 sec to obtain a lysed mixture.

[0036] (3) Add 2.4 mL of binding solution and 30 μL of magnetic beads to the lysed mixture obtained in step (2) above, vortex and incubate at room temperature for 15 min. During this period, the tube can be placed on a mixer and mixed by inversion or mixed by inversion every 3-5 min for 10 seconds to allow the magnetic beads and nucleic acid to fully bind. After the incubation, centrifuge briefly to remove droplets on the inner wall of the tube cap. Place the centrifuge tube on the magnetic rack for 2-5 min. When the magnetic beads are completely adsorbed, carefully remove the liquid with a pipette and remove the centrifuge tube.

[0037] (4) Add 750 μL of rinse solution 1 to the magnetic beads obtained in step (3) above (please check whether anhydrous ethanol has been added before use), mix by pipetting or invert for 30 seconds to fully suspend the magnetic beads, and centrifuge briefly to remove droplets on the inner wall of the tube cap. Place the centrifuge tube on the magnetic rack for 1 min. When the magnetic beads are completely adsorbed, carefully remove the liquid with a pipette and remove the centrifuge tube.

[0038] Note: All magnetic beads and liquids in step (4) can be transferred to a 1.5 mL magnetic stand for subsequent operations. If there are residual magnetic beads on the wall of the centrifuge tube, add 750 μL of rinse solution 1 to rinse, and then transfer them to a 1.5 mL centrifuge tube.

[0039] (5) Add 750 μL of rinse solution 2 to the magnetic beads obtained in step (4) above (please check whether anhydrous ethanol has been added before use), mix by inverting for 30 seconds to fully suspend the magnetic beads, and centrifuge briefly to remove droplets on the inner wall of the tube cap. Place the centrifuge tube on the magnetic rack for 1 min. When the magnetic beads are completely adsorbed, carefully remove the liquid with a pipette and remove the centrifuge tube.

[0040] (6) Add 750 μL of rinse solution 2 to the magnetic beads obtained in step (5) above (please check whether anhydrous ethanol has been added before use), mix by inverting for 30 seconds to fully suspend the magnetic beads, and centrifuge briefly to remove droplets on the inner wall of the tube cap. Place the centrifuge tube on the magnetic rack for 1 min. When the magnetic beads are completely adsorbed, carefully remove the liquid with a pipette and remove the centrifuge tube.

[0041] (7) Place the magnetic beads obtained in step (5) above on a magnetic rack and dry at room temperature for 5-10 min.

[0042] Note: The residual anhydrous ethanol will inhibit the subsequent enzyme reaction, so make sure that the anhydrous ethanol evaporates completely when drying. But do not over-dry to avoid affecting the efficiency of nucleic acid elution.

[0043] (8) Add 30-80 μL of elution buffer to the magnetic beads obtained in step (7) above, use a pipette to resuspend the magnetic beads, and incubate at 15-25 °C with low-speed shaking for 5-10 min, or gently shake every 2 min to fully elute the nucleic acid. Centrifuge briefly to remove droplets on the inner wall of the tube cap.

[0044] (9) Then place the centrifuge tube on the magnetic rack and let it stand for 2 min. When the magnetic beads are completely adsorbed, carefully transfer the nucleic acid solution to a new centrifuge tube. The collected nucleic acid solution is the purified nucleic acid and should be stored under appropriate conditions.

[0045] It should be noted that the centrifugation involved in the above steps has a different function from the centrifugal extraction in the prior art. The function of the above centrifugation is mainly to remove unnecessary droplets and avoid experimental errors.

