Tree salt stress resistance gene and application thereof

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to a tree salt stress resistance gene and application thereof. The nucleotide sequence of the tree salt stress resistance gene is as shown in SEQ ID NO. 1. The expression quantity of the gene is remarkably positively correlated with the salt resistance of the plant, and verification shows that after the MYB43 gene is over-expressed in the poplar, the salt resistance of the plant can be remarkably improved, and the growth characteristic of the plant is not inhibited, so that the MYB43 gene can be used for cultivating a high-yield, high-quality and salt-resistant new variety, and a new molecular tool is provided for genetic improvement of salt resistance of forest trees.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a tree salt stress resistance gene and application thereof. Background Art

[0002] Soil salinization seriously restricts agricultural and forestry production and is one of the key limiting factors for agricultural and forestry production and its sustainable development. Salt stress can cause primary stresses such as osmotic stress and ion toxicity, and high salt can also cause a series of secondary stresses such as oxidative stress and nutritional stress. The accumulation of multiple stresses can affect plant growth and metabolic processes. As sessile organisms, in order to reduce the harm of soil salinity and alkali stress, plants have evolved highly complex signal transduction pathways that enable them to cope with the harm caused by salt stress.

[0003] The V-myb avian myeloblastosis viral oncogene homolog (MYB) gene family is one of the largest transcription factor families in plants, and is involved in regulating plant growth and development, physiological metabolism, cell morphology and pattern building, and other physiological processes. However, there are few reports on the salt tolerance function of the MYB transcription factor family genes in Populus tomentosa. Summary of the invention

[0004] The object of the present invention is to provide a tree salt stress resistance gene and application thereof. The tree salt stress resistance gene can significantly improve the salt resistance of the plant after being overexpressed in poplar, and will not inhibit the growth characteristics of the plant.

[0005] The present invention provides a tree salt stress resistance gene, and the nucleotide sequence of the tree salt stress resistance gene is shown as SEQ ID NO.1.

[0006] The invention also provides the CDS sequence of the tree salt stress resistance gene.

[0007] The invention also provides application of the gene or the CDS sequence in tree resistance to salt stress.

[0008] The present invention also provides a pair of primers for amplifying the gene or the CDS sequence, wherein the forward nucleotide sequence of the primers is shown as SEQ ID NO.2; and the reverse nucleotide sequence of the primers is shown as SEQ ID NO.3.

[0009] The present invention also provides a recombinant vector, which contains the gene or the CDS sequence.

[0010] As a preferred embodiment, the basic skeleton of the recombinant vector includes pBI121 vector.

[0011] The invention also provides application of the recombinant vector in tree resistance to salt stress.

[0012] The present invention also provides a method for improving the resistance of trees to salt stress, comprising the following steps: overexpressing the gene or the CDS sequence in the genome of the target tree.

[0013] The present invention also provides the use of the gene, the CDS sequence or the recombinant vector in creating salt stress resistant germplasm resources, and overexpressing the gene or the CDS sequence in the genome of a target tree.

[0014] As a preferred embodiment, the trees include poplars, and the poplars include Populus tomentosa.

[0015] Beneficial effects: The present invention provides a tree salt stress resistance gene, the nucleotide sequence of which is shown in SEQ ID NO. 1. The expression of the gene is significantly positively correlated with the salt resistance of the plant. Verification has shown that the MYB43 gene can significantly improve the salt resistance of the plant after being overexpressed in poplars, and will not inhibit the growth characteristics of the plant. Therefore, it can be used to cultivate high-yield, high-quality, salt-resistant new varieties, providing a new molecular tool for genetic improvement of forest salt resistance.

[0016] The embodiments of the present invention show that after overexpressing the CDS sequence of the MYB43 gene in poplar, the salt resistance of the plant can be significantly improved, photosynthesis can be increased, and root development can be promoted, providing a new idea for breeding new salt-resistant poplar varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required to be used in the embodiments are briefly introduced below.

