Detection method of porcine acute diarrhea syndrome coronavirus
By extracting and amplifying the SADS-CoV N gene, preparing monoclonal antibodies and fluorescent microsphere markers, assembling test strips for detection, it solved the problem that it is difficult to quickly and accurately detect SADS-CoV in the clinical primary layer, and achieved high sensitivity and specificity Sexy and convenient detection effect.
Patent Information
- Application Number
- CN202411656762.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-19
- Publication Date
- 2025-02-25
AI Technical Summary
The prior art is difficult to perform rapid and accurate detection of pig acute diarrhea syndrome coronavirus (SADS-CoV) at the clinical base, and the traditional methods are time-consuming and require expensive equipment and professionals.
cDNA was synthesized by extracting viral RNA from SADS-CoV for reverse transcription, and the SADS-CoV N gene was obtained by PCR amplification, recombinant plasmid was constructed, recombinant SADS-CoV N protein was expressed and purified, and monoclonal anti-SADS-CoV N protein was prepared Antibodies and antibodies labeled with fluorescent microspheres were assembled for testing.
It significantly improves the detection sensitivity and specificity of SADS-CoV, can detect infections early, reduce the risk of epidemic transmission, reduce detection costs, simplify operational processes, is suitable for grassroots diagnosis, and improves the efficiency of pig herd health management.
Smart Images
Figure CN119510756A_ABST
Abstract
Description
Technical Field
[0001] The invention relates to the technical field of medical detection, and in particular to a method for detecting porcine acute diarrhea syndrome coronavirus. Background Art
[0002] Porcine acute diarrhea syndrome coronavirus is a newly discovered porcine enteric coronavirus in recent years. The clinical symptoms of sick pigs are similar to those of other porcine enteric coronavirus infections and are difficult to distinguish. Currently, it can only be identified and judged through laboratory tests, among which viral nucleic acid detection is the most widely used in current laboratory identification detection methods. However, it requires large-scale test instruments and professional operators, which is not suitable for the promotion of clinical primary diagnosis.
[0003] At present, a relatively popular rapid detection technology at home and abroad is immunochromatography, which can be used as a main method of instant testing. It mainly uses colloidal gold or immune microspheres as a labeling carrier to catalyze color reactions in the area where antigens and antibodies are combined to achieve early rapid detection of pathogens. This detection method is fast, simple, sensitive, intuitive, and inexpensive. It can be detected on site and is in an important position in detection technology. It is a powerful supplement to traditional and large-scale instrument detection methods and is suitable for the promotion of clinical diagnosis. However, the above method is most widely used in laboratory identification detection methods and is not suitable for the promotion of clinical primary diagnosis. In addition, some researchers have prepared ELISA detection kits to detect SADS-CoV antigens, but ELISA detection takes a long time, and the method uses antibodies to SADS-CoV S protein as reporting antibodies. S protein is the most easily mutated protein in coronavirus, so the detection effect of mutant strains needs to be evaluated, which is time-consuming and laborious. For this reason, a detection method for porcine acute diarrhea syndrome coronavirus is proposed by a technician in this field to solve the above problems. Summary of the invention
[0004] In view of the deficiencies in the prior art, the present invention provides a method for detecting porcine acute diarrhea syndrome coronavirus, which solves the problems raised in the above-mentioned background technology.
[0005] To achieve the above objectives, the present invention is implemented by the following technical scheme: A method for detecting porcine acute diarrhea syndrome coronavirus, comprising the following steps:
[0006] S1, extract the viral RNA of SADS-CoV and perform reverse transcription to synthesize cDNA;
[0007] S2, obtain the SADS-CoV N gene by PCR amplification and construct a recombinant plasmid;
[0008] S3. Expression and purification of recombinant SADS-CoV N protein;
[0009] S4, preparing monoclonal antibodies against SADS-CoV N protein;
[0010] S5, preparing antibodies labeled with fluorescent microspheres;
[0011] S6, assembling the test strips, including the test line, the quality control line and the sample pad;
[0012] S7. Conduct sample testing and analyze the results.