[0046] Example 3 The kit of Example 1 is applied to detection. In this example, a second specific method for extracting nucleic acid is provided. The following is to apply the kit of the present invention to an automated workstation. The compatible automated workstations include Auto-Pure 24D and Nuetraction BFEX-24E, as well as other automated workstations on the market that can be used to extract large-volume samples. Using the reagents and materials of the kit of Example 1, the specific extraction steps are as follows: Select the appropriate automated workstation. The automated workstation includes a reagent strip and a magnetic rod set. The reagent strip includes multiple wells. Different reagents and materials are added to different wells. 1-4 mL of sample is added to well 1. The volume ratio of magnetic beads, proteinase K solution, sample, lysate, and binding solution is 1.5:10:100:80:120. Specific values ​​are given below using 2 mL of sample as an example. The specific values ​​are provided to allow those skilled in the art to better implement the technical solution, but other reasonable specific values ​​are not excluded: (1) Add 2 mL of sample, 1.6 mL of lysis buffer, and 200 μL of proteinase K solution to well 1. Mix well and incubate the well at room temperature for 15 min. Gently mix the well every 3-5 min. (This step is performed outside the instrument.)

[0047] (2) After 15 min of lysis, add 2.4 mL of binding solution and 30 μL of magnetic beads to well 1.

[0048] (3) Add 750 μL-800 μL of rinse solution 1 (add anhydrous ethanol before use) to well 2. 750 μL is preferred.

[0049] (4) Add 750 μL-800 μL of rinse solution 2 (add anhydrous ethanol before use) to well 3. 750 μL is preferred.

[0050] (5) Add 750 μL-800 μL of rinse solution 2 (add anhydrous ethanol before use) to well 4. 750 μL is preferred.

[0051] (6) Add 50 μL-60 μL of elution buffer to well 5. 50 μL is preferred.

[0052] (7) After all reagents have been added, place the reagent strip in the experimental tray.

[0053] (8) Place the magnetic rod cover and run the program to obtain the nucleic acid solution.

[0054] It should be noted that the present invention provides a nucleic acid extraction method suitable for the kit of the present invention through Examples 2 and 3, proving that the kit of the present invention can be used for both manual extraction and automated extraction, has a wide range of applications, and has high adaptability.

[0055] 2. Performance evaluation / verification methods The following provides a variety of performance evaluation methods applicable to free nucleic acid extraction kits, especially those applicable to free nucleic acid extraction kits for large-volume samples.

[0056] Method 1: The method used to verify the quality of nucleic acid purified by the free nucleic acid extraction kit requires the use of a Qubit concentration measurement instrument for testing. The nucleic acid solution after extraction / purification is the sample.

[0057] Specifically: Use Qubit 4.0 Fluorometer (Thermo Fisher Scientific) to measure the sample concentration. Use a pipette to measure 1 μL of nucleic acid solution sample and add 199 μL of dye premix. After mixing, turn off the light and let it stand for 2 min. Then put it into Qubit 4.0 fluorescent agent for concentration measurement. Calculate the total amount of extracted DNA based on the obtained value. The total amount of extracted DNA is the product of sample DNA concentration and sample DNA volume.

[0058] Herein, DNA refers to free DNA of the sample.

[0059] Method 2: The method used to verify the quality of nucleic acid purified by the free nucleic acid extraction kit is as follows: It is necessary to detect by real-time fluorescence quantitative PCR (TaqMan probe), select the human internal reference gene ACTB as the detection object, and design the forward primer ACTB-F, reverse primer ACTB-R and probe ACTB-P of the internal reference gene ACTB according to the sequence of the extracted DNA. Please refer to Tables 1 to 3 for details.

[0060] The sequence of the extracted DNA is SEQ ID NO.1, as follows: GTGATGGAGGAGGCTCAGCAAGTCTTCTGGACTGTGAACCTGTGTCTGCCACTGTGTGCTGGGTGGTGGTCATCTTTCCCACCAGGCTGTGGCCTCTGCAACCTTCAAGGGAGGAGCAGGTCCCATTGG.

[0061] Table 1 ACTB primer and probe sequences

[0062] It should be noted that CY5 is a fluorescent group, BHQ3 is a quenching group, and ACTB-P is the labeled sequence.

