Plasmid pHT01-P43-CI857-PR-PdxT-PdxS as well as preparation method and application thereof

Abstract

The invention relates to a plasmid pHT01-P43-CI857-PR-PdxT-PdxS, a preparation method of the plasmid, bacillus subtilis containing the plasmid and application of the bacillus subtilis in expression of pyridoxal phosphate (PLP), and belongs to the field of gene engineering. Aiming at the problem of low production efficiency of pyridoxal phosphate in the prior art, key factors required by high-efficiency expression of pyridoxal phosphate are realized by constructing plasmids containing a temperature-sensitive transcription factor CI857, a specific promoter and PdxS and PdxT genes of bacillus subtilis SCK6. The method comprises the following steps: firstly, obtaining a basic plasmid pHT01-P43, then sequentially inserting CI857, PR-PdxT and PdxS gene segments, and finally obtaining a target plasmid. When the plasmid is transferred into bacillus subtilis, the yield of pyridoxal phosphate can be obviously improved. The invention provides an efficient and stable production method of pyridoxal phosphate, which is of great significance to industrial production and scientific research.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and relates to a plasmid pHT01-P 43 -CI 857 -P R -PdxT-PdxS and its preparation method and application. Background Art

[0002] Pyridoxal phosphate (PLP) is the biologically active form of vitamin B6. It participates in the metabolism of amino compounds and acts as a cofactor in more than 150 enzymatic reactions. Enzymes that use it as a coenzyme are called PLP-dependent enzymes, which account for approximately 4% of known enzymes.

[0003] Currently, vitamins on the market are mainly sold in the form of pyridoxine hydrochloride, and the synthesis method is mainly chemical synthesis. There are many methods for chemically synthesizing vitamin B6, such as the pyridone method, the alkynyl ether method, and the oxazole method. However, chemical synthesis has problems such as complex steps, reaction conditions, and chemical raw materials that pose a great threat to the environment during the production process. Therefore, microbial synthesis methods with milder reaction conditions and more environmentally friendly production processes are more attractive than chemical synthesis methods.

[0004] Vitamin B6 contains six compounds, and there are two synthetic pathways in organisms. They are the 5-phosphate deoxyxylulose (DXP) dependent pathway and the DXP independent pathway. Among the microorganisms that can produce vitamin B6, the metabolic pathway of Bacillus subtilis is clear, and there are many studies on its metabolic transformation. It has been widely used in the production of industrial enzymes and chemicals. Bacillus subtilis grows faster and has a strong ability to secrete homologous proteins, which is conducive to large-scale fermentation. In addition, Bacillus subtilis is a biosafe microorganism that meets the safety microorganisms recognized by the US Food and Drug Administration, so it is suitable as a starting strain for the production of vitamin B6. The natural production pathway of vitamin B6 in Bacillus subtilis is a DXP-independent pathway, which involves two rate-limiting enzymes PdxS and PdxT, and the direct product is pyridoxal phosphate PLP. However, in the process of using Bacillus subtilis to produce pyridoxal phosphate, the expression levels of the key enzymes PdxS and PdxT and their regulatory mechanisms become key factors restricting production.

[0005] During the transformation of the strain, the temperature-sensitive element λCI 857 / P R Widely used, variant CI from the CI gene of λ phage 857 and its corresponding P R The promoter can respond to temperature changes. 857 Forms dimers and binds to the promoter to block transcription; at high temperatures, CI 857The inactivated dimer disengages from the promoter binding site, turning on gene transcription. Summary of the invention

[0006] In view of this, the present invention provides a novel plasmid pHT01-P43-CI857-PR-PdxT-PdxS, which integrates the thermosensitive transcription factor CI857, specific promoters P43 and PR, and PdxS and PdxT genes from Bacillus subtilis SCK6. Through genetic engineering means, the efficient expression of PdxS and PdxT genes in Bacillus subtilis is achieved, thereby increasing the yield of pyridoxal phosphate.