[0013] Preferably, the construction of the recombinant plasmid in step S2 specifically comprises the following steps:
[0014] S201, PCR amplification of SADS-CoV N gene using specific primers;
[0015] S202, inserting the target gene into the pGEX-6p-1 vector by restriction endonuclease digestion;
[0016] S203. Transform the recombinant plasmid into DH5α competent cells for screening.
[0017] Preferably, the monoclonal antibody in step S4 comprises the following steps:
[0018] S401, mixing the purified SADS-CoV N protein with Freund's adjuvant and immunizing mice;
[0019] S402, prepare a monoclonal antibody cell line that stably expresses SADS-CoV N protein through cell fusion technology.
[0020] Preferably, the fluorescent microsphere antibody in step S5 comprises the following steps:
[0021] S501, combining fluorescent microspheres with SADS-CoV monoclonal antibodies through carbodiimide and N-hydroxysuccinimide cross-linking reactions;
[0022] S502. Block unreacted sites to improve specificity.
[0023] Preferably, assembling the test strip in step S6 specifically comprises the following steps:
[0024] S601, overlapping and pasting the treated sample pad, fluorescent marker binding pad, nitrocellulose membrane and absorbent paper in sequence;
[0025] S602. Use spraying technology to form detection lines and quality control lines on the nitrocellulose membrane.
[0026] Preferably, sensitivity detection is also included, and the sensitivity detection includes detecting SADS-CoV at different dilution multiples and recording the fluorescence signal intensity.
[0027] Preferably, specific detection is also included, wherein the specific detection is performed by reacting a cell culture known to contain other viruses with a test strip to observe a non-specific reaction.
[0028] Preferably, a repeatability test is also included, wherein the repeatability test includes selecting different batches of antigen immunofluorescence microsphere test strips for multiple tests and calculating the coefficient of variation.
[0029] The present invention provides a method for detecting porcine acute diarrhea syndrome coronavirus. It has the following beneficial effects:
[0030] 1. The present invention significantly improves the detection sensitivity and specificity of SADS-CoV by using recombinant SADS-CoV N protein and monoclonal antibodies. Compared with traditional PCR and ELISA detection, this method can identify the virus more accurately, especially when the viral load in the sample is low. This increase in sensitivity can detect infection early and facilitate timely prevention and control measures, thereby reducing the risk of epidemic spread. At the same time, the SADS-CoV fluorescent microsphere rapid detection test strip obtained in this study uses anti-N protein antibodies and uses fluorescent microspheres with europium as the luminescent element to label the antibodies. The sensitivity of the assembled test strip is consistent with the results of laboratory rt-PCR detection, and the method can perform preliminary quantification of the test samples.
[0031] 2. The present invention ensures the reliability and consistency of the test results by introducing sensitivity, specificity and repeatability test steps. By testing different batches of test strips multiple times and using different dilution multiples of viruses for verification, the stability and reproducibility of the test can be effectively evaluated. This scientific quality control process ensures the effectiveness of the test method, so that the test results not only have clinical reference value, but also provide reliable data support for subsequent epidemic control.
[0032] 3. Compared with the existing nucleic acid detection methods, the present invention does not require expensive large-scale equipment and professionals to operate, but relies on immunochromatography technology and test strips, which greatly simplifies the operation process. This feature enables grassroots diagnostic institutions to conduct on-site testing more conveniently, reduces testing costs, and increases clinical promotion applicability. This convenience also enables farms and grassroots veterinarians to quickly obtain test results, improving the efficiency of pig health management. BRIEF DESCRIPTION OF THE DRAWINGS
[0033] Figure 1 is a flow chart of the present invention;
[0034] Figure 2 It is an identification diagram of the SADS-CoV N recombinant protein in the embodiment of the present invention;
[0035] Figure 3 This is a graph showing the reaction between the IFA identification of monoclonal antibodies and Vero cells infected with SADS-CoV in the embodiment of the present invention;
[0036] Figure 4 This is a schematic diagram of the sensitivity of the test strip in an embodiment of the present invention;
[0037] Figure 5 Schematic diagram of PCR detection of clinical samples in an embodiment of the present invention. DETAILED DESCRIPTION
[0038] The following will be combined with the drawings in the specification of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.
