Integrated PCSK9 adenine base editing system and application

Abstract

The invention belongs to the technical field of biological medicine, and particularly relates to an integrated PCSK9 adenine base editing system and application. The integrated PCSK9 adenine base editing system comprises the following structures: (1) a single plasmid; (2) a PCSK9 adenine base editor; and (3) delivering the carrier. Wherein the single plasmid and the PCSK9 adenine base editor form a single plasmid integrated adenine base editor, and then the single plasmid integrated adenine base editor is wrapped by the delivery carrier to form the integrated PCSK9 adenine base editing system. The invention provides an integrated base editing system with a built-in liver specific promoter, the integrated base editing system can be specifically expressed in liver cells, and meanwhile, the problems that double-stranded DNA needs to be cut off in a traditional Crispr / gRNA technology, and the off-target effect and uncertainty of gene editing are greatly relieved are solved; in addition, the problems that in a traditional double-plasmid system, the efficiency of two plasmids entering the same target cell is different, and the editing efficiency is low can be solved.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an integrated PCSK9 adenine base editing system and application. Background Art

[0002] Liver cancer is one of the most common malignant tumors, and its mortality rate ranks second among all malignant tumors. my country is a country with a high incidence of liver disease, and its liver cancer deaths account for more than 50% of the world's total. The severe situation has brought a heavy burden to society and medical care. Clinical liver cancer treatment is mainly based on surgery, radiotherapy, and immunotherapy. Currently, mainstream medicine believes that improving patient survival rates through immunotherapy is an important means of treating liver cancer. However, in practice, many patients show low response to immunotherapy drugs and rapid drug resistance, resulting in unsatisfactory prognosis.

[0003] Proprotein Convertase Subtilisin / kexin Type 9 (PCSK9) is a serine protease mainly secreted by hepatocytes. Recent studies have reported that PCSK9 protein is a new tumor immunosuppressive molecule that reduces the efficacy of immune checkpoint therapy. There have been reports that combined PCSK9 monoclonal antibodies can significantly improve the tumor-killing effect of PD1 antibodies, but PCSK9 monoclonal antibodies have strong allergic reactions and cause adverse reactions. At the same time, the PCSK9 protein bound by the antibody cannot be quickly eliminated from the body, resulting in a large amount of PCSK9 protein accumulation in the body, reducing its effect of improving immunotherapy. In recent years, gene editing therapy has achieved success in many clinical trials in the field of tumors, and researchers are committed to finding new solutions from the gene editing level. However, traditional Crispr / gRNA technology requires cutting double-stranded DNA, which greatly increases the off-target effect and uncertainty of gene editing. In addition, the dual-plasmid base editing system is composed of two plasmids that separately express Cas protein and gRNA. The dual-plasmid adenine base editing system can edit the target gene in vivo and in vitro, but because the two plasmids have different efficiencies in entering the same target cell, the efficiency of the dual-plasmid editing system is greatly limited.

[0004] For example, the patent with publication number CN114686456A and invention title “Base editing system based on bimolecular deaminase complementation and its application” discloses a system mainly composed of base editing fusion proteins A, B and guide RNA with dual complementarity of nCas9 and nuclear base deaminase, which reduces the problem of off-target of traditional editors. However, the patented technical solution is composed of three components: dual complementary base editing fusion proteins A, B and guide RNA, and the three components need to reach the target cell at the same time to produce an editing effect. However, in the actual treatment of humans and animals, the efficiency of multiple components entering a cell at the same time and producing an effect is extremely low. At the same time, safe and efficient carriers are also needed for the in vivo and in vitro delivery of plasmid editors to truly achieve good effects in cells. Therefore, it is necessary to propose new methods and strategies. Summary of the invention

[0005] In view of this, the purpose of the present invention is to provide an integrated PCSK9 adenine base editing system and its construction method and application, so as to partially solve or alleviate the above-mentioned deficiencies in the prior art. The present invention specifically adopts the following technical solutions.

[0006] On the one hand, the present invention provides an integrated PCSK9 adenine base editing system.

[0007] All-in-one PCSK9 adenine base editing system, including the following structures:

[0008] (1) Single plasmid;

[0009] (2) a PCSK9 adenine base editor, comprising a U6 promoter structure, a TBG promoter structure, an AmpR promoter structure and a plasmid backbone region;

[0010] Wherein, the U6 promoter structure comprises a gRNA targeting PCSK9; the gRNA targeting PCSK9 comprises a sequence selected from any one of SEQ ID NO.3 and SEQ ID NO.12-28;

[0011] Wherein, the TBG promoter structure comprises a liver-specific TBG promoter sequence and a CRIPSR / Cas9 ABE protein;

[0012] The single plasmid and the PCSK9 adenine base editor form a single plasmid integrated adenine base editor;

[0013] (3) delivery vehicle;

[0014] The single-plasmid integrated adenine base editor is encapsulated by the delivery vector to form the integrated PCSK9 adenine base editing system.

[0015] Preferably, the gRNA targeting PCSK9 includes a sequence selected from any one of SEQ ID NO.3, SEQ ID NO.12, SEQ ID NO.13, SEQ ID NO.14, SEQ ID NO.15, SEQ ID NO.16, SEQ ID NO.17, SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22, SEQ ID NO.23, SEQ ID NO.24, SEQ ID NO.25, SEQ ID NO.26, SEQ ID NO.27 or SEQ ID NO.28.

[0016] Optionally, the present invention can also provide an integrated PCSK9 adenine base editing system.