[0007] In order to achieve the above object, the present invention provides the following technical solutions:

[0008] The present invention provides a plasmid pHT01-P 43 -CI 857 -P R -PdxT-PdxS, the plasmid sequence is shown in SEQ ID NO.1;

[0009] The plasmid contains the temperature-sensitive transcription factor CI 857 , promoter P 43 , promoter P R , PdxS and PdxT genes of Bacillus subtilis SCK6;

[0010] Thermosensitive transcription factor CI 857 The nucleotide sequence is shown in SEQ ID No. 2;

[0011] The promoter P 43 , P R The nucleotide sequences are shown in SEQ ID No. 3 and SEQ ID No. 4;

[0012] The nucleotide sequence of the PdxS is shown in SEQ ID No.5, and the nucleotide sequence of the PdxT is shown in SEQ ID No.6;

[0013] Further, the preparation method of the plasmid is as follows:

[0014] S1: Amplification of plasmid pHP13-P 43 Get P 43 The promoter was expressed in plasmid pHT01 and P 43 The promoter was double-digested, ligated with T4 ligase, transformed into competent cells, and sequenced to obtain plasmid pHT01-P. 43 ,

[0015] S2: KpnI and BamHI were used to double-digest the plasmid pHT01 and the synthetic RBS-CI 857 Gene fragments, ligated and transformed competent cells, and sequenced to obtain plasmid pHT01-CI 857 ,

[0016] S3: Amplify the PdxS and PdxT genes in the SCK6 genome, use primers to add RBS sequences before PdxS and PdxT, and add P before RBS-PdxT. R Promoter, and insert BamHI, SmaI restriction sites, double restriction enzyme digestion plasmid pHT01-CI 857 With P R -RBS-PdxT gene fragments were ligated with T4 ligase, transformed into competent cells, and sequenced to obtain plasmid pHT01-CI 857 -P R -PdxT,

[0017] S4: Amplification CI 857 -P R -PdxT sequence fragment, and the plasmid pHT01-P was cut with PstI 43 , the plasmid pHT01-P 43 With CI 857 -P R -PdxT sequence fragments were connected by seamless cloning, transformed into competent cells and sequenced to screen plasmid pHT01-P 43 -CI 857 -P R -PdxT,

[0018] S5: Cut the plasmid pHT01-P with SmaI 43 -CI 857 -P R -PdxT, amplify the RBS-PdxS sequence with homology arms, connect them with seamless cloning enzyme, transform competent cells, and sequence and screen the plasmid pHT01-P 43 -CI 857 -P R -PdxT-PdxS;

[0019] The present invention also provides a Bacillus subtilis containing the plasmid;

[0020] The application of the Bacillus subtilis in expressing pyridoxal phosphate PLP.

[0021] The beneficial effects of the present invention are:

[0022] This innovative plasmid design provides new ideas and methods for solving the technical problem of low efficiency in pyridoxal phosphate production, achieving efficient expression of PdxS and PdxT genes in Bacillus subtilis, thereby increasing the production of pyridoxal phosphate, and achieving easy-to-control expression through the addition of temperature-sensitive elements.

[0023] Other advantages, objectives and features of the present invention will be described in the following description to some extent, and to some extent, will be obvious to those skilled in the art based on the following examination and study, or can be taught from the practice of the present invention. The objectives and other advantages of the present invention can be realized and obtained through the following description. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to make the purpose, technical solutions and advantages of the present invention more clear, the present invention will be described in detail below in conjunction with the accompanying drawings, wherein:

[0025] Figure 1 Plasmid pHT01-P 43 -CI 857 -P R -PdxT-PdxS structure diagram;

[0026] Figure 2 Plasmid pHT01-P 43 -CI 857 -P R -PdxT-PdxS electropherogram;

[0027] Figure 3 This is a graph showing the changes in PLP production of different strains under different temperature culture conditions. DETAILED DESCRIPTION

[0028] The following describes the embodiments of the present invention by specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention. It should be noted that the illustrations provided in the following embodiments only illustrate the basic concept of the present invention in a schematic manner, and the following embodiments and features in the embodiments can be combined with each other without conflict.

[0029] Among them, the drawings are only used for illustrative explanations, and they only represent schematic diagrams rather than actual pictures, and should not be understood as limitations on the present invention. In order to better illustrate the embodiments of the present invention, some parts of the drawings may be omitted, enlarged or reduced, and do not represent the size of actual products. For those skilled in the art, it is understandable that some well-known structures and their descriptions in the drawings may be omitted.