[0039] Example:
[0040] Please refer to the attached Figure 1 - Attachment Figure 5 The present invention provides a method for detecting porcine acute diarrhea syndrome coronavirus, comprising the following steps:
[0041] S1, extract the viral RNA of SADS-CoV and perform reverse transcription to synthesize cDNA;
[0042] S2, obtain the SADS-CoV N gene by PCR amplification and construct a recombinant plasmid;
[0043] The construction of the recombinant plasmid in step S2 specifically includes the following steps:
[0044] S201, PCR amplification of SADS-CoV N gene using specific primers;
[0045] S202, inserting the target gene into the pGEX-6p-1 vector by restriction endonuclease digestion;
[0046] S203. Transform the recombinant plasmid into DH5α competent cells for screening.
[0047] Specifically, the viral RNA was extracted according to the instructions of the viral genomic RNA extraction kit (RNeasy Mini Kit, QIAGEN), and then reverse transcribed to synthesize cDNA, and the SADS-CoV N gene was amplified using specific primers with BamH I and Xho I restriction sites (SADS-CoV-N-F1: CTGGGATCCATGGCCACTGTTAATTGG; SADS-N-R1128: CCGCTCGAGCTAATTAATAATCTCATCCA). The pGEX-6p-1 empty vector and the PCR product were cut with BamH I and Xho I restriction endonucleases, and then the target gene was recovered, and the target gene obtained was connected by T4 DNA ligase, and the connection product was transformed into DH5α competent cells. Positive clones were screened, plasmids were extracted and sent to Guangzhou Shenggong Biotechnology Co., Ltd. for sequencing. The plasmid with the correct sequencing results was transformed into BL21 competent cells, and positive monoclonal bacteria were picked for a large number of induced expressions.
[0048] S3. Expression and purification of recombinant SADS-CoV N protein;
[0049] Specifically, the expression of the recombinant protein was identified by SDS-PAGE, the strain expressing the recombinant protein was induced to express in large quantities, and the protein was purified according to the purification steps of the GST-tagged protein.
[0050] S4, preparing monoclonal antibodies against SADS-CoV N protein;
[0051] The monoclonal antibody in step S4 includes the following steps:
[0052] S401, mixing the purified SADS-CoV N protein with Freund's adjuvant and immunizing mice;
[0053] S402, prepare a monoclonal antibody cell line that stably expresses SADS-CoV N protein through cell fusion technology.
[0054] Specifically, the purified SADS-CoV N protein was mixed with an equal amount of Freund's adjuvant and inoculated subcutaneously into the abdomen of 5 6-week-old BALB / c mice, with each inoculated with an antigen dose of 100 μg. Two weeks later, the same dose of antigen treated with Freund's incomplete adjuvant was injected. Three days before cell fusion, an equal amount of antigen without adjuvant (200 μg per mouse) was injected intraperitoneally for booster immunization once, and cell fusion was then performed.
[0055] Immunized mouse spleen cells and SP2 / 0 cells were mixed at a ratio of 5:1, and then PEG was added for fusion. The cells were cultured in a 96-well culture plate at 37°C in a CO2 incubator. When the hybridoma cells grew to 1 / 10 of the bottom area of the well, the supernatant was aspirated and positive hybridoma cells were screened by indirect ELISA and IFA. The positive wells were subcloned three times in a row by limiting dilution until all monoclonal wells were positive. The final monoclonal clone was expanded and cultured to establish a strain and cryopreserved.
[0056] 8-week-old BALB / c mice were intraperitoneally injected with Freund's incomplete adjuvant (0.5 ml per mouse). After 7 days, hybridoma cells in good growth state were intraperitoneally injected into BALB / c mice at a density of about 5×105 per mouse. Around 7 days, the abdomen of the mouse began to swell significantly. Ascites was repeatedly extracted, centrifuged at 2000r / min for 10 minutes to remove cell components and other precipitates, and the supernatant was collected. After purification, 0.02% sodium azide was added, aliquoted, and stored at -70°C. The ascites was diluted with PBS in increments, and the titer of the monoclonal antibody was determined by ELISA. Then the ascites was purified according to the HiTrap Protein G HPGE Healthcare antibody purification instructions.