[0063] Table 2 Reaction system

[0064] Table 3 PCR reaction procedure

[0065] Method 3: Method for verifying the recovery efficiency of nucleic acids after purification by free nucleic acid extraction kit.

[0066] It is necessary to add exogenous nucleic acids to the sample to monitor the extraction recovery rate.

[0067] The exogenous nucleic acid is Lambda DNA, and the recovery of Lambda DNA is detected by real-time fluorescence quantitative PCR (TaqMan probe). According to the sequence of Lambda DNA, the forward primer Lambda-F, reverse primer Lambda-R and probe Lambda-P of Lambda DNA are designed. Please refer to Table 4 to Table 6 for details.

[0068] The sequence of Lambda DNA is SEQ ID NO.5, as follows: GCCCGTGTGCGTGACATAAAACCGGTATGGGCGCTTGCCAACGACATGAACTGCAGTGCAGGTCAGTTGCTTGCCAGTGCCGCCTCCCGGCGTCTGGTCACGCAGACCGCCCGGACAGGCTCCATCGGCGTCATGATGGCTCAC.

[0069] Table 4 Lambda DNA primer and probe sequences

[0070] It should be noted that FAM is a fluorescent group, BHQ1 is a quenching group, and Lambda-P is the labeled sequence.

[0071] Table 5 Reaction system

[0072] Table 6 PCR reaction program

[0073] It should be noted that the purpose of the nucleic acid before / after extraction is to detect and compare the nucleic acid after extraction and the exogenous nucleic acid before extraction using real-time fluorescence quantitative PCR (TaqMan probe) method.

[0074] 3. Testing Reference Figure 1 , combined with the above (i) and (ii) to provide more specific tests, including comparative tests: It should be noted that the repetition in the following experiment is to conduct parallel experiments and ensure the accuracy of the test results.

[0075] Example 4 In this embodiment, different from Embodiment 2, the sample is a urine sample.

[0076] A urine sample from a healthy person was selected, divided into 10 replicate samples, and exogenous nucleic acid samples were added (according to the needs of subsequent testing), and nucleic acid was extracted using the method of Example 2. 2 mL of sample was taken from each replicate for extraction.

[0077] After nucleic acid extraction, the total amount after extraction, internal reference CT and exogenous DNA recovery rate were evaluated according to the three methods in (II). The experimental results are shown in Table 7.

[0078] Table 7 Experimental results

[0079] Example 5 In this embodiment, different from Embodiment 2, the sample is a plasma sample.

[0080] Mixed plasma samples from healthy subjects were selected and divided into three volume levels (1 mL, 2 mL, and 4 mL). Each volume level was divided into 6 replicates and exogenous nucleic acid samples were added (according to the needs of subsequent testing). The method of Example 2 was used for nucleic acid extraction.

[0081] After nucleic acid extraction, the total amount after extraction, internal reference CT and exogenous DNA recovery rate were evaluated according to the three methods in (II). The experimental results are shown in Table 8.

[0082] Table 8 Experimental results

[0083] It should be noted that the different volume levels are indicated in the above sample numbers through suffixes: "002-1mL", "002-2mL", "002-4mL".

[0084] Example 6 In this embodiment, different from Embodiment 2, the sample is a plasma sample.

[0085] Mixed plasma samples from healthy people of 2 batches were selected, each of which was divided into 3 replicates and exogenous nucleic acid samples were added (according to the needs of subsequent testing), and nucleic acid extraction was performed using the method of Example 2. At the same time, a comparative experiment was set up, with the same samples, and the same products, such as magnetic bead-based large-volume free nucleic acid extraction kit (DP710) from T Company (Tiangen Biochemical Technology (Beijing) Co., Ltd.) and Q Company (Qiagen)'s similar product QIAamp Ciculating Nucleic Acid Kit (50) were used for nucleic acid extraction, and the specific steps were strictly followed in accordance with the kit instructions. It should be noted that, for each replicate, 2 mL of sample was taken for extraction.