[0030] The same or similar numbers in the drawings of the embodiments of the present invention correspond to the same or similar parts; in the description of the present invention, it should be understood that if the terms "upper", "lower", "left", "right", "front", "rear", etc. indicate the orientation or position relationship, they are based on the orientation or position relationship shown in the drawings, which is only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operate in a specific orientation. Therefore, the terms describing the position relationship in the drawings are only used for illustrative purposes and cannot be understood as limiting the present invention. For ordinary technicians in this field, the specific meanings of the above terms can be understood according to specific circumstances.

[0031] Example 1

[0032] In the present invention, P 43 Strong promoter overexpression CI 857 Temperature-sensitive protein, using P R The promoter expression comes from the PdxS (Gene ID: 939988) and PdxT (Gene ID: 939971) genes in Bacillus subtilis. The Bacillus subtilis uses SCK6 as the starting strain, uses the Escherichia coli-Bacillus subtilis shuttle plasmid pHT01 as the vector, and selects the strong constitutive promoter P 43 Expression of the temperature-sensitive protein CI on pHT01 857 , P R The promoter-controlled PdxS and PdxT genes were inserted into the CI 857 After the gene was identified, different RBS sequences were designed on the RBS Calculator website (https: / / salislab.net / ) and the CI 857 The target strain was obtained by PCR amplification of the ribosome binding site (RBS) sequence of PdxS, PdxT genes.

[0033] The strains and plasmids involved in the present invention: Escherichia coli DH5α chemically competent cells were purchased from Sangon Biotechnology (Stock) Co., Ltd., Bacillus subtilis SCK6 strain was donated by Professor Shi Ting of Tianjin Institute of Industrial Biotechnology, University of Chinese Academy of Sciences, and plasmid pHT01 was purchased from Miaoling Biotechnology Co., Ltd.

[0034] Plasmid pHT01-P 43 Construction: Primers were used from pHP13-P 43 P 43 The promoter was cleaved by BsiWI and BamHI endonucleases, respectively. 43The fragments were double-digested at 30℃ and 55℃ for 1.5h respectively, with a digestion system of 50μL. After digestion, the product was recovered with a PCR product recovery kit and connected with T4 ligase at 4℃ overnight. Take 4μL of the ligation product and add it to the melted 100mL E. coli DH5α competent medium and gently rotate to mix. After ice bathing for 30min, heat shock at 42℃ for 60s, and then place on ice for 2min. Add 700μL of antibiotic-free LB liquid culture medium, culture at 37℃, 220rpm shaking table for 45min, centrifuge at 6000rpm for 2min, discard the excess 700mL LB, resuspend the enriched bacteria, spread on the ampicillin-resistant LB plate, and culture at 37℃ overnight in an incubator. Pick a single colony for colony and bacterial liquid PCR the next day, and send the positive transformant to Sangon Biotech (Shanghai) Co., Ltd. for sequencing. The correctly sequenced vector is named pHT01-P 43 .

[0035] Primer sequences:

[0036] P 43 -F:gttcgtacgaagcttgcggcttccttgtagagc

[0037] P 43 -R: cgcggatccgtcgacctgcagcatgtg

[0038] RBS-CI synthesized by Qingke Biotechnology Co., Ltd. was used as a primer 857 After the sequence was amplified, pHT01 and RBS-CI were double-digested with KpnI and BamHI. 857 Gene fragments, after the digestion products were recovered, they were ligated with T4 ligase at 4°C overnight, transformed into E. coli DH5α chemical competent cells, and the positive transformants were selected for sequencing. The transformants with correct sequencing were named pHT01-CI 857 According to the sequences published in NCBI, primers for PdxS and PdxT were designed. PdxS and PdxT were amplified from the SCK6 genome using primers. RBS sequences were added before PdxS and PdxT using primers. R The promoter was added in front of RBS-PdxT and BamHI and SmaI restriction sites were inserted into the fragment. pHT01-CI was double-digested 857 Plasmid and P R -RBS-PdxT gene fragment was recovered and ligated with T4 ligase at 4°C overnight, transformed into E. coli DH5α chemical competent cells and selected positive transformants for sequencing. The transformants with correct sequencing were named pHT01-CI 857 -P R -PdxT.