[0017] All-in-one PCSK9 adenine base editing system, including the following structures:

[0018] (1) Single plasmid;

[0019] (2) a PCSK9 adenine base editor, comprising a U6 promoter structure, a TBG promoter structure, an AmpR promoter structure and a plasmid backbone region;

[0020] Wherein, the U6 promoter structure comprises a gRNA targeting PCSK9; the gRNA targeting PCSK9 is a gRNA of mouse PCSK9, including a sequence selected from any one of SEQ ID NOs. 12-19;

[0021] Wherein, the TBG promoter structure comprises a liver-specific TBG promoter sequence and a CRIPSR / Cas9 ABE protein;

[0022] The single plasmid and the PCSK9 adenine base editor form a single plasmid integrated adenine base editor;

[0023] (3) delivery vehicle;

[0024] The single-plasmid integrated adenine base editor is encapsulated by the delivery vector to form the integrated PCSK9 adenine base editing system.

[0025] Optionally, the present invention can also provide an integrated PCSK9 adenine base editing system.

[0026] All-in-one PCSK9 adenine base editing system, including the following structures:

[0027] (1) Single plasmid;

[0028] (2) a PCSK9 adenine base editor, comprising a U6 promoter structure, a TBG promoter structure, an AmpR promoter structure and a plasmid backbone region;

[0029] Wherein, the U6 promoter structure comprises a gRNA targeting PCSK9; the gRNA targeting PCSK9 is a gRNA of human PCSK9, including a sequence selected from any one of SEQ ID NOs. 20-28;

[0030] Wherein, the TBG promoter structure comprises a liver-specific TBG promoter sequence and a CRIPSR / Cas9 ABE protein;

[0031] The single plasmid and the PCSK9 adenine base editor form a single plasmid integrated adenine base editor;

[0032] (3) delivery vehicle;

[0033] The single-plasmid integrated adenine base editor is encapsulated by the delivery vector to form the integrated PCSK9 adenine base editing system.

[0034] Furthermore, the liver-specific TBG promoter sequence is shown as SEQ ID NO.5.

[0035] Furthermore, the delivery vector includes a nanocarrier, and the nanocarrier and the single-plasmid integrated adenine base editor form a stable complex through electrostatic interaction.

[0036] Furthermore, the nanocarrier is obtained by using vitamin E succinate polyethylene glycol 1000 as a hydrophobic end, polyethylene imine as a hydrophilic end, and a ROS-sensitive (reactive oxygen species-sensitive) ketal thiol linker covalently linked in the middle (between the hydrophobic end and the hydrophilic end).

[0037] The thioketal linkage is also called a ketethiolate bond or a ketal bond. It consists of two sulfur atoms, a carbonyl group, and a carbon atom.

[0038] Furthermore, the nanocarrier is compounded with the single-plasmid integrated adenine base editor at a mass ratio of 2-10:1.

[0039] Preferably, the mass ratio of the nanocarrier to the single-plasmid integrated adenine base editor includes 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1 or 10:1.

[0040] Furthermore, the delivery vector also includes liposome vectors and any other commercially available delivery vectors.

[0041] On the other hand, the present invention provides an application of the above-mentioned integrated PCSK9 adenine base editing system.

[0042] Application of the above-mentioned integrated PCSK9 adenine base editing system in the preparation of liver cancer targeted preparations.

[0043] The application of the above-mentioned integrated PCSK9 adenine base editing system in the preparation of immune cell immune efficacy enhancers.

[0044] Preferably, the immune cells include T cells and NK cells.

[0045] Furthermore, the integrated PCSK9 adenine base editing system is used to culture the immune cells in vitro to silence the PCSK9 gene in the immune cells.

[0046] A combination drug combination for targeted liver cancer treatment, the combination drug combination comprising the above-mentioned integrated PCSK9 adenine base editing system and immune cells.

[0047] Furthermore, the combined drug composition also includes other pharmaceutically feasible carriers and / or adjuvants.

[0048] The present invention can also provide a method for preparing the above-mentioned integrated PCSK9 adenine base editing system, which specifically comprises:

[0049] S01: Construction of a single-plasmid all-in-one adenine base editor;

[0050] S02: Synthetic delivery vector TPGS-TK-PEI;

[0051] S03: Dissolve the synthesized TPGS-TK-PEI in water, and obtain self-organizing nanoparticles by water bath ultrasound; mix the self-organizing nanoparticles with the single-plasmid integrated adenine base editor in a mass ratio of 2-10:1, and let stand at room temperature to obtain the integrated PCSK9 adenine base editing system.

[0052] Furthermore, the mass ratio of the self-organizing nanoparticles to the single-plasmid integrated adenine base editor includes 2:1, 3:1, 4:1, 5:1, 6:1, 7:1, 8:1, 9:1 or 10:1.

[0053] Further, the synthesis steps of the delivery vector TPGS-TK-PEI include:

[0054] S01: Propane-2,2-diylbis(thio)diacetic acid (abbreviated as TK) and amino polyethylene glycol 1000 vitamin E succinate (abbreviated as TPGS-NH2) are subjected to condensation acylation reaction under the catalysis of a catalyst to obtain ROS-sensitive vitamin E succinate polyethylene glycol 1000 (abbreviated as TPGS-TK);

[0055] S02: The TPGS-TK and polyethyleneimine polymer (abbreviated as PEI) are subjected to condensation acylation reaction under the catalysis of a catalyst to obtain a ROS-sensitive amphiphilic polymer (abbreviated as TPGS-TK-PEI).

[0056] It should be noted that the strategy of using the single plasmid system of the present invention as a template, transcribing in vitro into mRNA, and delivering and editing PCSK9, and providing alternative sequences similar or identical to those of the present invention, is an easily associated avoidance strategy and is also within the scope of protection of the present invention.