[0086] The fragments extracted from the kit of the present invention, the similar products of Company T and the similar products of Company Q were analyzed and compared. Figure 2 , The fragment analysis was performed using a Qsep1 biological fragment analyzer, and the fragment size and distribution of the extracted nucleic acid were analyzed according to the instructions.

[0087] After nucleic acid extraction, the total amount after extraction, internal reference CT and exogenous DNA recovery rate were evaluated according to the three methods in (II). The experimental results are shown in Table 9.

[0088] Table 9 Experimental results of the product of the present invention

[0089] It should be noted that the mixed plasma samples from healthy individuals of two batches were distinguished by 003 and 004, and the three replicates were distinguished by batch numbers “1, 2, 3”.

[0090] Example 7 In this example, the extraction method of Example 3 was used and the sample was a plasma sample.

[0091] Mixed plasma samples from healthy people were selected and divided into 10 replicate samples. Exogenous nucleic acid samples were added (according to the needs of subsequent testing) and nucleic acid was extracted using a large-volume sample automatic extractor (Aosheng Auto-Pure 24D). 2 mL of sample was taken from each replicate for extraction.

[0092] Instructions for use of the instrument and specific steps of the procedure: (1) Add 2 mL of sample, 1.6 mL of lysis buffer, and 200 μL of proteinase K solution to well 1. Mix well and incubate the well at room temperature for 15 min. Gently mix the well every 3-5 min. (This step is performed outside the instrument.)

[0093] (2) After 15 min, add 2.4 mL of binding solution and 30 μL of magnetic beads to well 1.

[0094] (3) Add 750 μL-800 μL of rinse solution 1 to well 2 (add 40% anhydrous ethanol before use).

[0095] (4) Add 750 μL-800 μL of rinse solution 2 to well 3 (add 4 times the amount of anhydrous ethanol in rinse solution 2 before use).

[0096] (5) Add 750 μL-800 μL of rinse solution 2 to well 4 (add 4 times the amount of anhydrous ethanol in rinse solution 2 before use).

[0097] (6) Add 55 μL-60 μL of elution buffer to well 5.

[0098] (7) After all reagents have been added, place the reagent strip in the experimental tray.

[0099] (8) Put the magnetic rod cover in place and run the program.

[0100] (9) The remaining liquid in well 5 is the obtained nucleic acid solution.

[0101] Conventional details not written here do not affect the improvement of the present application or are not key features of the improvement of the present application, and the operator can operate according to the instrument manual and operating guide.

[0102] After nucleic acid extraction, the total amount after extraction, internal reference CT and exogenous DNA recovery rate were evaluated according to the three methods in (II). The experimental results are shown in Table 10.

[0103] Table 10 Experimental results

[0104] Example 8 In this embodiment, a comparative experiment is set up, and the sample is a plasma sample.

[0105] The manual nucleic acid extraction method of Example 2 was used, and after adding the sample, nucleic acid was extracted from the kit of the present invention (prepared with reference to Example 1) and the kit of the same product of Company T.

[0106] Using the automated extraction method of Example 7, after adding the sample, nucleic acid extraction was performed on two automated instruments (Auto-Pure24D from Aosheng) for the kit of the present invention (prepared with reference to Example 1) and the kit of a similar product of Company T, respectively.

[0107] In order to control the influencing factors, the above samples were mixed plasma samples from the same batch of healthy people, divided into 18 replicates and added with exogenous nucleic acid samples (according to the detection needs), and two parallel replicate experiments were performed. Among them, 2 mL of each replicate sample was taken for extraction.

[0108] In order to control the influencing factors, the performance verification after nucleic acid extraction mentioned above is as follows: after nucleic acid extraction, the total amount after extraction, internal reference CT and exogenous DNA recovery rate are evaluated according to the three methods in (II). The experimental results are shown in Figure 3~Figure 5 The total amount after extraction is referenced Figure 3 , internal reference CT Figure 4 , exogenous DNA recovery rate reference Figure 5 It should be noted that the experimental outliers are deleted from the figure.