[0039] Primer sequences:

[0040] CI 857 -F:cggggtaccggaccgccacggcttagggtctatt

[0041] CI 857 -R: cgcggatcctcagccaaatgtctcttcaggcca

[0042] PdxT-F:atgttaacaataggtgtactaggacttcaaggagcag

[0043] PdxT-R:cgcgttatacaagtgccttttgctttatattcctcaacc

[0044] RBS-PdxT-F:ccccaaacgggaaaaaagggggtttattaaatgttaacaataggtgtactagg

[0045] PR-RBS-PdxT-F:gtgcgtgttgactattttacctctggcggtgataatggttgcatgtactaaggaggttgccccaaacgggaaaaaagggggt

[0046] BamHI-PdxT-F:cgcggatccgtgcgtgttgactattttacct

[0047] SmaI-PdxT-R:tcccccgggttatacaagtgccttttgctt

[0048] CI 857 The RBS sequence of the gene is preferably ggaccgccacggcttagggtctatttatacaacaaaggaggtatttatt,

[0049] The RBS sequence of the PdxS gene is preferably gtcgtgcaaacgaaaaaggaggtaattatt,

[0050] The RBS sequence of the PdxT gene is preferably ccccaaacgggaaaaaagggggtttattaa.

[0051] CI 857 -P R -PdxT was amplified and pHT01-P was digested with PstI 43 Plasmid, linearized plasmid and CI 857-P R -PdxT fragments were recovered and connected together using seamless cloning enzyme at 50℃ for 15min. After transformation into E. coli DH5α, positive transformants were selected for sequencing. The plasmid with the correct sequencing was named pHT01-P 43 -CI 857 -P R -PdxT.

[0052] Primer sequences:

[0053] IF CI-F:agagaggaatgtacacatgctgcaggaccgccacggcttagg

[0054] IF PdxT-R:actctagaggatccgtcgacctgcagttatacaagtgccttttgctttatattcctcaac

[0055] Digestion of pHT01-P with SmaI 43 -CI 857 -P R -PdxT plasmid, use primers to amplify RBS-PdxS with homology arms, connect them with seamless cloning enzyme and transform Escherichia coli DH5α, select positive transformants for sequencing, and the sequencing results prove that plasmid pHT01-P 43 -CI 857 -P R -PdxT-PdxS is built successfully, the structure diagram is as follows Figure 1 As shown, the electrophoresis diagram is Figure 2 shown.

[0056] Primer sequences:

[0057] IF PdxS-F:agatcctctagagtcgacgtccccgtcgtgcaaacgaaaaaggagg

[0058] IF PdxS-R:ccgctcattaggcgggctgccccgggttaccagccgcgttcttgc

[0059] Example 2

[0060] The resulting plasmid pHT01-P 43 -CI 857 -P R-PdxT-PdxS was transformed into Bacillus subtilis SCK6. The specific transformation method was as follows: after streaking the Bacillus subtilis SCK6 strain, a single colony was picked and cultured overnight in LB medium containing 1 μg / ml, and the OD of the overnight cultured SCK6 bacterial solution was adjusted with LB containing 1% xylose. 600 , so that OD 600 =1, 37℃, 200rpm culture for 2h to make it competent. Take 1μL of the target plasmid and transform it into 100mL competent SCK6, culture it in a shaking table at 37℃, 200rpm for 1.5h, spread it on a chloramphenicol resistance plate and culture it overnight, perform colony PCR and bacterial liquid PCR, pick out the positive transformants, and name the strain SCK6-MT.

[0061] Shake flask fermentation process: Fermentation medium components (12g / L yeast powder, 6g / L tryptone, 12.5g / L K2HPO4·3H2O, 2.5g / L KH2PO4, 10mL trace element solution, 10g / L lactose, 20g / L sucrose). Trace element solution formula (4g / LFeSO4·7H2O, 4g / L CaCl2, 1g / L MnSO4·5H2O, 0.4g / L CoCl2·6H2O, 0.2g / L NaMoO4·2H2O, 0.2g / L ZnSO4·7H2O, 0.1g / L AlCl3·6H2O, 0.1g / L CuCl2·H2O, 0.05g / L H3BO4). The production strain seed solution was cultured at 30°C for 10h. Then, 5% (v / v) was inoculated into a 250 mL baffled shake flask for fermentation, with a liquid volume of 50 mL, a rotation speed of 220 rpm, a temperature of 37° C., and a fermentation period of 72 h.