[0057] S5, preparing antibodies labeled with fluorescent microspheres;
[0058] The fluorescent microsphere antibody in step S5 includes the following steps:
[0059] S501, combining fluorescent microspheres with SADS-CoV monoclonal antibodies through carbodiimide and N-hydroxysuccinimide cross-linking reactions;
[0060] S502. Block unreacted sites to improve specificity.
[0061] Specifically, 100 μL of Eu fluorescent microspheres with a solid content of 1% was diluted in 500 μL of 0.05 mol / L pH 8.0 boric acid buffer, 30 μL of 10 mg / mL carbodiimide and 60 μL of 10 mg / mL N-hydroxysuccinimide were added, and the mixture was activated at 50 rpm at room temperature on a rotary shaker for 15 min, then centrifuged at 40,000 g for 10 min, the supernatant solution was removed, and the mixture was re-dissolved with 0.05 mol / L pH 8.0 boric acid buffer, then ultrasonically treated at 80 W for 30 s, 50 μg of SADS-CoV monoclonal antibody was added, and the mixture was coupled at 50 rpm at room temperature on a rotary shaker for 2 hours, 50 μL of 50 mmol / L ethanolamine and 10% BSA solution was added for blocking overnight, and finally centrifuged at 40,000 g for 10 min, and washed with 0.05 mol / L The solution was reconstituted with boric acid buffer at pH 8.0, washed twice, and then ultrasonically treated at 80W for 30s. The solution was then stored in a refrigerator at 4°C for later use.
[0062] S6, assembling the test strips, including the test line, the quality control line and the sample pad;
[0063] The assembling of the test strip in step S6 specifically includes the following steps:
[0064] S601, overlapping and pasting the treated sample pad, fluorescent marker binding pad, nitrocellulose membrane and absorbent paper in sequence;
[0065] S602. Use spraying technology to form detection lines and quality control lines on the nitrocellulose membrane.
[0066] Specifically, the preparation of nitrocellulose membrane T line and C line
[0067] The SADS-CoV (3E8) antibody was dissolved in 0.01 mol / L pH7.4 phosphate buffer containing 1.5% (m / v) trehalose, 0.5% (m / v) bovine serum albumin, and 0.05% (v / v) SDS to a final concentration of 1.0 mg / mL, and sprayed with a film sprayer at 15 mm from the left end of the nitrocellulose membrane to form a detection line T line; the goat anti-mouse IgG monoclonal antibody was dissolved in 0.01 mol / L pH7.4 phosphate buffer containing 1.5% (m / v) trehalose, 0.5% (m / v) bovine serum albumin, and 0.05% (v / v) SDS to a final concentration of 1.0 mg / mL, and sprayed with a film sprayer at 22 mm from the left end of the nitrocellulose membrane to form a quality control line C line. The sprayed nitrocellulose membrane was dried at 37°C for 2 hours and stored in a dry environment at room temperature for later use.
[0068] Preparation of fluorescent marker conjugate pad
[0069] First, the fluorescent binding pad was soaked in 0.1 mol / L pH7.4 phosphate buffer containing 2.5% (m / v) trehalose, 1% (m / v) bovine serum albumin, 1% (v / v) tween-20, and 0.5% (m / v) PVP, and then dried in a 37°C oven for 2 hours. Then, the SADS-CoV antibody fluorescent microsphere marker and the mouse IgG fluorescent microsphere marker were diluted 500 times with 0.1 mol / L pH7.4 phosphate buffer, sprayed on the treated and dried binding pad, dried in a 37°C oven for 2 hours, and then stored in a sealed dry packaging bag for later use.