[0018] Figure 1 is the position where the CDS fragment of the MYB43 gene was connected to the pBI121 vector, where LB indicates the left border and RB indicates the right border;

[0019] Figure 2 Schematic diagram of gRNA connected to the vector;

[0020] Figure 3 Growth traits of wild-type poplar plants and MYB43-overexpressing positive plants;

[0021] Figure 4 The statistical results of plant height of wild-type poplar plants and MYB43-overexpressing positive plants;

[0022] Figure 5Growth traits of wild-type poplar plants and MYB43-overexpressing positive plants under 0mM, 50mM, 85mM and 100mM salt stress, and root development traits under 50mM salt stress;

[0023] Figure 6 Root cross sections of MYB43-overexpressing and MYB43-knockout poplars and wild-type controls. DETAILED DESCRIPTION

[0024]

[0025] The present invention also provides the CDS sequence of the tree salt stress resistance gene. As a specific embodiment, the CDS sequence of the tree salt stress resistance gene is as shown in SEQ ID NO.As shown in Figure 4: 5'-ATGGG AAGGCAACCATGTTGTGACAAAGTTGGGTTGAAGAAAGGGCCATGGACTTCTGATGAGGATAAGAAACTCATTACCTTCATCCTCGCTAATGGTCAATGTTGCTGGAGAGCTGTTCCTAAGCTTGCAGGATTGTTAAGGTGTGGGAAGAGTTGCAGGCTGAGATGGACAAACTATCTCAGGCCAGATTTGAAGAGAGGTCTTTTATCAGAATACGAAGAGAAGATGGTGATTGATCTCCACGCTCAACTTGGCAACAGATGGTCTAAGATTGCATCACATCTACCCGGCAGAACTGATAATGAAATCAAGAACCATTGGAATACTCACATCAAGAAAAAGTTAAGGAAAATGGGAATTGATCCTCTCACTCACAAGCCACTCTCTACCATTGAAACACCGCCGTCACCACCACCACAGCAAGAAGTTCAAGTGCAGGAGAAAATACAAGAAATAGAGCAGCAAGCTGTACAACAGTCTTGTTCCCCTAATATCGTATCTGAACTGGACCAAAATAAGGAACCTGAGACATCATTACGATCAACAGTAACTCAAGAGGAAGAGATCAATAACATGGCCGCAAGCACATATGGCACAATGGAGCAAACGGATGGTTTTTGCATAGATGAAGTTCCGCTAATTGAACCCCATGAAATCTTAGTCCCTTGTGGACTTTCTCCTTCATCAACCCCAGCCCCAACCTCTTCATCATCGTCATCGACATCATCTTCTTCTTCTTCATATGGTTCAAACAATATCCTTGAAGACTTGCTACTGCCAGATTTTGAATGGCCTATTAATAATGTCGACATTGGCTTGTGGGGTGATTACCTGAACAGTTGGGATGTGCTAATCAGTGATGCTGTCGGTGATTGGAAGCAAACAACAATGTTTGATCCTCCTCTCAATCAGTGCTCAAGAATGATATTGGATCAAGATTCTTGGACAAATGGGCTCTTGTGA-3'.

[0026] The invention also provides application of the gene or the CDS sequence in tree resistance to salt stress.

[0027] As a specific implementation, after overexpressing the CDS sequence of the MYB43 gene in poplars, the salt resistance of the plants can be significantly improved, and photosynthesis can be increased, root development can be promoted, and a new idea for breeding new salt-resistant poplar varieties is provided. The salt can be NaCl.

[0028] The present invention also provides a pair of primers for amplifying the gene or the CDS sequence, wherein the forward nucleotide sequence of the primers is shown as SEQ ID NO.2; and the reverse nucleotide sequence of the primers is shown as SEQ ID NO.3.

[0029] The sequences of the primers of the present invention are as follows:

[0030] Forward primer (SEQ ID NO. 2): 5'-ATGGGAAGGCAACCATGTTGTG-3',

[0031] Reverse primer (SEQ ID NO. 3): 5'-TCACAAGAGCCCATTTGTCCAAG-3'.

[0032] The present invention also provides a recombinant vector, which contains the gene or the CDS sequence. After the recombinant vector is transferred into a plant, the MYB43 gene can be overexpressed in the plant, thereby improving the salt resistance of the plant.

[0033] As a preferred embodiment, the basic skeleton of the recombinant vector includes pBI121 vector.

[0034] The present invention also provides the use of the recombinant vector in tree resistance to salt stress. As a specific embodiment, overexpression of the MYB43 gene has a significant promoting effect on the height trait of poplars, indicating that the MYB43 gene can not only significantly improve the salt resistance of plants, but also promote the growth characteristics of plants.