[0109] Figure 3-Figure 5 In the present invention, the sample for extracting nucleic acid using the manual nucleic acid extraction method of Example 2 is recorded as ZK reagent portable, and correspondingly, the kit of the same product of T company is recorded as T reagent portable.

[0110] Figure 3-Figure 5 In the present invention, the samples of nucleic acid extracted by the automated extraction method of Example 7 are recorded as ZK Reagent Automation 1 (first parallel repeated experiment) and ZK Reagent Automation 2 (second parallel repeated experiment); correspondingly, the kits of similar products of T Company are recorded as T Reagent Automation 1 (first parallel repeated experiment) and T Reagent Automation 2 (second parallel repeated experiment).

[0111] Example 9 In this example, the stability of the kit of the present invention was tested. After the kit of the present invention was prepared according to the method of Example 1, it was stored at room temperature for 0 months, 3 months, 6 months, and 12 months. After being stored as required, the kit was taken out and nucleic acid was extracted from the sample. The nucleic acid extraction referred to the manual nucleic acid extraction method of Example 2.

[0112] The samples were: mixed plasma samples from healthy people were selected, divided into 5 replicates and exogenous nucleic acid samples were added (according to the needs of subsequent testing). Among them, 2 mL of sample was taken from each replicate for extraction.

[0113] After nucleic acid extraction, the total amount after extraction, internal reference CT and exogenous DNA recovery rate were evaluated according to the three methods in (II). The experimental results are shown in Table 11.

[0114] Table 11 Experimental results of the products of the present invention stored at room temperature for 0-12 months

[0115] It should be noted that 5 repeats are represented by repeat 1 to repeat 5 in the above table.

[0116] 4. Data Analysis By referring to the above tables and figures, we can get the following results: The present invention provides a new method for preparing a free nucleic acid extraction kit in Example 1, provides an artificial nucleic acid extraction method applicable to the aforementioned kit in Example 2, and provides an automated nucleic acid extraction method applicable to the aforementioned kit in Example 3, which can be adapted to a fully automatic nucleic acid extraction instrument.

[0117] The present invention provides three performance evaluation / verification methods in (ii), and the aforementioned methods are applicable to free nucleic acid extraction kits, and are particularly applicable to the kits of the present invention.

[0118] In Examples 4 to 6 of the present invention, nucleic acid extraction and performance verification are performed on different samples (urine, plasma) using the kit and artificial nucleic acid extraction method of the present invention.

[0119] In Example 7 of the present invention, nucleic acid extraction and performance verification are performed on samples using the kit and automated nucleic acid extraction method of the present invention.

[0120] The present invention sets up a comparative test in Example 8, controls sample factors, and verifies and compares the performance of different kits (the kit of the present invention and the existing kits on the market) from two dimensions (manual nucleic acid extraction and automated nucleic acid extraction).

[0121] The present invention sets up a comparative test in Example 9, controls sample factors, changes storage conditions, and performs manual nucleic acid extraction and performance verification after the kit of the present invention is stored.

[0122] Furthermore, the data also show that The average amount of free nucleic acids manually extracted from samples using the kit of the present invention and the average amount of free nucleic acids automatically extracted from samples can both reach more than 5 ng / mL.

[0123] It can be seen from the recovery rate that the efficiency of free nucleic acid extraction of the present invention can reach more than 90%. The performance of the test kit of the present invention can be more than 90% effective even if it is placed for one year.

[0124] In the present invention, the amount of sample input can be adjusted within a range of 1-4 mL.

[0125] The kit of the invention belongs to a free nucleic acid extraction kit which can be adapted to both an automated workstation and a large-volume sample.