[0070] Sample pad handling
[0071] The glass cellulose membrane sample pad was soaked in PBS buffer (0.2 mol / L, pH 8.0) containing 10 mmol / L EDTA, 1% (v / v) tween-20, 0.5% (m / v) PVP, and 0.5% (m / v) BSA, and then baked in a 37°C oven for 2 hours until completely dry, and stored in a sealed dry packaging bag for later use.
[0072] Test strip assembly
[0073] Overlap and paste the following on the PVC backing: the treated sample pad, the fluorescent marker binding pad sprayed with the fluorescent marker probe, the nitrocellulose membrane sprayed with the detection line T line and the quality control line C line, and the absorbent paper in sequence. After assembly, cut into 4 mm wide test strips.
[0074] S7. Conduct sample testing and analyze the results.
[0075] 1. Detection
[0076] 1.1 also includes sensitivity testing, which involves testing SADS-CoV at different dilution multiples and recording the fluorescence signal intensity.
[0077] Specifically, 1 ml of SADS-CoV cell culture fluid (TCID50 is 104) was diluted 10 times with diluent to 1000, 100, 10 and 1 TC ID50 / mL, and 100 μL was drawn from the virus stock solution and each diluted sample and added to the sample well of the test strip, and inserted into the fluorescent immunoassay analyzer for reading after 10 minutes. According to the sensitivity of the test results of the fluorescent microsphere test strip, SADS-CoV with different dilutions was tested by rt-PCR, and the amplification primers of SADS-CoV nucleic acid were: SADS-CoV-N-F1: 5-ATGGCCACTGTTAATTGG-3; and SADS-CoV-N-R1: 5-CTAATTAATAATCTCATCCA-3.
[0078] 1.2 also includes specific detection, which is performed by reacting cell cultures known to contain other viruses with the test strip and observing non-specific reactions.
[0079] Specifically, cell cultures known to contain PEDV, TGEV, PDCoV, S IV, SVA, PRRSV, PRV and CSFV were reacted with the test strips, and the reaction results were detected.
[0080] 1.3 also includes repeatability testing, which involves selecting different batches of antigen immunofluorescence microsphere test strips for multiple tests and calculating the coefficient of variation.
[0081] Specifically, dilutions of SADS-CoV containing 1000TCID50 / ml and 100TCID50 / ml were selected for detection, and the SADS-CoV antigen immunofluorescence microsphere test strips from the same batch and 3 different batches of SADS-CoV antigen immunofluorescence chromatography test strips were tested respectively, and the intra-batch and inter-batch coefficients of variation were calculated.
[0082] Clinical data detection and comparison
[0083] Our laboratory stored 15 samples of diseased specimens from a pig farm in Qingyuan area where a SADS-CoV outbreak occurred in 2017 and conducted test strip and PCR tests to evaluate their clinical applicability.
[0084] 2 Results
[0085] 2.1 Expression and purification of SADS-CoV N recombinant protein
[0086] Please refer to the instruction manual Figure 2 (In the attached figure, 1: bacterial supernatant; 2: purified N protein), the pGEX-SADS-CoV-N recombinant plasmid was transformed into BL21 competent cells and induced for expression. SDS-PAGE identification showed that the recombinant protein was successfully expressed in the bacterial supernatant ( Figure 1 ). Purify the target protein from the bacterial supernatant.
[0087] 2.2 Identification of monoclonal cell lines expressing anti-SADS-CoV N protein
[0088] Please refer to the instruction manual Figure 3 After immunizing mice three times with purified SADS-CoV N protein, the spleen was aseptically removed and the spleen cells were fused with SP2 / 0 cells. The culture supernatant of the fused hybridoma cell line was screened by ELISA and IFA. A total of 5 cell lines stably expressing monoclonal antibodies against SADS-CoV N protein were obtained, which were named 5B2, 3E8, 5E12, 2B4, and 4A3. The IFA identification results are as follows Figure 2 It was identified that the heavy chain subclass of the 5 antibodies was IgG1, and the light chain subclass was κ.