[0057] Beneficial technical effects:

[0058] (1) In view of the fact that the existing editors are multi-plasmid systems with low transfection and editing efficiency, the present invention innovatively proposes a single-plasmid integrated base editing system. Specifically, the present invention first provides an integrated base editor, which simultaneously expresses Cas protein and target gRNA in one plasmid; in addition, the integrated base editor is single-stranded cutting and has a built-in liver-specific promoter, so the integrated base editor can be specifically expressed in liver cells, and at the same time, it can overcome the need for traditional Crispr / gRNA technology to cut double-stranded DNA, greatly alleviating the off-target effect and uncertainty of gene editing; in addition, it can also overcome the problem of different efficiencies of two plasmids entering the same target cell and low editing efficiency in the traditional dual-plasmid system.

[0059] (2) Furthermore, the present invention synthesized a nanocarrier TPGS-TK-PEI, which has been verified to achieve efficient transfection in vitro and in vivo, and can also efficiently silence the target gene. Compared with commercial carriers, the nano delivery carrier synthesized by the present invention has lower cost and has the potential for large-scale promotion.

[0060] (3) Finally, the integrated base editing system synthesized by the present invention has been proven to be effective in both in vitro and in vivo animal experiments, and therefore has the potential to be put into clinical application. BRIEF DESCRIPTION OF THE DRAWINGS

[0061] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings required for use in the embodiments or the prior art descriptions are briefly introduced below. In all the drawings, similar elements or parts are generally identified by similar reference numerals. In the drawings, each element or part is not necessarily drawn according to the actual scale. Obviously, the drawings described below are some embodiments of the present invention. For those of ordinary skill in the art, other drawings can also be obtained based on these drawings without paying creative labor.

[0062] Figure 1 This is a schematic diagram of the construction process of a single-plasmid integrated adenine base editor in one embodiment of the present invention;

[0063] Figure 2 The structural formula of the delivery vector TPGS-TK-PEI synthesized in one of the embodiments of the present invention;

[0064] Figure 3 This is the horizontal gel electrophoresis result of the TPGS-TK-PEI plasmid adsorbed and loaded with the PCSK9 adenine base editor plasmid in one of the embodiments of the present invention;

[0065] Figure 4 This is a scanning electron micrograph of the integrated PCSK9 adenine base editing system ABE-TBG-PCSK9 NPs synthesized in one of the embodiments of the present invention (scale bar 200 nm);

[0066] Figure 5 The transfection results of the integrated PCSK9 adenine base editing system synthesized by the present invention and the control base editing system;

[0067] Figure 6 This is a graph showing the editing efficiency results of the integrated PCSK9 adenine base editing system synthesized by the present invention and the control base editing system;

[0068] Figure 7 The integrated PCSK9 adenine base editing system synthesized by the present invention silences PCSK9 in liver cancer cells in vitro and then inoculates transplanted tumors to inhibit tumor growth in vivo;

[0069] Figure 8 The results of inhibiting the growth of liver cancer transplanted tumors after silencing PCSK9 by injecting the integrated PCSK9 adenine base editing system synthesized by the present invention into animals;

[0070] Fig. 9 The integrated PCSK9 adenine base editing system synthesized by the present invention promotes CD8 + The result of T cell killing. DETAILED DESCRIPTION

[0071] In order to make the purpose, technical solution and advantages of the embodiments of the present invention clearer, the technical solution in the embodiments of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work are within the scope of protection of the present invention.

[0072] Herein "and / or" includes any and all combinations of one or more of the associated listed items.

[0073] Herein, "plurality" means two or more than two, ie, it includes two, three, four, five, etc.

[0074] As used in this specification, the term "about" typically means + / - 5% of the stated value, more typically + / - 4% of the stated value, more typically + / - 3% of the stated value, more typically + / - 2% of the stated value, even more typically + / - 1% of the stated value, and even more typically + / - 0.5% of the stated value.

[0075] In this specification, some embodiments may be disclosed in a format of being in a range. It should be understood that this description of "being in a range" is only for convenience and brevity, and should not be interpreted as a rigid limitation on the disclosed range. Therefore, the description of the range should be considered to have specifically disclosed all possible sub-ranges and independent numerical values ​​within this range. For example, the description of the range 1-6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6, etc., as well as individual numbers within this range, such as 1, 2, 3, 4, 5 and 6. Regardless of the breadth of the range, the above rules apply.

[0076] Some drawings are detailed:

[0077] Figure 5 In the figure, (A) Detection of cell transfection efficiency of double plasmid system ABE8.2m-EGFP and LRC-PCSK9; (B) Detection of cell transfection efficiency of single plasmid system ABE-TBG-PCSK9; (C) Transfection efficiency statistics.

[0078] Figure 6 In the figure, (A) is a statistical diagram of editing efficiency of the single-plasmid system and the dual-plasmid system. (B) is the silencing efficiency result of the integrated PCSK9 adenine base editing system on PCSK9 protein.

[0079] Understandably, Figure 5 and Figure 6All of the above are base editing systems, including delivery vectors. However, NPs are not shown in the figures.

[0080] Figure 7 In the figure, (A) PCSK9 was silenced in mouse liver cancer H22 and Hepa1-6 cell lines in vitro using the liver-specific integrated PCSK9 adenine base editing system to construct a Balb / C transplant tumor model. The tumor volume was measured every other day and statistical analysis was performed. (B, C) Deaths were recorded and survival analysis was performed. When the time endpoint was reached, the transplanted tumor was dissected and weighed. (D) Flow cytometry analysis revealed changes in immune cells in the transplanted tumor. (E) Fluorescence staining was used to detect CD8 + Changes in T cells and cytokine expression.