[0035] The present invention also provides a method for improving the resistance of trees to salt stress, comprising the following steps: overexpressing the gene or the CDS sequence in the genome of the target tree. As a specific embodiment, the recombinant expression vector can be transformed into the cells of the target plant to overexpress the MYB43 gene. The transformation method can be Agrobacterium transformation; the Agrobacterium is preferably GV3101. By overexpressing the MYB43 gene in plants, new high-yield, high-quality, and salt-resistant varieties can be cultivated, which has great application value for the genetic improvement of forest salt resistance.

[0036] The present invention also provides the use of the gene, the CDS sequence or the recombinant vector in creating salt stress resistant germplasm resources, and overexpressing the gene or the CDS sequence in the genome of a target tree.

[0037] Unless otherwise specified, the present invention has no special requirements for the preparation raw materials, and commercially available products known to those skilled in the art can be used.

[0038] In order to further illustrate the present invention, a tree salt stress resistance gene and its application provided by the present invention are described in detail below in conjunction with examples, but they should not be construed as limiting the protection scope of the present invention.

[0039] Example

[0040] 1. MYB43 gene cloning

[0041] TIANGEN's RNAprep Pure Plant Total RNA Extraction Kit (DP432) was used to extract total RNA from Populus tomentosa "Yi Yang No. 3" (Ma Huandi. Cloning and genetic transformation of members of the sucrose synthase PtSS gene family of Populus tomentosa and analysis of wood properties differences of hybrid asexual lines of Populus tomentosa [D]. Beijing Forestry University, 2015.). For detailed operation steps, please refer to the kit manual. The extracted RNA was subjected to agarose gel electrophoresis, and the results showed clear and obvious bands, indicating that the quality of the extracted RNA met the standards for further testing. The concentration and quality (OD260 / 280 ratio) of the RNA were also tested, and the quality (OD260 / 280 ratio) was 1.9, indicating that the sample could be used for subsequent experiments. The TAKARA cDNA Synthesis Kit (PrimeScript TM IV 1st strand cDNA Synthesis Mix) was used to synthesize cDNA using plant total RNA as a template. The specific operation steps are shown in the product manual. The cDNA was stored at -20℃ for future use.

[0042] Using the full-strength gold high-fidelity gene cloning kit ( High Fidelity (HiFi) PCR SuperMix II (-dye) (AS131)) was used for gene amplification. In this example, the cDNA of Populus tomentosa "Yi Yang No. 3" was used as a template, and the CDS fragment of the MYB43 gene (SEQ ID NO. 4) was amplified by RT-PCR. The primers used for RT-PCR were:

[0043] Forward primer F: 5'-ATGGGAAGGCAACCATGTTGTG-3' (SEQ ID NO. 2);

[0044] Reverse primer R: 5'-TCACAAGAGCCCATTTGTCCAAG-3' (SEQ ID NO. 3).

[0045] The amplification system of RT-PCR is 25 μL, specifically: 10.0 μL of ultra-fidelity Taq enzyme, 0.5 μL of forward primer, 0.5 μL of reverse primer, 0.5 μL of buffer, 2.0 μL of cDNA template, and ddH2O to 25 μL; the PCR amplification conditions are: pre-denaturation at 94°C for 3 min; denaturation at 94°C for 10 s, annealing at 59°C for 60 s, extension at 72°C for 40 s, and 40 cycles; the amplified target fragment is detected by agarose gel electrophoresis, and the target fragment is excised and recovered using Tiangen's ordinary agarose gel DNA recovery kit. For specific operating instructions, please refer to the kit manual.

[0046] The CDS fragment of the MYB43 gene recovered from the gel was connected to the pEASY-T1 vector to obtain the T1-MYB43 vector. For specific operation steps, see the full-form gold pEASY-T1 ( The ligated vector was transformed into DH5α E. coli competent cells (Shanghai Weidi Biotechnology Co., Ltd. (DL1001M)) according to the instructions of the E. coli competent cells.

[0047] 2. Construction of MYB43 overexpression vector

[0048] (1) Enzyme digestion: Select BamH I as the restriction site to digest the overexpression vector pBI121 (Complete sequence of the binary vector pBI121 and its application in cloning T-DNA insertion from transgenic plants. DOI: 10.1023 / A: 1023475710642) and the T1-MYB43 vector containing the target gene. Incubate at 37°C for 3 hours to ensure that the cleavage reaction is completely cleaved. The pBI121 vector and T1-MYB43 vector cut by BamH I were detected by electrophoresis and recovered by gel cutting to obtain the linearized pBI121 vector and the CDS fragment of the MYB43 gene; the enzyme digestion system and method refer to the instructions of BamH I restriction endonuclease (NEWENGLAND Biolabs BamH I restriction endonuclease (R0136S)).