[0089] 2.3 Screening of fluorescent microsphere-labeled antibodies and capture antibodies
[0090] The test results showed that among the five strains of antibodies against SADS-CoV N protein, 5B2 was suitable for labeling with fluorescent microspheres; 3E8 antibody was suitable for use as a capture antibody on the test strip. Antibodies secreted by other antibody strains were not suitable for the preparation of the test strip. Therefore, this study selected 5B2 and 3E8 antibodies for the establishment of the test strip.
[0091] 2.4 Sensitivity of test strips
[0092] Please refer to the instruction manual Figure 4 (1-5 are samples with SADS-CoV contents of 10000, 1000, 100, 10 and 1 TCID50 / mL; Figure A is the electrophoresis of SADS-CoV nucleic acid detected by PCR detection method; Figure B is the detection result by fluorescent microspheres). The diluted SADS-CoV cell culture with known virus titer was tested by rt-PCR detection and fluorescent microsphere test strips according to the operating instructions ( Figure 3 A and 3B), the test results are as follows: when the virus content is 100 TCID50 / mL, the rt-PCR test shows positive, and when the virus content is less than 100 TCID50 / mL, the result shows negative; the fluorescent test strip test shows that when the virus content is greater than 100 TC ID50 / mL, the test result is 32.96, and the result is positive. When the virus content is 1000 TCID50 / mL, the test result is 274.07, and the result is positive. When the virus content is 104 TCID50 / mL, the test result is greater than 640, and the result is strongly positive. Based on this result, it can be concluded that the sensitivity of the test strip matches the rt-PCR test result and can be used for clinical testing.
[0093] 2.5 Specificity experiments
[0094] Table 1 Specificity test results of SADS-CoV fluorescent microsphere rapid test strips
[0095]
[0096]
[0097] From the results, it can be seen that the cell culture tests of PEDV, TGEV, PDCoV, S IV, SVA, PRRSV, PRV and CSFV were all negative, and only the cell culture test of SADS-CoV was positive, indicating that the SADS-CoV fluorescent microsphere rapid detection test strip has good specificity and has no cross reaction with swine viruses.
[0098] 2.6. Repeatability Experiment
[0099] The dilutions of SADS-CoV containing 1000TCID50 / ml and 100TCID50 / ml were selected for detection, and the SADS-CoV fluorescent microsphere rapid test strips of the same batch were tested respectively to calculate the intra-batch coefficient of variation. Three different batches of SADS-CoV fluorescent microsphere rapid test strips were tested to calculate the inter-batch coefficient of variation. The results are shown in Table 2.
[0100] Table 2 Repeatability test results of SADS-CoV fluorescent microsphere rapid test strips
[0101]
[0102]
[0103] As can be seen from Table 2, the intra-batch coefficients of variation are 2.26% and 1.38% respectively, and the inter-batch coefficients of variation are 4.51% and 2.83% respectively. The intra-batch and inter-batch coefficients of variation are all below 10%, proving that the prepared test strips have good repeatability.
[0104] 2.7 Clinical application of test strips
[0105] Please refer to the instruction manual Figure 5 , 15 samples of diseased materials from the pig farm in Qingyuan area where SADS-CoV broke out in 2017 were stored in our laboratory for test strips and PCR tests. The rt-test results are as follows: 13 samples of diseased materials tested positive for SADS-CoV nucleic acid, and 2 samples were negative for SADS-CoV. The test results are shown in Table 3. Only samples 5 and 9 were negative for SADS-CoV, and the other 13 samples were positive for SADS-CoV. This result is consistent with the rt-PCR test results.
[0106] Table 3 Clinical sample data and judgment results of test strips
[0107]
[0108]
[0109] Note: Fluorescence value > 8TU / mL is positive, fluorescence value < 8TU / mL is negative
[0110] in conclusion:
[0111] The SADS-CoV fluorescent microsphere rapid test strip obtained in this study used anti-N protein antibodies and labeled the antibodies with fluorescent microspheres with europium as the luminescent element. The sensitivity of the assembled test strip was consistent with the results of laboratory rt-PCR testing. Moreover, this method can perform preliminary quantification of the test samples and digitize the test results, avoiding human subjective bias and providing technical conditions for the clinical primary diagnosis of SADS-CoV.