[0081] Figure 8 (A) Balb / C transplant tumor model was constructed using mouse liver cancer H22 cells. When the tumor volume reached about 100 mm 3 At the end of the time period, the liver-specific integrated PCSK9 adenine base editing system was injected into the tail vein. (B, C) The tumor volume was measured every other day for statistical analysis. (D, E) Deaths were recorded for survival analysis. When the time end point was reached, the transplanted tumor was dissected and weighed. (F) Flow cytometry analysis revealed changes in immune cells in the transplanted tumor. (G) Fluorescence staining was used to detect CD8 + Changes in T cells and cytokine expression.

[0082] Fig. 9 (A) CD8 was observed by fluorescence microscopy + Co-culture results of T cells and ABE-TBG-PCSK9 edited H22 liver cancer cells. (B) Cytotoxicity detection at different cell ratios.

[0083] Definition of noun:

[0084] The "integration" mentioned in the present invention means that a plasmid expression system of the present invention simultaneously expresses CRISPR / Cas9 protein and gRNA sequence targeting target DNA.

[0085] Example 1

[0086] This embodiment provides an example of an integrated PCSK9 adenine base editing system and a method for constructing the same.

[0087] The adenine base editing system provided in this embodiment includes the following:

[0088] (1) Single plasmid;

[0089] (2) PCSK9 adenine base editor;

[0090] (3) Delivery vehicle.

[0091] Among them, the PCSK9 adenine base editor includes U6 promoter structure, TBG promoter structure, AmpR promoter structure and plasmid backbone region.

[0092] It can be understood that a single plasmid plus a PCSK9 adenine base editor obtains a single plasmid integrated adenine base editor (abbreviated as ABE-TBG-PCSK9); and then a delivery vector encapsulates the single plasmid integrated adenine base editor to obtain an integrated PCSK9 adenine base editing system (abbreviated as ABE-TBG-PCSK9 NPs).

[0093] The U6 promoter structure includes a U6 promoter, a gRNA targeting PCSK9, and a gRNA scaffold, which functions to express a scaffold containing a gRNA targeting PCSK9 and then bind to the CRIPSR / Cas9 protein.

[0094] The TBG promoter structure includes a liver-specific TBG promoter, CRIPSR / Cas9 ABE protein, a P2A fragment, and an EGFP green fluorescent expression protein. Its function is to activate the CRIPSR / Cas9 ABE protein and the EGFP protein through the promoter.

[0095] AmpR promoter structure: contains AmpR promoter and ORI structure. Its function is to screen the bacterial species expressing plasmid in the amplification competent state.

[0096] The U6 promoter structure, the TBG promoter structure, and the AmpR promoter structure were connected together.

[0097] In a specific embodiment, the synthesized single plasmid integrated adenine base editor is 9014 bp in length, referred to as ABE-TBG-PCSK9, and its structural schematic is shown in Figure 1 .

[0098] The following Table 1 shows the sequence information of the integrated PCSK9 adenine base editor in this embodiment.

[0099] Table 1

[0100]

[0101]

[0102]

[0103]

[0104]

[0105]

[0106] Example 2

[0107] This example provides a specific preparation method for the integrated PCSK9 adenine base editing system synthesized in Example 1.

[0108] The experimental methods used in this example are all conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified.

[0109] 1. Example of the construction method of a single-plasmid all-in-one adenine base editor.

[0110] (1) Construction of plasmid “ABE8.2m-CMV-sgRNA”.

[0111] 1.1 Linearization of CRISPR / Cas9-EGFP fragment: Using the "ABE8.20m-EGFP" plasmid constructed independently in the laboratory as a template, the plasmid was linearized using the single restriction site MfeI non-restriction endonuclease.

[0112] 1.2 Amplification of U6 promoter-gRNA-gRNAscaffold fragment: Using the "LRC" plasmid as a template, primers were designed to amplify the U6 promoter-gRNA-gRNAscaffold fragment. Sticky ends that could complement the CRISPR / Cas9-EGFP fragment were added before and after the designed primers. The primers involved are as follows.

[0113] Table 2

[0114] SEQ ID Primers Sequence (5'-3') No.29 Forward Primer gcaaggcttgaccgacaattGGATCCgagggcctatttcccatgatt No.30 Reverse primer agcagattcttcatgcaattCgaattcaaaaaagcaccgact

[0115] 1.3 The CRISPR / Cas9-EGFP linearized vector was connected to the U6 promoter-gRNA-gRNA scaffold fragment.

[0116] Table 3

[0117]

[0118] 1.4 Connect plasmid to transform DH5α competent cells (Takara#9057): Thaw DH5α competent bacteria in an ice bath, take 5μL of the DNA connected in 1.3, add it to 25μL competent bacteria, and gently blow several times. After ice bathing for 30 minutes, heat shock accurately for 60 seconds in a 42℃ water bath, and then quickly move it into an ice bath for 1-2 minutes. Add 200μL of SOC medium or LB medium (without antibiotics) to the competent tube, and shake at 37℃ 200r / min for 1 hour to revive the bacteria. Centrifuge at 8000rpm for 2min, and the remaining 50μL of bacterial solution will be spread on the LB plate (containing antibiotics), and incubate it inverted at 37℃ overnight. Then pick 2-3 clones, add them to 1mL of LB medium containing antibiotics, shake at 37℃, 250r / min, and culture overnight, and send them for sequencing to detect whether the connection is successful.