[0126] The existing kits on the market can also be applied to the extraction method and performance verification method of the present invention, but in comparison, the kit of the present invention has better performance, and is more exclusive, specific and targeted to the kit of the present invention.

[0127] Although the preferred embodiments of the present application have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications falling within the scope of the present application.

[0128] Obviously, those skilled in the art can make various changes and modifications to the present application without departing from the spirit and scope of the present application. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. A kit for extracting free nucleic acid from large-volume samples, characterized in that: The kit includes the following components: Lysis buffer, proteinase K solution, binding buffer, rinse buffer 1, rinse buffer 2, elution buffer, magnetic beads; The lysate comprises: 1-100 mM Tris-HCl buffer, 1%-10% Tritonx-100, 1-5 M guanidine isothiocyanate, and the balance water; The proteinase K solution comprises: 1-100 mM Tris-HCl buffer, 10-50 mg / mL proteinase K dry powder, 1-100 mM CaCl2 solution, 30%-60% glycerol, and the balance water; The binding solution comprises: 1-5 M guanidine thiocyanate, 1%-10% (w / v) polyethylene glycol 8000, 0.1%-1% (w / v) sodium lauroyl sarcosinate, 0.5%-5% sodium acetate solution, 5%-10% Tween 20, 20%-50% isopropanol, and the balance water; The rinse solution 1 comprises: 1-100 mM Tris-HCl buffer, 1%-10% Tritonx-100, 1-5 M guanidine isothiocyanate, and the balance of water, wherein 20-50% anhydrous ethanol needs to be added to the rinse solution 1 before use; The rinse 2 comprises: 1-100 mM Tris-HCl buffer and the balance of water, wherein, before use, 1-10 times of anhydrous ethanol needs to be added to the rinse solution 1; The eluent comprises: 1-100 mM Tris-HCl buffer and the balance water; The magnetic beads include: magnetic beads made of silica and coated with carboxyl functional groups on the surface, with a content of 10-100 mg / mL.

2. A method for extracting nucleic acid, using the large-volume sample free nucleic acid extraction kit according to claim 1, characterized in that: The steps include: Sample preparation: Collect samples and centrifuge them for later use; Lysis: Take the sample to be used, the lysis solution, and the proteinase K solution, mix them evenly, and lyse them to obtain a lysed mixed solution; Magnetic bead binding: Add binding solution and magnetic beads to the lysed mixture, mix well, and incubate; Rinsing: After the incubation, the magnetic beads are left, and rinsing solution 1 containing anhydrous ethanol is added to the magnetic beads. After rinsing, the magnetic beads are left, and rinsing solution 2 containing anhydrous ethanol is added to the magnetic beads. After rinsing, the magnetic beads are left, and rinsing solution 2 containing anhydrous ethanol is added to the magnetic beads. Elution: After rinsing, the magnetic beads are left, and elution solution is added to the magnetic beads. After elution, the nucleic acid solution is collected.

3. The method for extracting nucleic acid according to claim 2, characterized in that: When preparing samples, take the samples collected in the preservation tubes, including whole blood, plasma, urine, and pleural and abdominal fluid samples. After the samples are fully mixed, first centrifuge at 1500 g-1600 g to obtain the supernatant, then centrifuge at 15000 g-16000 g to remove impurities in the samples and obtain the supernatant. The samples are collected and centrifuged for standby use.

4. The method for extracting nucleic acid according to claim 2, characterized in that: During lysis, take 1-4 mL of the sample to be used, lysis solution, and proteinase K solution, mix them, and lyse for 12-18 minutes to obtain a lysed mixed solution; during magnetic bead binding, add binding solution and magnetic beads to the lysed mixed solution, mix them, and incubate for 12-18 minutes; among them, the volume ratio of magnetic beads, proteinase K solution, sample to be used, lysis solution, and binding solution is 1.5:10:100:80:

120.