[0112] N protein is the nucleoprotein of SADS-CoV, which exists in large quantities in virus-infected hosts and cells. It is a highly conserved protein that is not easy to mutate. Therefore, the SADS-CoV fluorescent rapid test strip established by detecting N protein as an antigen can detect clinical samples. Although 5 cell lines that stably secrete monoclonal antibodies against SADS-CoV N protein were obtained in this study, experimental verification found that only 5B2 antibody and 3E8 antibody were suitable for the preparation of the test strip, and the other 3 antibodies were not suitable for the establishment of the SADS-CoV fluorescent test strip. This shows that there are certain functional differences in antibodies secreted by different cell lines.
[0113] At the same time, compared with the existing nucleic acid detection methods, the present invention does not require expensive large-scale equipment and professionals to operate, but relies on immunochromatography technology and test strips, which greatly simplifies the operation process. This feature enables grassroots diagnostic institutions to conduct on-site testing more conveniently, reduces testing costs, and increases clinical promotion applicability. This convenience also enables farms and grassroots veterinarians to quickly obtain test results, improving the efficiency of pig health management.
[0114] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.
Claims
1. A method for detecting porcine acute diarrhea syndrome coronavirus, characterized in that: The following steps are involved: S1, extract the viral RNA of SADS-CoV and perform reverse transcription to synthesize cDNA; S2, obtain the SADS-CoV N gene by PCR amplification and construct a recombinant plasmid; S3. Expression and purification of recombinant SADS-CoV N protein; S4, preparing monoclonal antibodies against SADS-CoV N protein; S5, preparing antibodies labeled with fluorescent microspheres; S6, assembling the test strips, including the test line, the quality control line and the sample pad; S7. Conduct sample testing and analyze the results.
2. The method for detecting porcine acute diarrhea syndrome coronavirus according to claim 1, characterized in that: The construction of the recombinant plasmid in the step S2 specifically comprises the following steps: S201, PCR amplification of SADS-CoV N gene using specific primers; S202, inserting the target gene into the pGEX-6p-1 vector by restriction endonuclease digestion; S203. Transform the recombinant plasmid into DH5α competent cells for screening.
3. The method for detecting porcine acute diarrhea syndrome coronavirus according to claim 1, characterized in that: The monoclonal antibody in step S4 comprises the following steps: S401, mixing the purified SADS-CoV N protein with Freund's adjuvant and immunizing mice; S402, prepare a monoclonal antibody cell line that stably expresses SADS-CoV N protein through cell fusion technology.
4. The method for detecting porcine acute diarrhea syndrome coronavirus according to claim 1, characterized in that: The fluorescent microsphere antibody in step S5 includes the following steps: S501, combining fluorescent microspheres with SADS-CoV monoclonal antibodies through carbodiimide and N-hydroxysuccinimide cross-linking reactions; S502. Block unreacted sites to improve specificity.
5. The method for detecting porcine acute diarrhea syndrome coronavirus according to claim 1, characterized in that: The assembling of the test strip in step S6 specifically includes the following steps: S601, overlapping and pasting the treated sample pad, fluorescent marker binding pad, nitrocellulose membrane and absorbent paper in sequence; S602. Use spraying technology to form detection lines and quality control lines on the nitrocellulose membrane.
6. The method for detecting porcine acute diarrhea syndrome coronavirus according to claim 1, characterized in that: It also includes sensitivity testing, which includes testing SADS-CoV at different dilution multiples and recording the fluorescence signal intensity.
7. The method for detecting porcine acute diarrhea syndrome coronavirus according to claim 1, characterized in that: Also included are specific tests, which are performed by reacting cell cultures known to contain other viruses with the test strip and observing nonspecific reactions.
8. The method for detecting porcine acute diarrhea syndrome coronavirus according to claim 1, characterized in that: The method also includes repeatability testing, which includes selecting different batches of antigen immunofluorescence microsphere test strips for multiple tests and calculating the coefficient of variation.