[0119] (2) Construction of plasmid “ABE-TBG-sgRNA”.

[0120] 2.1 Linearization of ABE-TBG-sgRNA fragment: Using the "ABE8.2m-CMV-sgRNA" plasmid as a template, the plasmid was linearized using the single restriction site EcoRI and NotI non-restriction endonucleases.

[0121] 2.2 Synthesis of liver-specific promoter TBG promoter fragment: Using the "AAV-SaKKH TBG ABE8e-gRNAscaffold" plasmid as a reference, the TBG promoter was designed with sticky ends complementary to the linearized vector "ABE8.2m-CMV-sgRNA" before and after.

[0122] 2.3CRISPR / Cas9-EGFP linearized vector was linked to the U6 promoter-gRNA-gRNAscaffold fragment.

[0123] Table 4

[0124]

[0125] 2.4 The ligated plasmid was transformed into DH5α competent cells (Takara#9057) using the same method as 1.4.

[0126] (3) Construction of plasmid “ABE-TBG-PCSK9”.

[0127] 3.1 Linearization of ABE-TBG-PCSK9 fragment: Using the "ABE8.2m-TBG-sgRNA" plasmid as a template, the plasmid was linearized using the double restriction site BsmBI non-restriction endonuclease.

[0128] 3.2 PCSK9 gRNA synthesis: (i) PCSK9 gRNA was designed with the GT site at the end of the first exon of PCSK9, and the sequence was SEQ ID NO.31: 5'-GCCCATACCTTGGAGCAACGG-3'. (ii) PCSK9 gRNA was annealed.

[0129] Table 5

[0130] Reagents Dosage Sense F-gRNA oligo (diluted to 100 μM in ddH2O) 1μL Antisense R-gRNA oligo (diluted to 100 μM in ddH2O) 1μL T4 PNK (5' phosphatase) (NEB#M0201S) 0.5μL 10×T4 DNA Polynucleotide Kinase buffer(NEB#B0201S) 1μL ddH2O 6.5μL Total 10μL

[0131] PCR reaction program: 37℃30min, 95℃5min, 1℃ / min cooling, 25℃, infinite cycle. You can also put it directly into boiling water for 5min, cool it down to room temperature. Store at -20℃. Add 30μL H2O to dilute it 4 times, and store it at 4℃ for later use.

[0132] 3.3ABE-TBG-PCSK9 linearized vector is linked to PCSK9 gRNA.

[0133] Table 6

[0134]

[0135] 3.4 The ligated plasmid was transformed into DH5α competent cells (Takara#9057) using the same method as 1.4.

[0136] 2. Example of construction of a delivery vector encapsulating a single-plasmid integrated adenine base editor.

[0137] It is understandable that other commercially available delivery vehicles can also be used to encapsulate single-plasmid integrated adenine base editors, such as liposome vectors.

[0138] This embodiment proposes a nanocarrier encapsulating a single plasmid integrated adenine base editor, wherein the material constituting the nanocarrier includes a ROS-responsive vitamin E succinate polyethylene glycol 1000-polyethyleneimine polymer represented by the following formula: TPGS-TK-PEI, structural formula see Figure 2 The nanocarrier is obtained by covalently linking a ROS-sensitive thioketal linkage with vitamin E succinate polyethylene glycol 1000 as the hydrophobic end and polyethyleneimine as the hydrophilic end; ABE-TBG-PCSK9 and TPGS-TK-PEI form an integrated PCSK9 adenine base editing system ABE-TBG-PCSK9NPs through electrostatic interaction. The synthesis method of TPGS-TK-PEI is as follows:

[0139] (1) Synthesis of ROS-sensitive vitamin E succinate polyethylene glycol 1000 (TPGS-TK).

[0140] Propane-2,2-diylbis(thio)diacetic acid (abbreviated as TK) and amino polyethylene glycol 1000 vitamin E succinate (abbreviated as TPGS-NH2) undergo condensation acylation reaction under the catalysis of a catalyst to obtain ROS-sensitive vitamin E succinate polyethylene glycol 1000 (abbreviated as TPGS-TK). Specifically: propane-2,2-diylbis(sulfide)diacetic acid (TK) and the catalyst system N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC) / N-hydroxysuccinimide (NHS) are dissolved in N,N-dimethylformamide according to a molar ratio of (1:1.2-5:1-5) (preferably 1:1.2:1.2), reacted at room temperature for 0.5-4 hours (preferably 0.5 hours), and amino polyethylene glycol 1000 vitamin E succinate (TPGS-NH2) was added, the molar ratio of TK to TPGS-NH2 was 1:0.2-1 (preferably 1:0.5), reacted at room temperature for 12-24 hours (preferably 24 hours), dialyzed with water for 1-3 days, and the dialysate was freeze-dried to obtain ROS-sensitive vitamin E succinate polyethylene glycol 1000 (TPGS-TK).

[0141] (2) Synthesis of ROS-sensitive amphiphilic polymer (TPGS-TK-PEI).