[0049] (2) Connection: Use The CDS fragment of MYB43 gene was ligated to the linearized pBI121 vector (see the position of CDS ligation in the vector for details). Figure 1 ) to obtain a ligation product. For detailed operations, refer to the kit instructions.

[0050] (3) Transformation: The ligation product was transformed into E. coli DH5α competent cells. The cells were transformed using the freeze-thaw method (Study on transformation efficiency of E. coli and Agrobacterium by different methods. Journal of Huaihai Institute of Technology (Natural Science Edition), 2007, (02): 55-58.). The transformation product was evenly spread on LB agar plates containing 50 mg / L kanamycin for culture.

[0051] (4) Screening: Resistant colonies were picked from the LB agar plate and PCR verification or sequencing was performed to confirm the correctness and direction of the inserted fragment.

[0052] Plasmid extraction and storage: Extract plasmids from verified positive colonies. Use the high-purity plasmid extraction kit (DP104) produced by Tiangen Company to extract the plasmid of the MYB43 overexpression vector, and store the plasmid of the MYB43 overexpression vector at -20°C.

[0053] 3. MYB43 overexpression vector genetic transformation

[0054] Place the competent Agrobacterium GV3101 (AC1001M) on ice, add 1 g of plasmid containing the MYB43 overexpression vector, mix well, and place on ice for 30 min; quickly cool in liquid nitrogen for about 1 min, then quickly transfer to a 37°C water bath to melt; add 1 mL of antibiotic-free YEB liquid culture medium at 28°C, 230 r / min for 4 h, resuspend the bacteria and spread them on a YEB plate containing 30 mg / L kanamycin, blow dry, and culture at 28°C for 48 h to obtain Agrobacterium containing the overexpression vector.

[0055] Select fresh and disease-free leaves of healthy poplar tissue culture seedlings as leaf disc transformation materials. After cleaning and disinfecting the surface of the leaves, cut them into small pieces or small pieces.

[0056] Agrobacterium containing the overexpression vector was cultured in LB medium at 28°C until the logarithmic growth phase.

[0057] The leaves were placed in the resuspended Agrobacterium solution for co-cultivation, and then the transformed leaf discs were transferred to differentiation medium (MS + 1.0 mg / L 6-BA and 0.1 mg / L NAA, pH adjusted to 5.8, agar 8g / L), the light cycle was set to 16h light / 8h dark, and the temperature was maintained at 25 ° C to promote stable transformation and expression of DNA.

[0058] Transplant new shoots from the differentiation medium to the rooting medium to promote plant formation. Use the overexpression vector pBI121 with a selective marker gene (resistant to kanamycin) (the pBI121 vector has kanamycin resistance and can grow normally on a medium containing kanamycin. Leaves that have not been successfully transformed do not contain the vector and therefore cannot grow on a kanamycin-resistant medium, ultimately achieving the purpose of screening positive plants.) to screen the transformed leaf discs to obtain transformed positive plants. Extract the DNA of the screened plants and perform PCR testing to confirm the presence of the exogenous gene, thereby verifying the successful introduction of the overexpression vector.

[0059] 4. Construction of MYB43 gene editing vector

[0060] (1) gRNA design: Use the online tool CRISPR-EG (http: / / skl.scau.edu.cn / targetdesign / ) to input the sequence of the MYB43 gene to design a gRNA targeting the gene. Select the first exon as the target site to improve the knockout efficiency. The final designed gRNA sequence is: 5'-ACCAGTGA CATATCTGAACTGGG-3' (SEQ ID NO.5).

[0061] (2) Vector construction: Select the CRISPR / Cas9 vector p2gR-TRI (ACRISPR / Cas9toolkit for multiplex genome editing in plants. https: / / doi.org / 10.1186 / s12870-014-0327-y) suitable for plant cells. Figure 2 As shown, gRNA is connected to the vector, and the insertion sites are: Target-Sense: 5'-TTG-gRNAsense; Target-Anti: 5'-AAC-gRNA anti. The knockout vector is obtained. The method for constructing the knockout vector is the same as the method in "2. Constructing the MYB43 overexpression vector".