5. The method for extracting nucleic acid according to claim 2, characterized in that: During rinsing, after the incubation is completed, leave the magnetic beads and add 750 μL-800 μL of rinsing solution 1 containing anhydrous ethanol to the magnetic beads to fully suspend the magnetic beads. After rinsing, leave the magnetic beads and add 750 μL-800 μL of rinsing solution 2 containing anhydrous ethanol to the magnetic beads to fully suspend the magnetic beads. After rinsing, leave the magnetic beads and add 750 μL-800 μL of rinsing solution 2 containing anhydrous ethanol to the magnetic beads.

6. The method for extracting nucleic acid according to claim 2, characterized in that: During elution, leave the magnetic beads after rinsing, dry them at room temperature for 5-10 min, add 30-80 μL of elution buffer to the magnetic beads to resuspend them, incubate them at 15-25 ℃ with low-speed shaking for 5-10 min, or gently shake them every 2 min to fully elute the nucleic acid, then let it stand and collect the nucleic acid solution after elution.

7. A method for extracting nucleic acid, using the large-volume sample free nucleic acid extraction kit according to claim 1, characterized in that: The steps include: Select a suitable fully automatic nucleic acid extractor, which includes a reagent strip and a magnetic rod sleeve, and the reagent strip includes well position 1, well position 2, well position 3, well position 4, and well position 5; Add 1-4 mL of sample, lysis buffer, and proteinase K solution to well 1, mix well, and lyse for 12-18 minutes. After lysis, add binding buffer and magnetic beads to well 1. Add 750 μL-800 μL of rinse solution 1 containing anhydrous ethanol to well 2; Add 750 μL-800 μL of rinse solution 2 containing anhydrous ethanol to well 3; Add 750 μL-800 μL of rinse solution 2 containing anhydrous ethanol to well 4; Add 55 μL-60 μL of elution buffer to well 5; After all reagents have been added, place the reagent strips in the experimental tray; Put the magnetic rod cover in place and run the program to obtain the nucleic acid solution.

8. The method for extracting nucleic acid according to claim 7, characterized in that: The volume ratio of magnetic beads, proteinase K solution, sample, lysis buffer, and binding solution is 1.5:10:100:80:

120.

9. A detection method for detecting a nucleic acid solution obtained according to the nucleic acid extraction method according to any one of claims 2 to 8, characterized in that: The method comprises the following steps: using a fluorescence quantitative instrument to measure the total amount of extracted DNA in a nucleic acid solution; The quality of nucleic acid after nucleic acid extraction was detected by real-time fluorescence quantitative PCR in combination with internal reference genes; the recovery efficiency of nucleic acid solution was detected by real-time fluorescence quantitative PCR in combination with exogenous nucleic acid.

10. The detection method according to claim 9, characterized in that: When detecting the quality of nucleic acid after nucleic acid extraction, it is necessary to detect it by TaqMan probe method, select human internal reference gene ACTB as the detection object, and design the forward primer ACTB-F, reverse primer ACTB-R and probe ACTB-P of the internal reference gene ACTB according to the sequence of the extracted DNA, wherein the sequence of the extracted DNA refers to SEQ ID NO.1, the forward primer ACTB-F refers to SEQ ID NO.2, the reverse primer ACTB-R refers to SEQID NO.3, and the probe ACTB-P refers to SEQ ID NO.4; When detecting the recovery efficiency of the nucleic acid solution, it is necessary to add exogenous nucleic acid to the sample. The exogenous nucleic acid is Lambda DNA, and the recovery of Lambda DNA is detected by the TaqMan probe method. According to the sequence of Lambda DNA, the forward primer Lambda-F, reverse primer Lambda-R and probe Lambda-P of Lambda DNA are designed, wherein the sequence of Lambda DNA refers to SEQ ID NO.5, the forward primer Lambda-F refers to SEQ ID NO.6, the reverse primer Lambda-R refers to SEQ ID NO.7, and the probe Lambda -P refers to SEQ ID NO.8.

Images