[0142] ROS-sensitive vitamin E succinate polyethylene glycol 1000 (abbreviated as TPGS-TK) and polyethyleneimine polymer (abbreviated as PEI) undergo condensation acylation reaction under the catalysis of a catalyst to obtain a ROS-sensitive amphiphilic polymer (abbreviated as TPGS-TK-PEI). Specifically: TPGS-TK and the catalyst system N-(3-dimethylaminopropyl)-N′-ethylcarbodiimide hydrochloride (EDC) / N-hydroxysuccinimide (NHS) are dissolved in N,N-dimethylformamide according to a molar ratio of (1:1.2-5:1-5) (preferably 1:1.2:1.2), reacted at room temperature for 0.5-4 hours (preferably 0.5 hours), and polyethyleneimine polymer (PEI) is added, the molecular weight range of PEI is 600-25000Da, preferably a branched polyethyleneimine polymer with a molecular weight of 25000Da, the mass ratio of TPGS-TK to PEI is 1:1-10 (preferably 1:3), reacted at room temperature for 24-48 hours (preferably 48 hours), dialyzed with water for 1-3 days, and the dialysate was freeze-dried to obtain a ROS-sensitive amphiphilic polymer (TPGS-TK-PEI).

[0143] Take 5 mg of the synthesized ROS-sensitive amphiphilic polymer (TPGS-TK-PEI) and dissolve it in 5 ml of deionized water. After water bath sonication for 10 minutes, self-organized nanoparticles NPs are obtained. The nanocarrier is mixed with the single plasmid integrated adenine base editor ABE-TBG-PCSK in a mass ratio of 2-10:1 (preferably 4:1), and after standing at room temperature for 15 minutes, the integrated PCSK9 adenine base editing system nanoparticles (ABE-TBG-PCSK9 NPs) are obtained.

[0144] Horizontal gel electrophoresis was used to examine the ability of nanoparticles to load plasmids, laser particle size analyzer was used to examine the particle size and potential of nanoparticles, and transmission electron microscopy was used to examine the morphology of nanoparticles. The results of horizontal gel electrophoresis showed that the nucleic acid could be completely adsorbed when the mass ratio of nanoparticles to plasmids was 4:1; the particle size of NPs was 118.17±1.96nm, PDI was 0.164±0.005, and the zeta potential was 26.33±0.45mV. After loading plasmids, the particle size of ABE-TBG-PCSK9 NPs was 141.13±2.32nm, PDI was 0.171±0.036, and the potential dropped to 12.27±2.06mV; transmission electron microscopy showed that ABE-TBG-PCSK9 NPs were round and spherical, and the relevant results are shown in the characterization. Figure 3 , Figure 4 .

[0145] Table 7

[0146] Size(nm) PDI Zeta potential (mV) NPs 118.17±1.96 0.164±0.005 26.33±0.45 ABE-TBG-PCSK9 NPs 141.13±2.32 0.171±0.036 12.27±2.06

[0147] Among them, NPs represents TPGS-TK-PEI plasmid; ABE-TBG-PCSK9 NPs represents the integrated PCSK9 adenine base editing system.

[0148] Example 3

[0149] This example provides a comparative verification of the transfection efficiency of the integrated PCSK9 adenine base editing system (referred to as the single plasmid system) synthesized in Example 2 and the dual-plasmid base editing system (referred to as the dual-plasmid system).

[0150] The dual-plasmid base editing system provided in this embodiment is the "ABE8.20m-EGFP" plasmid for the reported expression of CRISPR / Cas9 ABE protein and the "LRC-PCSK9" plasmid for the expression of PCSK9 gRNA constructed experimentally. The sequence of the gRNA used in the "LRC-PCSK9" plasmid is shown in SEQ ID NO. 3. The length of "ABE8.20m-EGFP" in the dual-plasmid base editing system is 9297bp, and the length of "LRC-PCSK9" is 7393bp, which is close to the length of the single-plasmid system.

[0151] Experimental steps: 293FT cells were plated one day in advance, and 1×10 cells were transfected with the single plasmid system and the double plasmid system using the nanocarriers (NPs) synthesized in Example 2. 6 For 293FT cells per ml, the transfection dose for the dual-plasmid system was 0.5 μg of each plasmid, and the transfection dose for the single-plasmid system was 1 μg.

[0152] The transfection efficiency was observed under a fluorescence microscope 24 hours after transfection. The results showed that the integrated PCSK9 adenine base editing system had a higher transfection efficiency than the dual-plasmid system. Figure 5 (ABE8.2m-EGFP and LRC-PCSK9 represent the dual-plasmid system; ABE-TBG-PCSK9 represents the single-plasmid system). The yellow light in 5A represents the transfection efficiency of the dual-plasmid system into the cells. Green light alone or red light alone indicates no editing effect. The green light alone in 5B represents the transfection efficiency of the single-plasmid system into the cells. Obviously, the integrated PCSK9 adenine base editing system presents a higher fluorescence entering the cells. 5C is a statistical chart of the transfection efficiency of the two systems; it can be seen from the figure that the transfection efficiency of the single-plasmid system is significantly higher than that of the dual-plasmid system.

[0153] Example 4

[0154] The integrated PCSK9 adenine base editing system synthesized in Example 2 efficiently edits the PCSK9 gene in vitro and silences PCSK9 protein expression in liver cancer cells.

[0155] 1. Screening of gRNA targeting PCSK9.