[0062] 5. Genetic transformation of MYB43 gene editing vector

[0063] The genetic transformation method of MYB43 gene editing vector is the same as the method of “3. Genetic transformation of MYB43 overexpression vector”.

[0064] 6. MYB43 overexpression improves salt resistance in poplar plants

[0065] When the MYB43 overexpressing poplar transgenic plants and wild-type poplar plants (plants without foreign genes) reached 4 weeks old, their tissue culture seedlings were removed from the culture medium, transplanted into pre-prepared soil, and placed in a poplar culture room for 16 weeks of soil culture. Figure 3 and Figure 4 As shown. Figure 3 and Figure 4 It can be seen that overexpression of the MYB43 gene has a significant promoting effect on the vertical growth of poplar.

[0066] The MYB43 overexpressing plants and wild-type poplar plants were subcultured for one month, and the top buds were selected and placed in a culture medium containing different concentrations of NaCl for sterile culture. The wild type (plants without foreign genes) and the overexpressing strains were subjected to salt stress treatment of 0mM, 50mM, 85mM and 100mM NaCl (the salt concentration is the concentration in the culture medium) for 7 days. Figure 5 As shown, poplars overexpressing the MYB43 gene can grow normally under 50mM NaCl salt treatment compared with the wild-type control. As the salt concentration increases, the lateral roots of the poplars overexpressing the MYB43 gene are more developed than the control.

[0067] Root cross sections of two-month-old MYB43-overexpressing and MYB43-knockout poplars and wild-type controls revealed that Figure 6 As shown in the figure, the red arrow indicates the endodermal cells in the root, and the black arrow indicates the pericycle cells. The endodermal cells and pericycle cells have an impact on the development of lateral roots. Lateral roots are usually densely covered with root hairs. The presence of root hairs further increases the absorption area, which can more effectively absorb water and dissolved mineral elements in the soil, and then transport these nutrients to the aboveground parts of the plant to support the growth and development of organs such as leaves and stems. In poplars that overexpress the MYB43 gene, the endodermal and pericycle cells of the roots are enlarged relative to the control, and show a phenotype of increased lateral roots under salt stress. However, the endodermal and pericycle cells of the roots of MYB43-knocked poplars are retarded in development, affecting the generation of lateral roots and, in turn, affecting the development of the plant.

[0068] It can be seen that after overexpression of the MYB43 gene in poplar, the salt resistance of the plant can be significantly improved, and the growth characteristics of the plant will not be inhibited. Its changes in the roots are the key to resisting salt stress. The lateral roots regulated in the endodermis and pericycle cells increase, which enhances the absorption and utilization efficiency of water and nutrients by the root system under stress. The high salt resistance of the MYB43 gene provided by the present invention provides a new idea for cultivating new salt-tolerant poplar varieties.

[0069] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A tree salt stress resistance gene, characterized in that: The nucleotide sequence of the tree salt stress resistance gene is shown as SEQ ID NO.

1.

2. The CDS sequence of the tree salt stress resistance gene according to claim 1.

3. Use of the gene according to claim 1 or the CDS sequence according to claim 2 in resisting salt stress in trees.

4. A pair of primers for amplifying the gene according to claim 1 or the CDS sequence according to claim 2, characterized in that: The forward nucleotide sequence of the primer is shown in SEQ ID NO.2; the reverse nucleotide sequence of the primer is shown in SEQ ID NO.

3.

5. A recombinant vector, characterized in that: The recombinant vector comprises the gene according to claim 1 or the CDS sequence according to claim 2.

6. The recombinant vector according to claim 5, characterized in that The basic framework of the recombinant vector includes pBI121 vector.

7. Use of the recombinant vector according to claim 5 or 6 in resisting salt stress in trees.

8. A method for improving the resistance of trees to salt stress, characterized in that: The following steps are involved: Overexpressing the gene described in claim 1 or the CDS sequence described in claim 2 in the genome of a target tree.

9. Use of the gene according to claim 1, the CDS sequence according to claim 2 or the recombinant vector according to claim 5 in creating germplasm resources resistant to salt stress, characterized in that: Overexpressing the gene described in claim 1 or the CDS sequence described in claim 2 in the genome of a target tree.

10. The use according to claim 9, characterized in that: The trees include poplars, and the poplars include Populus tomentosa.

Images