[0062] High performance liquid chromatography detection method for pyridoxal phosphate: prepare a gradient of pyridoxal phosphate PLP standard (0.1 mg / L, 1 mg / L, 10 mg / L, 20 mg / L, 50 mg / L).

[0063] The pHT01-P 43 -CI 857 -P R The target SCK6 strain of -PdxT-PdxS plasmid was cultured in a shaking table at the corresponding temperature and 200rpm. A certain amount of bacterial liquid was taken, centrifuged at 3700rpm for 5-10min, diluted 30 times and dissolved in aqueous solution, passed through a 0.22μm water membrane, and C18 was used as a chromatographic column to filter the organic phase. The wavelength of the ultraviolet detector was 319nm and the flow rate was 0.5mL / min. Under this condition, a standard curve was drawn and the content of pyridoxal phosphate (PLP) in the sample was detected. The expression level was as follows Figure 3 shown.

[0064] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the purpose and scope of the technical solution, which should be included in the scope of the claims of the present invention.

Claims

1. Plasmid pHT01-P 43 -CI 857 -P R -PdxT-PdxS, characterized by: The plasmid sequence is shown as SEQ ID NO.

1.

2. The plasmid according to claim 1, characterized in that: The plasmid contains the temperature-sensitive transcription factor CI 857 , promoter P 43 , promoter P R , PdxS and PdxT genes of Bacillus subtilis SCK6.

3. The plasmid according to claim 2, characterized in that: Thermosensitive transcription factor CI 857 The nucleotide sequence is shown in SEQ ID No.

2.

4. The plasmid according to claim 2, characterized in that: The promoter P 43 , P R The nucleotide sequences are shown in SEQ ID No. 3 and SEQ ID No.

4.

5. The plasmid according to claim 2, characterized in that: The nucleotide sequence of the PdxS is shown in SEQ ID No.5, and the nucleotide sequence of the PdxT is shown in SEQ ID No.

6.

6. The plasmid according to claim 1, characterized in that: The preparation method is as follows: S1: Amplification of plasmid pHP13-P 43 Get P 43 The promoter was expressed in plasmid pHT01 and P 43 The promoter was double-digested, ligated with T4 ligase, transformed into competent cells, and sequenced to obtain plasmid pHT01-P. 43 , S2: KpnI and BamHI were used to double-digest the plasmid pHT01 and the synthetic RBS-CI 857 Gene fragments, ligated and transformed competent cells, and sequenced to obtain plasmid pHT01-CI 857 , S3: Amplify the PdxS and PdxT genes in the SCK6 genome, use primers to add RBS sequences before PdxS and PdxT, and add P before RBS-PdxT. R Promoter, and insert BamHI, SmaI restriction sites, double restriction enzyme digestion plasmid pHT01-CI 857 With P R -RBS-PdxT gene fragments were ligated with T4 ligase, transformed into competent cells, and sequenced to obtain plasmid pHT01-CI 857 -P R -PdxT, S4: Amplification CI 857 -P R -PdxT sequence fragment, and the plasmid pHT01-P was cut with PstI 43 , the plasmid pHT01-P 43 With CI 857 -P R -PdxT sequence fragments were connected by seamless cloning, transformed into competent cells and sequenced to screen plasmid pHT01-P 43 -CI 857 -P R -PdxT, S5: Cut the plasmid pHT01-P with SmaI 43 -CI 857 -P R -PdxT, amplify the RBS-PdxS sequence with homology arms, connect them with seamless cloning enzyme, transform competent cells, and sequence and screen the plasmid pHT01-P 43 -CI 857 -P R -PdxT-PdxS.

7. Bacillus subtilis containing the plasmid according to claim 1.

8. Use of the Bacillus subtilis according to claim 7 in expressing pyridoxal phosphate PLP.

Images