[0156] Experimental steps: Using mouse or human genome as template, design PCSK9 gRNA at the 5'-GT-3' position at the end of the first exon of PCSK9, ensuring that the T in GT is located at the 3-8 position of gRNA to ensure the highest editing efficiency in vivo. (The gRNA design principle is that the length is between 17bp-24bp)

[0157] Table 8 Screened mouse PCSK9 gRNA

[0158] SEQ ID Mouse gRNA gRNA sequence (5'-3') BP No.12 mPCSK9-gRNA-1 ATACCTTGGAGCAACGG 17 No.13 mPCSK9-gRNA-2 CATACCTTGGAGCAACGG 18 No.14 mPCSK9-gRNA-3 CCATACCTTGGAGCAACGG 19 No.3 mPCSK9-gRNA-4 CCCATACCTTGGAGCAACGG 20 No.15 mPCSK9-gRNA-5 ACCCATACCTTGGAGCAACGG 21 No.16 mPCSK9-gRNA-6 CACCCATACCTTGGAGCAACGG 22 No.17 mPCSK9-gRNA-7 CCCATACCTTGGAGCAA 17 No.18 mPCSK9-gRNA-8 ACCCATACCTTGGAGCAA 18 No.19 mPCSK9-gRNA-9 CACCCATACCTTGGAGCAA 19

[0159] Table 9 Screened human PCSK9 gRNA

[0160] SEQ ID Human gRNA gRNA sequences BP No.20 hPCSK9-gRNA-1 GCACCTTGGCGCAGCGG 17 No.21 hPCSK9-gRNA-2 CGCACCTTGGCGCAGCGG 18 No.22 hPCSK9-gRNA-3 CCGCACCTTGGCGCAGCGG 19 No.23 hPCSK9-gRNA-4 CCCGCACCTTGGCGCAGCGG 20 No.24 hPCSK9-gRNA-5 ACCCGCACCTTGGCGCAGCGG 21 No.25 hPCSK9-gRNA-6 CACCCGCACCTTGGCGCAGCGG 22 No.26 hPCSK9-gRNA-7 CCCGCACCTTGGCGCAG 17 No.27 hPCSK9-gRNA-8 ACCCGCACCTTGGCGCAG 18 No.28 hPCSK9-gRNA-9 CACCCGCACCTTGGCGCAG 19

[0161] The above-synthesized integrated PCSK9 adenine base editing system was transfected into mouse liver cancer H22 cells or human liver cancer HepG2 cell lines. After 72 hours, the cells were collected to extract genomic DNA, and DNA fragments containing the editing sites were obtained by PCR amplification, and then gene sequencing was performed. The editing efficiency of the editing sites was calculated using Moriarity Lab-Edit R software. The editing efficiency results are shown in the table below.

[0162] Table 10 Editing efficiency data

[0163]

[0164]

[0165] 2. The integrated PCSK9 adenine base editing system efficiently edits the PCSK9 gene in vitro.

[0166] The dual-plasmid system prepared in Example 3 was still used as a control. mPCSK9-gRNA-4 was selected as the research object to construct a dual-plasmid transfection editing system. The synthesized dual-plasmid system and the integrated PCSK9 adenine base editing system were transfected into the mouse liver cancer H22 cell line, respectively. After 72 hours, the cells were collected to extract genomic DNA, and the DNA fragments containing the editing sites were amplified by PCR, and then gene sequencing was performed. The editing efficiency of the editing sites was calculated using Moriarity Lab-Edit R software. The editing results were analyzed, see Figure 6 A. The results show that the integrated PCSK9 adenine base editing system of the present invention can significantly edit the editing site, with an editing efficiency of 73±2.5%; the editing efficiency is much higher than that of the control dual-plasmid editing system, and the editing efficiency of the dual-plasmid editing system is only 54±3.5%.

[0167] 3. Integrated PCSK9 adenine base editing system inhibits PCSK9 protein expression in vitro

[0168] Protein extraction of mouse liver cancer H22 cells transfected with the integrated PCSK9 adenine base editing system (the following steps are all performed on ice). 72 hours after transfection, collect the cells, add cell lysis buffer (containing PMSF), blow with a gun tip or vortex to mix, and place the cell resuspension on ice for 30 minutes for cell lysis; put the ice into a small beaker, place the EP tube on ice, and turn the ultrasonic disruptor mode on for 5 seconds, off for 1 second, and repeat until the cells are broken for 1 minute. The broken cell solution was centrifuged at 13000 rpm and 4°C for 10 minutes. Carefully remove the EP tube, gently take the supernatant into another clean EP tube marked with the cell name and treatment conditions, and place it on ice to prepare for protein concentration determination.

[0169] The silencing efficiency of the integrated PCSK9 adenine base editing system on PCSK9 protein was further detected by Western blot. The results showed that after editing by the editing system, the protein expression of PCSK9 could be significantly silenced, and the silencing efficiency reached nearly 60% ( Figure 6 B).

[0170] Example 5

[0171] Mouse H22 liver cancer cells edited by the integrated PCSK9 adenine base editing system in vitro can also inhibit tumor growth in vivo. After the integrated PCSK9 adenine base editing system (ABE-TBG-PCSK9 NPs) synthesized in Example 2 edited and silenced PCSK9 in vitro, liver cancer transplants were inoculated to verify the inhibition of transplant tumor growth.

[0172] Experimental steps: H22 cell lines and Hepa1-6 cell lines transfected with ABE-TBG-PCSK9 NPs were used to construct subcutaneous transplant tumor models in Balb / C or C57 mice, respectively. The survival status of the mice was observed every other day and the changes in tumor volume were recorded. The mouse tumor volume curve and transplant tumor weight showed that the integrated PCSK9 adenine base editing system can significantly inhibit the growth of transplant tumors and prolong the survival of mice ( Figure 7 AC). Flow cytometry analysis revealed that CD8 + The proportion of T cells increased significantly, and IFNγ + CD8 + T cells and GzmB + CD8 + The proportion of T cells increased significantly, Treg cells and PD1 + CD8 + There was no significant change in the proportion of T cells ( Figure 7 D) Fluorescence staining was used to detect the CD8 + T cells, IFNγ + CD8 + T cells and GzmB + CD8 + The proportion of T cells increased significantly ( Figure 7 E).

[0173] The above results prove that the integrated PCSK9 adenine base editing system ABE-TBG-PCSK9NPs constructed by the present invention can effectively silence PCSK9 in mouse liver cancer cells, and the edited liver cancer cells can promote CD8 + T cell tumor infiltration inhibits transplanted tumor growth and prolongs mouse survival.

[0174] Example 6

[0175] Tail vein injection of the integrated PCSK9 adenine base editing system (ABE-TBG-PCSK9 NPs) synthesized in Example 2 into the liver cancer transplant tumor model can silence PCSK9 and inhibit the growth of liver cancer transplant tumors.

[0176] Experimental steps: The mouse liver cancer H22 cell line was used to construct a subcutaneous transplant tumor model in Balb / C mice. 3 Afterwards, Balb / C mice were randomly divided into two groups, and each group of mice was injected with ABE-TBG-PCSK9 NPs through the tail vein every three days. The survival status of the mice was observed every other day and the changes in tumor volume were recorded. The mouse tumor volume curve and transplanted tumor weight showed that ABE-TBG-PCSK9 NPs could significantly inhibit the growth of transplanted tumors and prolong the survival of mice ( Figure 8 AE). Flow cytometry analysis revealed that CD8 + The proportion of T cells increased significantly, and IFNγ + CD8 + T cells and GzmB + CD8 + The proportion of T cells increased significantly, while the proportion of Treg cells did not change significantly ( Figure 8 F) Fluorescence staining was used to detect CD8 + T cell ratio, IFNγ + CD8 + T cells and GzmB + CD8 + The proportion of T cells increased significantly ( Figure 8 G).

[0177] The above results prove that the integrated PCSK9 adenine base editing system constructed by the present invention can effectively silence PCSK9 in vivo and promote CD8 + T cell tumor infiltration inhibits transplanted tumor growth and prolongs mouse survival.

[0178] Example 7

[0179] Example 2 The synthesized integrated PCSK9 adenine base editing system ABE-TBG-PCSK9 NPs can promote CD8 + The killing effect of T cells.

[0180] Experimental steps: Examples 5 and 6 have demonstrated that in vivo experiments, ABE-TBG-PCSK9 NPs can promote mouse CD8 +In this example, the mouse liver cancer H22 cells transfected with ABE-TBG-PCSK9 NPs were further stained with calcein in vitro and then compared with CD8 + Mouse hepatoma cells were stained with calcein and co-cultured with different mouse CD8 + After 48 hours of co-culture with T cells, the death of liver cancer cells was detected by fluorescence microscopy and fluorescence microplate reader. + The killing ability of T cells on H22 liver cancer cells Fig. 9 AB).

[0181] It should be noted that, in this article, the term "includes", "comprising" or any other variation thereof is intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of more restrictions, an element defined by the sentence "comprising a ..." does not exclude the presence of other identical elements in the process, method, article or device including the element.

[0182] The embodiments of the present invention are described above in conjunction with the accompanying drawings, but the present invention is not limited to the above-mentioned specific implementation modes, which are merely illustrative rather than restrictive. Under the guidance of the present invention, ordinary technicians in this field can also make many forms without departing from the scope of protection of the present invention and the claims, all of which are within the protection of the present invention.

Claims

1. An integrated PCSK9 adenine base editing system, characterized in that: Includes the following structures: (1) Single plasmid; (2) a PCSK9 adenine base editor, comprising a U6 promoter structure, a TBG promoter structure, an AmpR promoter structure and a plasmid backbone region; Wherein, the U6 promoter structure comprises a gRNA targeting PCSK9; the gRNA targeting PCSK9 comprises a sequence selected from any one of SEQ ID NO.3 and SEQ ID NO.12-28; Wherein, the TBG promoter structure comprises a liver-specific TBG promoter sequence and a CRIPSR / Cas9ABE protein; The single plasmid and the PCSK9 adenine base editor form a single plasmid integrated adenine base editor; (3) delivery vehicle; The integrated adenine base editor is encapsulated by the delivery vector to form the integrated PCSK9 adenine base editing system.

2. The integrated PCSK9 adenine base editing system according to claim 1, characterized in that: The liver-specific TBG promoter sequence is shown as SEQ ID NO.

5.

3. The integrated PCSK9 adenine base editing system according to claim 1, characterized in that: The delivery vector comprises a nanocarrier, and the nanocarrier and the single-plasmid integrated adenine base editor form a stable complex through electrostatic interaction.

4. The integrated PCSK9 adenine base editing system according to claim 3, characterized in that: The nanocarrier has vitamin E succinate polyethylene glycol 1000 as a hydrophobic end, polyethylene imine as a hydrophilic end, and a ROS-sensitive ketal thiol linker covalently connected in the middle.

5. The integrated PCSK9 adenine base editing system according to claim 3, characterized in that: The nanocarrier is complexed with the single-plasmid integrated adenine base editor at a mass ratio of 2-10:

1.

6. The integrated PCSK9 adenine base editing system according to claim 1, characterized in that The delivery vehicles also include liposome vehicles.

7. Use of the integrated PCSK9 adenine base editing system according to any one of claims 1 to 6 in the preparation of liver cancer targeted preparations.

8. Use of the integrated PCSK9 adenine base editing system according to any one of claims 1 to 6 in the preparation of an immune cell immune efficacy enhancer.

9. A combined drug combination for targeted liver cancer treatment, characterized in that: The combination drug comprises the integrated PCSK9 adenine base editing system and immune cells as described in any one of claims 1-6.

10. The combined drug composition according to claim 9, characterized in that: The combined drug combination may also include other pharmaceutically feasible carriers and / or adjuvants.

Images